Genetically engineered bacteria for synthesizing l-tryptophan and application thereof

By regulating the expression of serA and serB genes through genetic engineering, the problem of glutamate accumulation in tryptophan production was solved, achieving efficient L-tryptophan synthesis and improving conversion rate and product concentration.

CN122128199APending Publication Date: 2026-06-02WESTLAKE UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
WESTLAKE UNIV
Filing Date
2026-03-13
Publication Date
2026-06-02

Smart Images

  • Figure CN122128199A_ABST
    Figure CN122128199A_ABST
Patent Text Reader

Abstract

The application discloses genetically engineered bacteria for synthesizing L-tryptophan and application thereof. The application realizes the following through two key gene regulation strategies (serA down-regulation and serB up-regulation): the accumulation amount of glutamic acid by-products is significantly reduced from 8-20 g / L to below 1.14 g / L, and the reduction ranges are 87.74% and 90.3% respectively; the sugar acid conversion rate (glucose / L-tryptophan) of L-tryptophan is increased from 19.2% to 20.9% and 21.3% respectively; without additional addition of expensive cofactors or inducers, the cost-effectiveness is significant.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, specifically relating to a genetically engineered bacterium for synthesizing L-tryptophan and its applications. Background Technology

[0002] L-Tryptophan is an essential aromatic amino acid that neither humans nor animals can synthesize on their own. It is widely used in food additives, pharmaceutical intermediates, animal feed, and functional health products. With increasing market demand, the production of L-Tryptophan using microbial fermentation has become the mainstream method due to its sustainability, cost-effectiveness, and environmental friendliness. Currently, modifying industrial strains such as *E. coli* through metabolic engineering to construct highly efficient L-Tryptophan cell factories is a key pathway to achieving industrial-scale production.

[0003] However, in actual fermentation processes, the efficient synthesis of L-tryptophan is often limited by various factors, among which the accumulation of metabolic byproducts is particularly prominent. Glutamate, as a crucial node molecule in central nitrogen metabolism, is prone to excessive accumulation in many engineered strains. This not only consumes a large amount of carbon skeleton and reducing power but may also interfere with flux distribution in the tryptophan synthesis pathway through feedback regulation mechanisms, thereby reducing the yield and conversion efficiency of the target product. Existing studies have shown that abnormal accumulation of glutamate is often closely related to precursor diversion, nitrogen metabolism imbalance, and dysregulation of key enzyme activities.

[0004] While high-tryptophan-producing strains can achieve high tryptophan yields in fed-batch fermentation, they are accompanied by significant accumulation of glutamate byproducts (up to 8–20 g / L), severely impacting carbon source utilization efficiency and final product conversion. Although existing research has focused on controlling organic acid byproducts such as acetic acid, for example, by knocking out acetic acid production bypass pathways to reduce acetic acid production, there are few reports on the mechanism of glutamate accumulation and targeted regulatory strategies. Furthermore, tryptophan synthesis depends on precursors such as 5-phosphoribose-1-pyrophosphate (PRPP) provided by the pentose phosphate pathway and phosphoenolpyruvate (PEP) and erythrose-4-phosphate (E4P) from the glycolysis pathway, and the supply balance of these precursors profoundly affects the operational efficiency of the entire aromatic amino acid synthesis network.

[0005] It is noteworthy that serine metabolism plays a crucial role in linking carbohydrate metabolism and amino acid synthesis. The serA gene encodes phosphoglycerate dehydrogenase (PGDH), which catalyzes the conversion of 3-phosphoglycerate to 3-phosphohydroxypyruvate and is the rate-limiting enzyme in serine synthesis. Its activity is inhibited by the NADH / NAD+ ratio and the feedback inhibition of the final product, serine. Simultaneously, SerA also possesses α-ketoglutarate reductase activity, utilizing α-ketoglutarate and NADH as substrates to catalyze the production of 2-hydroxyglutarate. Excessive intracellular SerA activity may lead to excess SerA catalyzing the reduction reaction using α-ketoglutarate, potentially contributing to the abnormal accumulation of glutamate in the later stages of fermentation. The serB gene encodes phosphoserine phosphatase, responsible for hydrolyzing 3-phosphoserine to free serine. Its expression level directly affects the size of the intracellular serine pool, thereby regulating the distribution of carbon flux among serine, glycine, and one-carbon units.

[0006] Based on existing research, this invention eliminates the accumulation of glutamate byproducts during L-tryptophan fermentation by regulating the expression of genes related to the serine metabolic pathway in Escherichia coli, thereby further improving the conversion efficiency of L-tryptophan. Summary of the Invention

[0007] The technical problem to be solved by this invention is to address the shortcomings of existing tryptophan-producing strains, which suffer from severe accumulation of glutamate byproducts (8-20 g / L) during fermentation, leading to carbon flow loss and reduced conversion rate. This invention provides a method to eliminate glutamate accumulation by precisely regulating the expression of key genes in the serine metabolic pathway, and applies this method to significantly improve tryptophan conversion rate and final product concentration.

[0008] This invention first provides a genetically engineered bacterium for synthesizing L-tryptophan, wherein at least one of the following modifications is made to *E. coli* used for tryptophan production through genetic engineering: Modification 1: Upregulate the expression level of the serB gene; Modification 2: Downregulate the expression level of the serA gene.

[0009] Preferably, when downregulating the expression level of the serA gene through genetic engineering, this is achieved by replacing the promoter of the serA gene with a promoter that is weaker than the original promoter.

[0010] More preferably, when downregulating the expression level of the serA gene through genetic engineering, this is achieved by replacing the promoter of the serA gene with the PserA promoter.

[0011] Preferably, the upregulation of serB gene expression level is achieved by overexpressing the serB gene.

[0012] More preferably, when overexpressing the serB gene, the serB gene is cloned into an expression plasmid to obtain a recombinant plasmid, and the recombinant plasmid is introduced into Escherichia coli for tryptophan production.

[0013] In a further preferred embodiment, when the serB gene is cloned into an expression plasmid to obtain a recombinant plasmid, the serB gene sequence also includes a promoter and a ribosome binding site.

[0014] More preferably, the expression plasmid is a plasmid with p15A as a replicon.

[0015] The present invention further provides the application of the genetically engineered bacteria in the synthesis of L-tryptophan.

[0016] This invention also provides a method for synthesizing L-tryptophan, which uses the genetically engineered bacteria for fermentation culture to convert the substrate glucose into the product L-tryptophan.

[0017] The method for eliminating the accumulation of glutamate byproducts in this invention is mainly achieved through the following two aspects: (1) In tryptophan-producing strains, the expression level of serA gene was downregulated by genetic engineering, the catalytic activity of phosphoglycerate dehydrogenase (PGDH) was reduced, and its competitive consumption of α-ketoglutarate was reduced, thereby blocking the abnormal synthesis pathway of glutamate. (2) Simultaneously enhance the expression level of the serB gene, increase the catalytic flux of phosphoserine phosphatase (PSP), strongly "pull" the metabolic flow of the entire SerABC pathway, and promote the efficient flow of the precursor 3-phosphoglycerate to serine, thereby reducing the intracellular content of SerA that can be used for the reduction of α-ketoglutarate.

[0018] The tryptophan-producing strain described in this invention is the S028 strain constructed in our laboratory. This strain was obtained by modifying the S028 strain through systemic metabolic engineering. Its L-tryptophan production by fed-batch fermentation reaches more than 43 g / L, but is accompanied by the accumulation of 8-20 g / L of glutamate. This is described in the literature: Rational design and metabolic analysis of Escherichia coli for effective production of L-tryptophan at high concentration, doi: 10.1007 / s00253-016-7772-5.

[0019] Beneficial effects of this invention: This invention achieves the following through two key gene regulation strategies (serA downregulation and serB upregulation): the accumulation of glutamate byproducts is significantly reduced from 8-20 g / L to below 1.14 g / L, with reductions of 87.74% and 90.3%, respectively; the L-tryptophan glucose-to-acid conversion rate (glucose / L-tryptophan) is increased from 19.2% to 20.9% and 21.3%, respectively; and no additional expensive cofactors or inducers are required, resulting in significant cost-effectiveness. Attached Figure Description

[0020] Figure 1 Comparison of glutamate accumulation during the fermentation process of recombinant strains under different regulatory strategies.

[0021] Figure 2 The effects of metabolic regulation of serA and serB expression levels on L-tryptophan production performance. Detailed Implementation

[0022] The *E. coli* strain S028 involved in the following examples is described in the literature: Rational design and metabolic analysis of *Escherichia coli* for effective production of *L-tryptophan* at high concentration, doi: 10.1007 / s00253-016-7772-5. The *E. coli* strain S028 is... E. coli S028 was obtained from the starting strain W3110 through the following modifications: the aroF, aroG, mtr, tnaA, and tnaB genes were knocked out from the genome, and the anti-feedback genes aroG (S180F), serA (H344A / N364A), trpE (S40F), and DCBA were integrated into the genome and overexpressed, ultimately resulting in the tryptophan-producing strain S028.

[0023] The nucleotide sequences involved are: The amino acid sequence encoded by serA: SEQ ID NO.1; The amino acid sequence encoded by serB: SEQ ID NO.2; serA nucleotide sequence: SEQ ID NO.3; serB nucleotide sequence: SEQ ID NO.4; The weak promoter PserA sequence is: caagaattacctttgcgtgatatttcctcaacatcgcgacgcaaacgttcatattgccgcaatattatttttgatatgttgaaaggcggatgcaaatccgcacacaacatttcaaaagacaggattgggtaa; sgRNA sequence serA-sgRNA:ttaagaaggagatatacatg.

[0024] The primer sequences used in this invention are shown in Table 1.

[0025] Table 1 Primer sequences used in this invention Example 1: CRISPR-Cas9 gene editing system mediates serA promoter substitution on the genome (1) Using the genome of Escherichia coli MG1655 as a template, primers serA-up-F / serA-up-R and serA-down-F / serA-down-R were used to amplify the upstream and downstream homologous arm fragments of the serA gene, respectively; at the same time, primers PserA-F / PserA-R were used to amplify the weak promoter PserA fragment.

[0026] (2) The three fragments were ligated by overlap extension PCR. The ligation order of the three fragments was upstream homologous arm, weak promoter, and downstream homologous arm, to obtain the target fragment PserA-serA, which is a linear DNA fragment.

[0027] (3) Using the pTargetF vector as a template, PCR was performed using primers serA-N20-F / pTF-R to clone the sgRNA sequence serA-sgRNA into the pTargetF vector to construct pTargetF-serA.

[0028] (4) pTargetF-serA, PserA-serA fragments and pCas9 plasmid were co-transformed into S028 competent cells and 10 mM L-arabinose was added to induce expression. After recovery at 30°C, the cells were plated on LB plates containing kanamycin (50 mg / L) and spectinomycin (100 mg / L).

[0029] (5) Colony PCR sequencing was performed using primers VF / VR to verify and screen positive clones.

[0030] (6) Positive clones were inoculated into LB tubes, and IPTG and kanamycin were added to remove the pTargetF-serA plasmid. The cells were then cultured overnight at 42°C to remove the pCas plasmid, finally obtaining the recombinant strain S028-serA. Compared with strain S028, the recombinant strain S028-serA only replaced the serA promoter that initiates the serA gene with the weak promoter PserA, thus weakening the expression intensity of the serA gene.

[0031] Example 2: Construction of serB and serA overexpression vectors and construction of recombinant strains (1) Using the genome of Escherichia coli MG1655 as a template, primers serA-F / serA-R and serB-F / serB-R were used to amplify the serA gene fragment (containing promoter and RBS (ribosome binding site)) and the serB gene fragment (containing promoter and RBS).

[0032] (2) The expression plasmid p15A was linearized using BamHI restriction enzyme, and the serA and serB gene fragments were inserted into the BamHI restriction site of plasmid p15A to obtain expression vectors p15A-serA and p15A-serB.

[0033] (3) The expression vectors p15A-serA and p15A-serB were electroporated into the L-tryptophan-producing strain S028 to obtain recombinant strains S028 / p15A-serA and S028 / p15A-serB, respectively, to enhance the expression of serA and serB genes.

[0034] Example 3: Fermentation performance verification 1. Seed liquid preparation: (1) Plate activation: Take the strain stored at -80℃, activate it on LB solid plate, and incubate at 37℃ for 16 h.

[0035] (2) Seed culture: Pick a single colony and inoculate it into 40 mL LB liquid medium, and culture at 37℃ and 220 rpm for 10 h.

[0036] 2. Fermentation culture The fermentation was carried out in a 1.0 L fermenter with an initial liquid volume of 0.4 L and an inoculum size of 10% (v / v).

[0037] Fermentation medium formula: glucose 12 g / L, magnesium sulfate heptahydrate 0.5 g / L, potassium dihydrogen phosphate 2 g / L, ammonium sulfate 4 g / L, yeast extract 1 g / L, citric acid 2 g / L, calcium pantothenate 0.5 mg / L, biotin 0.1 mg / L, ferrous sulfate heptahydrate 25 mg / L, manganese sulfate monohydrate 25 mg / L, copper sulfate pentahydrate 0.08 mg / L.

[0038] Fermentation conditions: temperature 37±0.5°C, initial pH 7.0 (controlled by automatic addition of 25% ammonia), dissolved oxygen maintained at 30-35% throughout, aeration rate 10-100 L / h, stirring speed 500-1200 rpm. When the residual sugar is below 2 g / L, add 800 g / L glucose solution to maintain the sugar concentration below 1 g / L.

[0039] 3. Detection Method L-Tryptophan Detection: L-Tryptophan was detected using the p-dimethylaminobenzaldehyde colorimetric method. The fermentation supernatant was diluted 100 times, and 100 μL of the diluted supernatant was added to 900 μL of p-dimethylaminobenzaldehyde. After thorough mixing, the mixture was boiled in a water bath for 2 min. Then, one drop of 2% sodium nitrite was added, and the mixture was inverted and mixed. The mixture was then boiled in a water bath for 3 min and quickly transferred to ice to cool. The absorbance at 600 nm was measured using a cuvette and recorded. A standard curve was plotted based on the L-Tryptophan standard detection results, and the L-Tryptophan concentration was calculated based on the absorbance values ​​of different samples.

[0040] Glutamate detection: L-glutamate oxidase was immobilized in a reaction membrane using an enzyme electrode analyzer (SBA-40E type), and the detection time was 30 s / sample.

[0041] 4. Experimental Results Results were obtained after 40 hours of fermentation. Figure 1 A comparison diagram showing the accumulation of glutamate during the fermentation process of recombinant strains under different regulatory strategies. Figure 2 To investigate the effects of metabolic regulation of serA and serB expression levels on L-tryptophan production performance.

[0042] Among them, the control strain S028 had L-tryptophan 42.7 g / L, glutamic acid 9.3 g / L, and a sugar-acid conversion rate of 19.2%.

[0043] Strain S028-serA: L-tryptophan 42.1 g / L, glutamate 1.14 g / L, sugar-acid conversion rate 20.9%. Compared with the control strain, strain S028-serA weakened the expression level of the serA gene, resulting in a decrease of 87.74% in glutamate accumulation and an increase of 8.1% in tryptophan yield.

[0044] Recombinant strain S028 / p15A-serB: L-tryptophan 43.2 g / L, glutamic acid 0.9 g / L, sugar-acid conversion rate 21.3%. Compared with the control strain, the recombinant strain S028 / p15A-serB showed a 90.3% reduction in glutamic acid accumulation and a 10.9% increase in tryptophan yield.

[0045] The recombinant strain S028 / p15A-serA contained 40.5 g / L L-tryptophan, 20.6 g / L glutamate, and a sugar-acid conversion rate of 17.1%. Compared with the control strain, the recombinant strain S028 / p15A-serA increased glutamate accumulation by 121.5% and decreased tryptophan yield by 10.9% after increasing serA expression.

[0046] The results above indicate that downregulating serA gene expression or upregulating serB gene expression can both reduce the accumulation of glutamate byproducts and increase the L-tryptophan glucose-acid conversion rate.

Claims

1. A genetically engineered bacterium for synthesizing L-tryptophan, characterized in that, At least one of the following modifications was made to E. coli used for tryptophan production through genetic engineering: Modification 1: Upregulate the expression level of the serB gene; Modification 2: Downregulate the expression level of the serA gene.

2. The genetically engineered bacterium for synthesizing L-tryptophan according to claim 1, characterized in that, When downregulating the expression level of the serA gene through genetic engineering, it is achieved by replacing the serA gene promoter with a weaker promoter than the original promoter.

3. The genetically engineered bacterium for synthesizing L-tryptophan according to claim 2, characterized in that, When downregulating the expression level of the serA gene through genetic engineering, this is achieved by replacing the serA gene promoter with the PserA promoter.

4. The genetically engineered bacterium for synthesizing L-tryptophan according to claim 1, characterized in that, Upregulating the expression level of the serB gene is achieved by overexpressing the serB gene.

5. The genetically engineered bacterium for synthesizing L-tryptophan according to claim 4, characterized in that, When the serB gene is overexpressed, the serB gene is cloned into the expression plasmid to obtain a recombinant plasmid, and the recombinant plasmid is introduced into E. coli for tryptophan production.

6. The genetically engineered bacterium for synthesizing L-tryptophan according to claim 5, characterized in that, When the serB gene is cloned into an expression plasmid to obtain a recombinant plasmid, the serB gene sequence also includes a promoter and a ribosome binding site.

7. The genetically engineered bacterium for synthesizing L-tryptophan according to claim 5, characterized in that, The expression plasmid is a plasmid with p15A as the replicon.

8. The use of the genetically engineered bacteria according to any one of claims 1 to 7 in the synthesis of L-tryptophan.

9. A method for synthesizing L-tryptophan, characterized in that, Fermentation culture is carried out using the genetically engineered bacteria according to any one of claims 1 to 7 to convert the substrate glucose into the product L-tryptophan.