A primer probe set, kit, detection method and disease risk assessment method for detecting fusarium oxysporum f. sp. Nectria

By using specific primer and probe sets and qPCR amplification technology, the problems of low sensitivity and insufficient specificity in the detection of Fusarium wilt in melons were solved, a risk assessment and early warning system was established, and early warning and precise control were achieved, reducing yield loss from Fusarium wilt in melons.

CN122104994APending Publication Date: 2026-05-29INST OF PLANT PROTECTION HEBEI ACAD OF AGRI & FORESTRY SCI
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
INST OF PLANT PROTECTION HEBEI ACAD OF AGRI & FORESTRY SCI
Filing Date
2026-04-16
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Existing methods for detecting Fusarium wilt in melons are cumbersome, time-consuming, error-prone, have low sensitivity and insufficient specificity, making it difficult to detect low concentrations in the early stages. Furthermore, the lack of disease risk assessment methods makes it difficult to control the spread of the disease.

Method used

qPCR amplification was performed using the specific primer and probe set fp7406/fp7328 and the probe fp7406 7328. Based on the correlation analysis between the number of Fusarium wilt bacteria in melon and the occurrence of the disease, a risk assessment and early warning system was established.

Benefits of technology

It has achieved highly sensitive detection of Fusarium wilt in melons, with strong specificity, enabling early warning and precise control, reducing yield loss, and promoting the healthy and sustainable development of the melon industry.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104994A_ABST
    Figure CN122104994A_ABST
Patent Text Reader

Abstract

The application relates to the field of biotechnology, and discloses a primer probe set for detecting fusarium oxysporum, a kit, a detection method and a disease risk assessment method. The primer probe set comprises a specific primer pair fp7406 / fp7328 and a probe fp7406 7328 probe. The primer probe set can be used for qPCR amplification, and can accurately and quickly detect fusarium oxysporum and has high specificity. According to the correlation analysis between the quantity of fusarium oxysporum and the occurrence of fusarium wilt of melon, a risk assessment method for fusarium wilt of melon is established. When the quantity of fusarium oxysporum exceeds 1x10 4 spores / gram of soil, it is high risk.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a primer and probe set, reagent kit, detection method, and disease risk early warning method for detecting Fusarium wilt in melons. Background Technology

[0002] As a typical soil-borne vascular disease, melon wilt is caused by infection with Fusarium oxysporum and other melon wilt fungi. It occurs widely in all melon producing areas and has become a major bottleneck restricting the high-quality development of the melon industry.

[0003] Detection of Fusarium wilt in melons is a prerequisite for precise disease control. Currently, existing detection methods mainly include traditional morphological identification and conventional PCR detection. Traditional morphological identification relies on the professional experience of operators, is cumbersome and time-consuming, and is difficult to distinguish between Fusarium wilt in melons and other closely related Fusarium species, making identification errors easy to occur. Although conventional PCR detection is more efficient than traditional methods, it suffers from insufficient specificity and low sensitivity, is easily affected by complex soil matrix, producing false positives, and cannot achieve early detection of low concentrations of pathogens, making it difficult to meet the needs of rapid and accurate detection in the field.

[0004] Meanwhile, existing detection methods can only achieve qualitative or simple quantitative detection, lacking supporting disease risk assessment methods. They cannot combine detection results to guide growers to take preventive measures in advance, making it difficult to contain the spread of diseases after they occur. Summary of the Invention

[0005] The purpose of this invention is to provide a primer and probe set for Fusarium wilt of melon, which can rapidly detect Fusarium wilt of melon with high sensitivity and strong specificity.

[0006] The second objective of this invention is to provide a kit for detecting Fusarium wilt in melons, which has good compatibility and is easy to operate.

[0007] The third objective of this invention is to provide a method for detecting Fusarium wilt in melons, with a standardized and regulated testing process that ensures the accuracy of the test results.

[0008] The fourth objective of this invention is to provide a method for risk assessment of Fusarium wilt in melons, enabling early warning and precise control of Fusarium wilt in melons, thereby reducing yield losses.

[0009] To achieve the above objectives, the present invention adopts the following technical solution:

[0010] This invention provides a primer and probe set for detecting Fusarium wilt in melons, including the specific primer pair fp7406 / fp7328 and the probe fp7406 / fp7328, the nucleotide sequences of which are as follows:

[0011] fp7406: TGAAAGTCTTGGCGGGTGT (SEQ ID No. 1);

[0012] fp7328: TCCTCTCCATCCTCATCAGT (SEQ ID No. 2);

[0013] fp7406 7328 probe: FAM-CACTCGTCTTGGTATTCCCTCGGACCTT-BHQ1 (SEQ ID No. 3).

[0014] The present invention provides a kit for detecting Fusarium wilt in melons, the kit comprising the aforementioned primer and probe set and PCR amplification reagents.

[0015] As one implementation method, the PCR amplification reagent is a 25 µL system, with the following composition: rTaq enzyme 0.5 µL, Mg 2+ 3 µL, 10×PCR buffer 2.5 µL, dNTP 2.0 µL, specific primer pairs and probes 1.0 µL each, DNA template 5 µL, BSA 5 µL, ddH2O 4 µL.

[0016] As one embodiment, the kit for detecting Fusarium wilt of melon of the present invention further includes a positive control and a negative control. The positive control includes genomic DNA of Fusarium wilt of melon or plasmid DNA containing the Fusarium wilt of melon FomSIX6 gene, and the negative control does not contain genomic DNA of Fusarium wilt of melon or the Fusarium wilt of melon FomSIX6 gene.

[0017] The present invention provides the application of the above-mentioned primer and probe set or the above-mentioned kit in the detection of Fusarium wilt in melon.

[0018] The present invention also provides a method for detecting Fusarium wilt in melons, wherein total DNA is extracted from the sample to be tested, and qPCR amplification is performed using the primer and probe set or kit described above. The sample that produces an effective amplification value is Fusarium wilt in melons.

[0019] As one implementation method, the qPCR amplification conditions are: 95℃ pre-denaturation for 1 min; 95℃ denaturation for 30 s, 60℃ annealing for 45 s, for a total of 45 cycles.

[0020] This invention also provides a method for risk assessment of melon wilt disease. The method involves detecting *Fusarium wiltii* in the soil using the above method. When the number of *Fusarium wiltii* in the soil is less than 1 × 10⁻⁶, the risk assessment method is more accurate. 3 When the number of spores / gram of soil is low, the risk is low; when the number of Fusarium wilt pathogens is 1×10⁻⁶, the risk is low. 3 ~1×10 4When the number of spores / grams of soil is between 100 and 100, it is considered medium risk; when the number of Fusarium wilt pathogens exceeds 1000, it is considered medium risk. 4 When the spore count is equal to the soil level, it indicates a high risk.

[0021] As one implementation method, when the number of Fusarium wilt bacteria in the soil is less than 1×10⁻⁶ 3 When the number of spores / gram of soil is less than 10, the disease index of Fusarium wilt in melons is less than 10; when the number of Fusarium wilt fungi is 1×10 3 ~1×10 4 When the number of spores / soil is between 10 and 25, the disease index of Fusarium wilt in melons is 10-25; when the number of Fusarium wilt fungi exceeds 1×10⁻⁶, the disease index of Fusarium wilt in melons is 10-25. 4 When the spore count is equal to the soil density, the disease index of wilt disease in melons is greater than 25.

[0022] Compared with the prior art, the present invention has the following advantages and effects:

[0023] (1) High sensitivity: qPCR amplification of *Fusarium wilt* in melon using the primer and probe set of this invention achieved a detection sensitivity of 50 copies / μL. The detection sensitivity for *Fusarium wilt* in soil was 10. 3 copies / g soil.

[0024] (2) High specificity: The primer and probe set designed by this invention for Fusarium wilt of melon can specifically identify Fusarium wilt of melon. It has high specificity and can quickly and accurately complete the detection of Fusarium wilt of melon.

[0025] (3) Based on the correlation analysis between the number of Fusarium wilt bacteria and the occurrence of Fusarium wilt in melon, this invention establishes a risk assessment and early warning system for Fusarium wilt in melon. This system has significant practical significance and application value for achieving early warning and precise control of Fusarium wilt in melon, reducing yield losses, and promoting the healthy and sustainable development of the melon industry. Attached Figure Description

[0026] Figure 1 The amplification curves for the specific detection of *Fusarium oxysporum* melon-specific strains in this invention are shown. The red curve representing the peak DNA is the *Fusarium oxysporum* melon-specific strain genome. The remaining green curves represent *Fusarium oxysporum* wilt-specific strain, *Fusarium oxysporum* cucumber-specific strain, *Fusarium oxysporum* winter melon-specific strain, *Fusarium oxysporum* watermelon-specific strain, *Fusarium oxysporum* tobacco-specific strain, *Fusarium oxysporum* pepper-specific strain, *Fusarium oxysporum* sunflower-specific strain, *Fusarium graminearum*, *Fusarium pseudograminearum*, *Rhizoctonia solani*, *Verticillium dahliae*, *Fusarium oxysporum*, *Fusarium trifidum*, *Fusarium moniliforme*, *Fusarium equisetifolium*, *Fusarium collodion*, *Fusarium solanum*, *Fusarium rotundum*, *Fusarium pubescens*, *Fusarium scutellarioides ...

[0027] Figure 2 This is the standard curve for the *Fusarium wilt* bacterium of melon in this invention.

[0028] Figure 3 The correlation between the amount of Fusarium wilt bacteria in the soil and the occurrence of melon diseases.

[0029] Figure 4 The relationship between the number of Fusarium oxysporum cultivars in melon and the occurrence of diseases. Detailed Implementation

[0030] The present invention will be further described below with reference to specific embodiments, but the present invention is not limited to the following embodiments. Unless otherwise specified, the experimental methods used in the embodiments are conventional methods, and the materials and reagents used are commercially available unless otherwise specified.

[0031] Example 1

[0032] Specificity of the primer and probe set of Fusarium wilt in melon

[0033] In this embodiment, based on the melon virulence-related effector FomSIX6 (Fusarium oxysporum f. sp. melonis Secreted in Xylem 6), a set of specific primers fp7406 / fp7328 and probe fp7406 7328 were screened and optimized for the specific detection of Fusarium oxysporum (melon-specific Fusarium oxysporum), as follows:

[0034] fp7406: TGAAAGTCTTGGCGGGTGT;

[0035] fp7328: TCCTCTCCATCCTCATCAGT;

[0036] fp7406 7328 probe: FAM-CACTCGTCTTGGTATTCCCTCGGACCTT-BHQ1.

[0037] Using DNA from Fusarium wilt of melon and other common soil-borne pathogens as templates, qPCR was used to amplify the DNA and verify the specificity of the primers and probes for Fusarium wilt of melon.

[0038] The PCR amplification system was a 25 µL system, and the contents were as follows: rTaq enzyme 0.5 µL, Mg 2+ 3 µL, 10×PCR buffer 2.5 µL, dNTP 2.0 µL, specific primers and probes 1.0 µL each, DNA template 5 µL, BSA 5 µL, ddH2O 4 µL.

[0039] The qPCR amplification conditions were: 95℃ pre-denaturation for 1 min; 95℃ denaturation for 30 s, 60℃ annealing for 45 s, for a total of 45 cycles.

[0040] The results showed that only qPCR amplification using *Fusarium wiltii* DNA as a template produced amplification values, while amplification using DNA from other pathogens as templates did not produce detection values. Figure 1 This indicates that the specific primers and probes used to detect Fusarium wilt in melons have high specificity.

[0041] Example 2

[0042] Sensitivity determination of the detection system

[0043] Using the genome of *Fusarium wiltii* as a template, amplification was performed using the specific primer and probe set from Example 1. The amplified product was purified and cloned into the vector pMD18-T. The vector was then transformed into *Escherichia coli* DH5α competent cells by heat shock transformation for propagation. The cells were plated on LB medium containing ampicillin for recombinant screening. PCR verification yielded a recombinant plasmid containing a *Fusarium wiltii*-specific sequence.

[0044] The recombinant plasmid DNA was extracted and linearized by digestion with the restriction enzyme EcoRI. The digestion products were subjected to agarose gel electrophoresis, and the corresponding fragments were recovered by gel extraction. The fragments were recovered using the Promega Gel Extraction Kit. The DNA concentration of the recombinant plasmid was determined using a Thermo Fisher Nanodrop 2000 spectrophotometer, and the copy number of the recombinant plasmid DNA was calculated according to the formula.

[0045] The above plasmid vector was diluted to 1×10⁻⁶ using ddH₂O. 6 1×10 5 1×10 4 1×10 3 1×10 2 1×10 1 1 copy / μL dilution buffer. Using the linearized recombinant plasmids obtained from the above copy number serial dilutions as templates, real-time quantitative PCR was performed using the TaqMan fluorescent probe method to establish a standard curve of plasmid copy number versus Ct value. The results showed that the standard curve for the *Fusarium oxysporum* melon-specific type was: y = -3.33x + 40.84, R... 2 =1.00, sensitivity of 50 copies / reaction system, suitable for quantitative detection of Fusarium wilt in melon ( Figure 2 ).

[0046] We prepared inoculum soil by quantitatively inoculating it with different concentrations of Fusarium wilt in melon. After extracting total DNA from the inoculum soil, we used the Fusarium wilt-specific primers and probes from Example 1 to perform qPCR quantitative detection.

[0047] The results are shown in Table 1. When the soil bacterial count was low, qPCR showed no amplification signal; when the inoculum size reached 10... 3 Stable amplification signals can be obtained when the spore count / gram soil concentration is 10 or higher. This indicates that the established quantitative detection system for *Fusarium oxysporum* in melons has a detection sensitivity of 10⁻⁶ for *Fusarium oxysporum* in soil samples. 3 Spores / gram of soil.

[0048] Table 1. Soil DNA qPCR detection at different inoculum amounts

[0049]

[0050] Example 3

[0051] Correlation between the amount of Fusarium wilt in soil and the occurrence of melon diseases

[0052] Under greenhouse conditions, a suspension of *Fusarium wilt* spores from melons was evenly mixed into sterilized and dried soil substrate to ensure a uniform bacterial load throughout the soil, resulting in a substrate with a bacterial load of 10. 7 spores / gram, 10 6 spores / gram, 10 5 spores / gram, 10 4 spores / gram, 10 3 Spores / gram of soil; soil without pathogens served as a blank control. After germination, melon seeds were placed in seedling trays containing soils with different amounts of pathogens. 100 grams of inoculum-containing soil was collected from each gradient, dried, and DNA was extracted. Greenhouse cultivation conditions were 25°C during the day and 18°C ​​at night. Disease incidence was assessed after 50 days. Simultaneously, 100 grams of inoculum-containing soil was collected from each gradient, dried, and DNA was extracted. Following the method in Example 1, qPCR was used to detect the pathogen count in the pre-seeding soil. Combined with disease surveys, the correlation between pathogen count and the severity of melon wilt disease was analyzed.

[0053] The results showed that the severity of melon wilt disease gradually increased with increasing pathogen concentration, and the disease severity increased when the pathogen concentration in the soil exceeded 10. 4 When the spore count / gram of soil was high, the disease index increased significantly ( Figure 3 ).

[0054] Example 4

[0055] Melon Fusarium wilt disease risk assessment and early warning system

[0056] Based on the analysis of the relationship between the abundance of *Fusarium wilt* in the soil and the occurrence of *Fusarium wilt* disease in melon, an early warning system for *Fusarium wilt* disease in melon was established. Specifically, when the abundance of *Fusarium wilt* in the soil is below 1×10⁻⁶, an early warning system for *Fusarium wilt* disease in melon is established. 3 When the spore count / gram of soil is less than 10, the risk of wilt disease in melons is defined as low; when the number of Fusarium wilt pathogens in melons is less than 1×10⁻⁶, the risk of wilt disease is defined as low. 3 ~1×10 4 When the spore count / soil density is between 10-25, the disease index is considered medium risk for melon wilt; however, when the number of Fusarium wilt pathogens exceeds 1×10⁻⁶, the disease risk is considered medium risk. 4 When the spore count / gram of soil reaches a disease index greater than 25, the occurrence of Fusarium wilt in melons is severe, defined as high risk. The establishment of this early warning system provides an effective disease prediction tool for melon cultivation, helping farmers to take appropriate control measures in the early stages, thereby reducing the impact of diseases on crop yield and quality.

[0057] Table 2 Risk Assessment of Fusarium Wilt in Melon

[0058]

[0059] The above embodiments are the best implementations of the present invention, but the implementations of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. A primer and probe set for detecting Fusarium wilt in melons, characterized in that, It includes a specific primer pair fp7406 / fp7328 and a probe fp7406 7328 probe, the nucleotide sequence of fp7406 is shown in SEQ ID No. 1, the nucleotide sequence of fp7328 is shown in SEQ ID No. 2, and the nucleotide sequence of fp7406 7328 probe is shown in SEQ ID No.

3.

2. A kit for detecting Fusarium wilt in melons, characterized in that, The kit includes the primer and probe set and PCR amplification reagents as described in claim 1.

3. The reagent kit according to claim 2, characterized in that, It also includes a positive control and a negative control. The positive control includes genomic DNA of Fusarium wilt of melon or plasmid DNA containing the Fusarium wilt of melon FomSIX6 gene, and the negative control does not contain genomic DNA of Fusarium wilt of melon or the Fusarium wilt of melon FomSIX6 gene.

4. The kit according to claim 2 or 3, characterized in that, The PCR amplification reagent was prepared in a 25 µL system, as follows: rTaq enzyme 0.5 µL, Mg... 2+ 3 µL, 10×PCR buffer 2.5 µL, dNTP 2.0 µL, specific primer pairs and probes 1.0 µL each, DNA template 5 µL, BSA 5 µL, ddH2O 4 µL.

5. The application of the primer and probe set according to claim 1 or the kit according to any one of claims 2 to 4 in the detection of Fusarium wilt in melon.

6. A method for detecting Fusarium wilt in melons, characterized in that, Total DNA is extracted from the sample to be tested, and qPCR amplification is performed using the primer and probe set described in claim 1 or the kit described in any one of claims 2 to 4. The sample that produces a valid amplification value is Fusarium wilt of melon.

7. The method for detecting Fusarium wilt in melons according to claim 6, characterized in that, The qPCR amplification conditions were: 95℃ pre-denaturation for 1 min; 95℃ denaturation for 30 s, 60℃ annealing for 45 s, for a total of 45 cycles.

8. A method for risk assessment of wilt disease in melons, characterized in that, The method described in claim 6 is used to detect Fusarium wilt in soil. When the number of Fusarium wilt in the soil is less than 1 × 10⁻⁶, the result is considered satisfactory. 3 When the number of spores / gram of soil is low, the risk is low; when the number of Fusarium wilt pathogens is 1×10⁻⁶, the risk is low. 3 ~1×10 4 When the number of spores / grams of soil is between 100 and 100, it is considered medium risk; when the number of Fusarium wilt pathogens exceeds 1000, it is considered medium risk. 4 When the spore count is equal to the soil level, it indicates a high risk.

9. The method according to claim 8, characterized in that, When the number of Fusarium wilt bacteria in the soil is less than 1×10 3 When the number of spores / gram of soil is less than 10, the disease index of Fusarium wilt in melons is less than 10; when the number of Fusarium wilt fungi is 1×10 3 ~1×10 4 When the number of spores / soil is between 10 and 25, the disease index of Fusarium wilt in melons is 10-25; when the number of Fusarium wilt fungi exceeds 1×10⁻⁶, the disease index of Fusarium wilt in melons is 10-25. 4 When the spore count is equal to the soil density, the disease index of wilt disease in melons is greater than 25.