InDel molecular marker for synchronously improving fiber strength and lint percentage of cotton and application thereof

By detecting nucleotide sequence variations at base 8234514 on chromosome D06 of the cotton genome using InDel molecular markers, the problem of simultaneously improving cotton fiber strength and lint percentage in traditional breeding methods has been solved. This has achieved rapid and accurate simultaneous improvement, thereby increasing the selection efficiency and economic benefits of new cotton varieties.

CN122104997APending Publication Date: 2026-05-29COTTON RES INST HEBEI ACAD OF AGRI & FOREST SCI
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
COTTON RES INST HEBEI ACAD OF AGRI & FOREST SCI
Filing Date
2026-04-21
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Traditional breeding methods are difficult to improve cotton fiber strength and lint percentage simultaneously, and suffer from problems such as long selection cycles, high costs, and low accuracy.

Method used

Using InDel molecular markers, by detecting nucleotide sequence variations at nucleotide 8234514 on chromosome D06 of the cotton genome, cotton plants carrying the homozygous C genotype were selected as breeding parents using InDel molecular marker-assisted selection, thereby achieving simultaneous improvement of fiber strength and lint percentage.

Benefits of technology

It enables rapid and accurate simultaneous improvement of cotton fiber strength and lint percentage, thereby increasing the efficiency and economic benefits of selecting new cotton varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122104997A_ABST
    Figure CN122104997A_ABST
Patent Text Reader

Abstract

The application discloses an InDel molecular marker for synchronously improving fiber strength and lint percentage of cotton and application, and belongs to the field of cotton biotechnology.The InDel molecular marker is located at the 8234514 base of a cotton genome D06 chromosome; the InDel molecular marker is a nucleotide sequence shown in SEQ ID NO.1, and the 101th base of the nucleotide sequence is an insertion or deletion.The InDel marker provided by the application can assist in simultaneously identifying the high and low of fiber strength and lint percentage, and the fiber strength and lint percentage of cotton plants with a genotype of deletion are significantly higher than those of individuals with a genotype of insertion.The molecular marker disclosed by the application has very great application value for identifying comprehensive excellent traits of cotton, and has important significance for accelerating the breeding of new cotton varieties with high quality and high yield and improving the economic benefits of cotton.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of cotton biotechnology, and in particular to an InDel molecular marker and its application for simultaneously improving cotton fiber strength and lint percentage. Background Technology

[0002] cotton( Gossypium spp Cotton is the only crop that produces fiber from seeds. As an important natural fiber raw material, it has a significant impact on national economic development and farmers' income. In recent years, with the shrinking of cotton-growing land, mechanized harvesting, and the upgrading of textile technology, the focus of ensuring stable cotton supply has shifted to improving quality and yield through improved varieties and cultivation methods. Simultaneously improving cotton fiber quality and yield traits is necessary for social development and the improvement of people's quality of life, and is also a major measure to increase cotton planting income, making it a key task in current cotton breeding research.

[0003] Fiber strength (FS) and lint percentage (LP), core traits of cotton fiber quality and yield, are both complex quantitative traits controlled by multiple genes. Furthermore, there is a significant negative genetic correlation between fiber strength and lint percentage, making simultaneous improvement difficult (Li et al. Genome-wide artificial introgressions of Gossypium barbadense into G.hirsutum Reveal superior loci for simultaneous improvement of cotton fiber quality and yield traits. Journal of Advanced Research. 2023, 53:1-16. Because the selection process in traditional breeding mainly focuses on phenotypic selection, and phenotypic traits are easily affected by external conditions such as the environment, traditional breeding makes it difficult to break the linkage of unfavorable genes, resulting in long selection cycles, high costs, and low accuracy.

[0004] The development of molecular markers facilitates genetic selection of traits at the chromosome level. Molecular markers are not limited by individual tissues and developmental stages, nor are they affected by environmental conditions. They can be used for rapid and accurate detection of target genes and targeted improvement. Molecular marker-assisted selection technology is currently an effective method to overcome the bottlenecks of conventional breeding and improve the selection efficiency in breeding (Bailey et al. Genetic strategies for improving crop yields. Nature. 2019Nov;575(7781):109-118).

[0005] Insertion-deletion (InDel) markers refer to the insertion or deletion of nucleotide fragments of different sizes at the same locus in the genome of closely related species or different individuals of the same species. This phenomenon is caused by gaps created during homologous sequence alignment. InDels are widely distributed, densely packed, and numerous in the genome. InDel molecular markers have strong genetic effects, high accuracy, good stability, and are simple and convenient to detect, and have been applied in germplasm resource analysis, molecularly assisted genetic breeding, and the construction of genetic maps (Yang et al. Recent progression and future perspectives incotton genomic breeding. J. Integr. Plant Biol. 2023, 65, (2), 548-569). In recent years, with the continuous advancement of sequencing technology, the detection cost, reliability, and timeliness of InDels have been continuously improving in a way that is beneficial to research, making it possible to break gene linkage and simultaneously improve multiple traits. Summary of the Invention

[0006] The purpose of this invention is to provide an InDel molecular marker and its application for simultaneously improving cotton fiber strength and lint percentage, thereby solving the problems existing in the prior art. This invention provides a method for efficiently and accurately identifying and screening cotton with simultaneously improved fiber strength and lint percentage using InDel molecular markers.

[0007] To achieve the above objectives, the present invention provides the following solution: One of the technical solutions of the present invention is an InDel molecular marker related to cotton fiber strength and lint percentage, wherein the InDel molecular marker is located at base 8234514 on chromosome D06 of the cotton genome; The InDel molecular marker is the nucleotide sequence shown in SEQ ID NO.1, where the 101st base is an insertion or deletion.

[0008] The second technical solution of the present invention is a method for identifying cotton fiber strength and lint percentage traits, comprising the following steps: detecting the genotype of the InDel molecular marker in the genomic DNA of the cotton sample to be tested, and determining the fiber strength and lint percentage traits based on the genotype.

[0009] The third technical solution of the present invention is the application of the InDel molecular marker in the breeding of cotton fiber strength and / or lint percentage traits.

[0010] The fourth technical solution of the present invention is a breeding method for cotton fiber strength and / or lint percentage traits, comprising the following steps: using the InDel molecular marker to perform genotyping on cotton germplasm resources, selecting individuals with missing genotypes as breeding parent materials, or using them to screen cotton plants with simultaneous improvement in fiber strength and lint percentage.

[0011] Based on the above technical solution, the present invention has the following technical effects: The InDel marker D06_8234514: CCCACTCTTAGGTTGTAACTGATTTAT / C provided by this invention can assist in the simultaneous identification of fiber strength and lint percentage. Cotton plants carrying the homozygous C genotype have significantly higher fiber strength and lint percentage than individuals carrying the CCCACTCTTAGGTTGTAACTGATTTAT genotype. The molecular markers disclosed in this invention have significant application value for the identification of comprehensive superior traits in cotton, and are of great importance for accelerating the breeding of high-quality and high-yield cotton varieties and improving the economic benefits of cotton. Attached Figure Description

[0012] Figure 1 BSA analysis of FS and LP in the F2 population was performed simultaneously. Among them, a) shows the phenotypic distribution and correlation analysis of FL and LP in the F2 population, b) shows the phenotypic distribution of FL and LP in extremely segregated pools, c) shows the genome-wide ΔSNP-index based on BSA analysis, d) shows the D06 chromosome ΔSNP-index based on BSA analysis, and e) shows the D06 chromosome G'value based on BSA analysis.

[0013] Figure 2 For InDel in F 2:3 Haplotype verification of the population. Detailed Implementation

[0014] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field, and the reagents or raw materials used are all purchased from commercial channels or are publicly available unless otherwise specified.

[0015] This invention provides an InDel molecular marker associated with cotton fiber strength and lint percentage traits, wherein the InDel molecular marker is located at base 8234514 on chromosome D06 of the cotton genome; The InDel molecular marker is the nucleotide sequence shown in SEQ ID NO.1, where the 101st base is an insertion or deletion.

[0016] This invention also provides a method for identifying cotton fiber strength and lint percentage traits, comprising the following steps: detecting the genotype of the InDel molecular marker in the genomic DNA of the cotton sample to be tested, and determining the fiber strength and lint percentage traits based on the genotype.

[0017] In some specific implementations, the method for determining fiber strength and lint percentage traits based on genotype is as follows: individuals with a missing genotype have significantly higher fiber strength and lint percentage than individuals with an inserted genotype.

[0018] This invention also provides the application of the InDel molecular marker in cotton breeding with excellent fiber strength and / or lint percentage traits.

[0019] This invention also provides a cotton breeding method with excellent fiber strength and / or lint percentage traits, comprising the following steps: using the InDel molecular marker to perform genotyping on cotton germplasm resources, selecting individuals with missing genotypes as breeding parent materials, or using them to screen cotton plants with simultaneously improved fiber strength and lint percentage.

[0020] In some specific implementations, the cotton is upland cotton.

[0021] Example 1 The discovery of InDel 1. Using CCRI45 as the female parent and superior lines of FS and LP synchronous improvement selected from high-generation backcrosses of CCRI45 and "Hai 1" as the male parent, a cotton F2 segregating population (experimental population) containing 3324 individual plants was constructed. The fiber strength and lint percentage phenotypes of the parents and individual plants in the F2 population were investigated: After natural boll opening, the cotton was harvested manually, and the seed cotton weight was measured. After ginning, the lint weight was measured. [Lint percentage] [Lin weight / seed cotton weight] collect lint percentage phenotypic values; then, weigh 20 grams of lint fiber samples from each material and send them to the Cotton Quality Supervision and Testing Center of the Ministry of Agriculture and Rural Affairs (Anyang, Henan, Cotton Research Institute of Chinese Academy of Agricultural Sciences) to complete fiber quality testing and collect fiber strength (FS) phenotypic values.

[0022] 2. Based on the LP and FS phenotypic values ​​in the F2 population ( Figure 1 From this, 30 plants each of "High Bulk" and "Low Bulk" were selected to form an extreme segregation pool. Figure 1 (b)

[0023] 3. Extract DNA from the young leaves of the 60 selected cotton plants according to the CTAB method (Paterson et al. A rapid method for extraction of cotton ( Gossypiums pp. (genomie DNA suitable for RFLP and PCR analysis. Plant MOl Rep, 1993, 11: 122-127), corresponding to the mixing pool, the DNA of single plants is mixed in equal quantities to form a DNA mixing pool.

[0024] 4. Using Illumina HiSeq TM The mixed-pool DNA was resequencing at a depth of 30-fold (PE 125bp) using a sequencing platform (Illumina, Inc., San Diego, CA, USA). Following standard procedures for cotton BSA analysis, TM-1 was used as the reference genome (Hu et al.). Gossypium barbadense and Gossypiumhirsutum Genomes provide insights into the origin and evolution of allotetraploid cotton. Nat. Genet.2019, 51,(4), 739-748), SNP and InDel variant detection and filtering were performed on the sequencing data of each pool (Wang et al. AAQSP increases mapping resolution of stable QTLs through applying NGS-BSA in multiple genetic backgrounds. Theor. Appl. Genet. 2022, 135, 3223-3235). Using the R package QTLseqr v0.7.5 (Mansfeld, BN; Grumet, R., QTLseqr: an R package for bulksegregant analysis with next-generation sequencing. Plant Genome 2018, 11,(2)), the ΔSNP-index (SNP frequency, including InDel) and G'value of each variant site between the two pools were calculated. A sliding window of 750kb was used to obtain the fitted values ​​of ΔSNP-index and G'value within the intervals. The results were calculated using 10,000 permutations, with a 95% confidence level as the screening threshold (Abe, A.; Kosugi, S.; Yoshida, K.; Natsume, S.; Takagi, H.; Kanzaki, H.; Matsumura, H.; Yoshida, K.; Mitsuoka, C.; Tamiru, M.; Innan, H.; Cano, L.; Kamoun, S.; Terauchi, R., Genome sequencing). (Reveals agronomically important loci in rice using MutMap. Nat. Biotechnol. 2012, 30,(2), 174-178), obtaining all target candidate intervals.

[0025] 5. Determination of key InDels. Based on the BSA analysis results, select the peak signal associated with the variant sites and phenotypes within the location confidence interval.

[0026] 6. BSA analysis showed a highly significant and prominent association signal within the 7.1–8.3 Mb region of genome D06. Figure 1 (c, d, e). The strongest peak signal was detected at InDel: D06_8234514. Figure 1(d, e, Table 1).

[0027] Table 1. Correlation information near the signal peak within the candidate interval.

[0028] 7. The strong association signal InDel: D06_8234514 is located at position 101 of the nucleotide sequence shown in SEQ ID NO.1, containing the base polymorphism site CCCACTCTTAGGTTGTAACTGATTTAT / C. In the parental line CCRI45, the genotype is homozygous CCCACTCTTAGGTTGTAACTGATTTAT, while in the superior near-isogenic line M7561, which is simultaneously improved in FS and LP, the genotype is homozygous C. Individuals with the homozygous C genotype have significantly higher fiber strength and lint percentage than individuals with the inserted genotype.

[0029] SEQ ID NO.1: GAAATATATAAGGACTAATTTACTCATTTTTTTTAGTAAAGAGACTGAAATGCAATCCACCCCTATGTACAGAGACTTCCCTAATACTTTTACGAGACTA CCCACTCTTAGGTTGTAACTGATTTAT[C] GAGAAGCTCGAATTTGAGTTTCCAAATTTAATTTTATATCATCACATTTATTTCTGAAGTTTAAATTCGATCCTAACTGAAATATGTTTTTTTAACATAA.

[0030] Note: The gene sequence of an individual with genotype C is (SEQ ID NO.2): GAAATATATAAGGACTAATTTACTCATTTTTTTTAGTAAAGAGACTGAAATGCAATCCACCCCTATGTACAGAGACTTCCCTAATACTTTTACGAGACTA C GAGAAGCTCGAATTTGAGTTTCCAAATTTAATTTTATATCATCACATTTATTTCTGAAGTTTAAATTCGATCCTAACTGAAATATGTTTTTTTAACATAA.

[0031] The gene sequence of the individual with the inserted genotype is (SEQ ID NO.3): GAAATATATAAGGACTAATTTACTCATTTTTTTTAGTAAAGAGACTGAAATGCAATCCACCCCTATGTACAGAGACTTCCCTAATACTTTTACGAGACTA CCCACTCTTAGGTTGTAACTGATTTATGAGAAGCTCGAATTTGAGTTTCCAAATTTAATTTTATATCATCACATTTATTTCTGAAGTTTAAATTCGATCCTAACTGAAATATGTTTTTTTAACATAA.

[0032] Example 2 1. Verification of InDel: 260 representative plants were selected from the F2 population to construct the next generation F2. 2:3 Group. As described in the relevant method of Example 1, F is collected. 2:3 The FS and LP phenotypes of 260 lines were analyzed, and DNA was extracted for 6-fold resequencing. Variation detection and genotyping were performed, and the lines were clustered according to the InDel:D06_8234514 genotype. The significant differences in fiber FS and LP among different genotypes were analyzed. Results showed that in the F… 2:3 Of the 260 cotton lines in the population, 153 were homozygous for the genotype CCCACTCTTAGGTTGTAACTGATTTAT (InDel: D06_8234514), 69 were homozygous for genotype C, and 38 were single plants with genotypic deletions. Analysis of the FS and LP phenotypes of the two homozygous genotypes revealed that cotton lines carrying the homozygous C genotype had significantly higher fiber strength and lint percentage than those carrying the CCCACTCTTAGGTTGTAACTGATTTAT genotype. Figure 2 This demonstrates that InDel:D06_8234514 plays a significant role in identifying the simultaneous improvement of fiber strength and lint percentage.

[0033] 2. The Value of InDel. Simultaneous improvement of fiber strength and lint percentage is a crucial task in cotton breeding and production, and a bottleneck in the development of new cotton varieties with superior overall traits using existing breeding methods. The InDel: D06_8234514 provided by this invention can assist in identifying whether fiber strength and lint percentage are improved simultaneously. Cotton plants carrying the homozygous C genotype exhibit significantly higher fiber strength and lint percentage than individuals carrying the CCCACTCTTAGGTTGTAACTGATTTAT genotype. The molecular marker disclosed in this invention has significant application value for identifying superior cotton traits and is of great importance for accelerating the breeding of high-quality cotton varieties and improving the economic benefits of cotton.

[0034] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively describe all embodiments here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. An InDel molecular marker associated with cotton fiber strength and lint percentage, characterized in that, The InDel molecular marker is located at base 8234514 on chromosome D06 of the cotton genome; The InDel molecular marker is the nucleotide sequence shown in SEQ ID NO.1, where the 101st base is an insertion or deletion.

2. A method for identifying cotton fiber strength and lint percentage characteristics, characterized in that, Includes the following steps: The genotype of the InDel molecular marker described above is detected in the genomic DNA of the cotton sample to be tested, and the fiber strength and lint percentage are determined based on the genotype.

3. The application according to claim 2, characterized in that, The method for determining fiber strength and lint percentage traits based on genotype is as follows: individuals with a missing genotype have significantly higher fiber strength and lint percentage than individuals with an inserted genotype.

4. The application of the InDel molecular marker as described in claim 1 in the breeding of cotton with excellent fiber strength and / or lint percentage.

5. A cotton breeding method with excellent fiber strength and / or lint percentage traits, characterized in that, Includes the following steps: The InDel molecular markers were used to genotype cotton germplasm resources, and individuals with missing genotypes were selected as breeding parents or used to screen cotton plants with simultaneous increases in fiber strength and lint percentage.

6. The cotton breeding method according to claim 5, characterized in that, The cotton in question is upland cotton.