An optimized IL-21 gene of grass carp, its encoded recombinant protein, recombinant plasmid, and its recombination methods and applications.

By optimizing the sequence of the grass carp IL-21 gene and expressing it in Escherichia coli, the problems of low expression efficiency and complex process in the existing technology have been solved, realizing the efficient preparation of grass carp IL-21 recombinant protein and intestinal homeostasis regulation, which has good application potential.

CN122128314APending Publication Date: 2026-06-02XINYANG AGRI & FORESTRY UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202610249824.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-03
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

The existing grass carp IL-21 gene and recombinant protein have low expression efficiency, complex preparation process, and insufficient activity verification, which prevents them from being applied in practice and limits their application potential in grass carp immune enhancement and disease control.

Method used

The grass carp IL-21 gene sequence was optimized, primers were designed for PCR amplification, recombinant plasmid pET-28a-IL-21 was constructed, and expressed in Escherichia coli. The recombinant protein was purified by Ni-NTA chromatography column, simplifying the process and improving expression efficiency and activity.

Benefits of technology

This study achieved efficient and soluble expression of recombinant IL-21 protein in grass carp, simplified the preparation process, reduced costs, and demonstrated its biological function in regulating intestinal homeostasis, providing a new approach for enhancing immunity and controlling diseases in grass carp.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122128314A_ABST
    Figure CN122128314A_ABST
Patent Text Reader

Abstract

This invention relates to the fields of molecular biology and biomedicine, specifically to a method and application of recombinant methods for the grass carp IL-21 optimized gene, its recombinant protein, and plasmids. The recombinant protein of this invention is a mature grass carp IL-21 peptide. The pET-28a-IL-21 recombinant expression plasmid was constructed by optimizing the IL-21 base codons, transformed into an *E. coli* (DE3) expression system, and soluble grass carp IL-21 recombinant protein was obtained by IPTG induction. Furthermore, this invention also found that the optimized gene, its recombinant protein, and plasmids can enhance the intestinal barrier integrity of grass carp, inhibit the load of pathogenic bacteria in the intestine, and repair intestinal damage caused by bacterial infection. This indicates that the grass carp IL-21 recombinant protein has a significant effect on protecting intestinal homeostasis, highlighting its promising application prospects in the research and development of prevention and treatment of bacterial enteritis in aquatic animals.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of biology and biomedicine, specifically an optimized grass carp IL-21 gene, its encoded recombinant protein, recombinant method, and application. Background Technology

[0002] Interleukin-21 (IL-21) belongs to the γ-chain receptor family and is a type I cytokine with a four-alpha helix structure. It is mainly produced by natural killer T cells (NKT) and activated T cells. After binding to the IL-21 receptor (IL21R), IL-21 can regulate the body's innate and adaptive immune responses through the JAK / STAT signaling pathway, making it one of the key cytokines regulating immune function.

[0003] In mammals, IL-21 has been proven to be a pleiotropic cytokine that not only widely participates in regulating the proliferation and differentiation of T cells, B cells and NK cells, but also plays an important role in regulating intestinal inflammatory responses, antibacterial defense and maintaining mucosal immunity. Its recombinant protein has been explored for application in immunomodulation-related research and product development, showing good application potential.

[0004] Grass carp, as one of my country's main freshwater farmed fish, plays a vital role in the development of the aquaculture industry through its healthy cultivation. However, grass carp are susceptible to pathogens such as bacteria and viruses during farming, leading to diseases like bacterial enteritis and gill rot, which seriously affect farming efficiency and industry development. Given the important immunomodulatory function of IL-21, its potential application in the field of grass carp immune control has attracted widespread attention and has become one of the hot topics in research related to enhancing grass carp immunity.

[0005] However, functional research on IL-21 in fish is still in its early stages. Existing studies on grass carp IL-21 mainly focus on its transcriptional distribution, expression response after pathogen infection, and the regulatory effects of certain splice variants on B cell proliferation and antibody secretion—basic aspects—and have not yet developed into a mature application technology system. Of particular note is the uncertainty regarding whether grass carp IL-21 can exert its intestinal homeostasis regulatory role through recombinant protein forms; its immunomodulatory mechanisms and practical application effects in grass carp lack sufficient validation.

[0006] In the prior art, patent CN108822202B discloses the preparation of recombinant IL-21 protein from grass carp. However, the preparation process does not optimize the nucleotide sequence of grass carp IL-21, resulting in the expressed recombinant protein mainly existing in inclusion bodies. It must undergo complex steps such as denaturation and renaturation to complete purification, which not only increases the process difficulty and production cost of protein preparation, but may also affect the activity of recombinant protein. At the same time, the recombinant protein has only undergone in vitro activity verification, without in vivo activity and application effect verification. It is impossible to clarify its actual immunomodulatory role in grass carp, making it difficult to apply to practical scenarios such as immune enhancement and disease control in grass carp farming, and thus failing to meet the actual needs of healthy grass carp farming.

[0007] Furthermore, the codon bias of the grass carp IL-21 gene that has not undergone sequence optimization does not match that of commonly used engineered host cells (such as Escherichia coli and Pichia pastoris), resulting in low gene expression efficiency and limited recombinant protein production, which further restricts the large-scale preparation and industrial application of grass carp IL-21 recombinant protein.

[0008] In summary, grass carp IL-21, as a cytokine with important immunomodulatory functions, has broad application prospects in enhancing grass carp immunity, controlling diseases, and promoting healthy aquaculture. However, existing grass carp IL-21 genes and recombinant proteins suffer from numerous drawbacks, including low expression efficiency, complex preparation processes, insufficient activity verification, and inability to achieve practical applications, severely restricting their potential. Therefore, targeted modification of the grass carp IL-21 gene to optimize its nucleotide sequence and overcome the aforementioned deficiencies in existing technologies, thereby enabling efficient, convenient preparation and effective application of grass carp IL-21 recombinant protein, has become an urgent technical problem to be solved. This is precisely the core necessity for this invention to carry out the grass carp IL-21 gene modification work. Summary of the Invention

[0009] In order to effectively overcome the shortcomings and limitations of the above-mentioned technologies, the present invention provides an optimized grass carp IL-21 gene, the gene sequence of which includes the sequence shown in SEQ ID NO.1 and its 90%-95% homologous sequence, wherein positions 4-57 are signal peptides.

[0010] Furthermore, the present invention also provides a grass carp IL-21 recombinant protein, the recombinant protein being encoded by the gene described in claim 1, and the amino acid sequence of the recombinant protein being as shown in SEQ ID NO.2.

[0011] Furthermore, the present invention also provides a recombinant plasmid of the grass carp IL-21 optimized gene, comprising the plasmid vector pET-28a and the nucleotide sequence of positions 58-497 as described in claim 1.

[0012] The recombinant plasmid recombinant method includes the following steps: (1) Design primers 1-10 based on the optimized nucleotide sequence of the grass carp IL-21 gene, and amplify the optimized nucleotide sequence encoding the mature peptide of grass carp IL-21 from position 58 to 497 by PCR technology. The sequences of primers 1-10 for PCR are shown in SEQ ID NO.3-SEQ ID NO.12. (2) The amplification product obtained in step (1) is ligated into the plasmid vector pET-28a to obtain the recombinant expression plasmid pET-28a-IL-21 containing the optimized grass carp IL-21 mature peptide gene fragment. pET-28a-IL-21 is transformed into Escherichia coli expressing DE3 strain. Colony screening is performed using primers 11 and 12. The plasmid is extracted after the positive strain is amplified and then subjected to enzyme digestion verification and sequencing. The gene sequences of primers 11 and 12 are shown in SEQ ID NO.13-SEQ ID NO.14.

[0013] Furthermore, step (1) includes two rounds of PCR amplification. The first round of PCR amplification uses primers 1-10, and the second round of PCR amplification uses the PCR product from the first round as a template for the second round of PCR. The optimized nucleotide sequence encoding the mature peptide of grass carp IL-21 is obtained by combining primers 1 and 10.

[0014] The system and procedure for the first round of PCR amplification reaction in step (1) are as follows: 0.5 μL polymerase PV2, 10 μL 5×PV2 buffer, 0.5 μL each of primers 1-10 with a mass concentration of 50 pmol / μL, 1 μL 10 mM dNTP, and supplemented to 50 μL with sterile ddH2O; the PCR reaction procedure is as follows: 95℃, 3 min; 95℃, 25 s, 62℃, 20 s, 72℃, 40 s, 25 cycles; 72℃, 1 min; store at 4℃. And / or, the system and procedure for the second round of PCR amplification reaction are as follows: 1 μL of the first round product as template, 0.5 μL of polymerase PV2, 10 μL of 5×PV2 buffer, 0.5 μL each of primer 1 and primer 10 with a mass concentration of 50 pmol / μL, 1 μL of 10 mM dNTP, and supplemented to 50 μL with sterile ddH2O; the PCR reaction program is as follows: 95℃, 3 min; 95℃, 25 s, 62℃, 20 s, 72℃, 40 s, 25 cycles; 72℃, 1 min; store at 4℃.

[0015] In step (2), the pET-28a vector was double-digested with NcoI and XhoI enzymes. Then, the second-round PCR product and the pET-28a vector double-digested product were recovered from the gel using a gel recovery kit. After gel recovery, the recombinant plasmid pET-28a-IL-21 was constructed by homologous recombination. The recombination reaction system was as follows: 2 μL of pET-28a vector double-digested product, 3 μL of second-round PCR gel recovery product, and 5 μL of recombinase (GN-Trelief SoSoo Cloning Kit). The mixture was incubated at 50℃ for 25 min. Then, 50 μL of E. coli DE3 competent cells were added to the recombinant expression vector pET-28a-IL-21, and the mixture was incubated on ice for 30 min, then heat-shocked at 42℃ for 90 s, and immediately placed on ice for 3 min. 200 μL of antibiotic-free LB medium (A507002-0250, Sangon Biotech) was added, and the mixture was cultured at 37℃ and 150 rpm for 1 h with shaking. 100 μL of the culture medium was then taken. μL of bacterial suspension was evenly spread onto an LB agar plate (B530113-0010, Sangon Biotech) containing kanamycin. After incubation at 37°C overnight, single colonies were picked for detection. The reaction system consisted of 1 µL of bacterial suspension as template, 1 µL each of primers 11 and 12, 5 µL of ExTaq DNA polymerase, and 2 µL of ddH2O, for a total of 10 µL. The reaction conditions were as follows: pre-denaturation: 95°C, 3 min; denaturation: 95°C, 10 s; annealing: 55°C, 10 s; extension: 72°C, 30 s, 30 cycles; 72°C, 10 min; storage at 16°C. Three positive clones were then sequenced and the plasmid was retrieved. The plasmid was then verified by double enzyme digestion at 37°C. After identification, it was confirmed that *E. coli* expressing grass carp IL-21 recombinant protein was obtained. The double enzyme digestion verification system is as follows: Reagent dosage (µl) 1 each of Nco I and Xho I pET-28a / pET-28a-IL-21 25 10×buffer 3 Total system 30.

[0016] The present invention also provides a method for recombinant protein purification: the recombinant plasmid pET-28a-IL-21 is transformed into Escherichia coli expressing DE3 strain, and the recombinant protein is induced, expressed and purified in LB medium with 0.1-0.3 mM IPTG at 16-30℃ for 15-18 h.

[0017] Furthermore, *E. coli* containing the grass carp IL-21 recombinant protein were cultured in two 1 L tubes of LB liquid medium (B540113-0100, Sangon Biotech) at 37°C with shaking. When the OD value reached 0.6, IPTG was added to a final concentration of 0.1-0.3 mM. After induction at 16-30°C for 15-18 h, the induced bacterial cells were collected and treated with a cell disruptor. After centrifugation at 8000 rpm and 4°C for 10 min, the protein sample was obtained by filtration through a 0.45 µm filter. The sample was then added to a Ni-NTA chromatography column and bound at 4°C for 3 h. It was then washed stepwise with 20 mM, 40 mM, 60 mM, 80 mM, and 100 mM imidazole solutions. These imidazole solutions also contained 20 mM NaH2PO4 and 500 mM NaCl, with a pH of 7.4. Each wash consisted of 2... mL, and then collect grass carp IL-21 recombinant protein with protein elution buffer, which includes 500 mM imidazole, 20 mM NaH2PO4, 500 mM NaCl, and pH 7.4. After dialyzing the grass carp IL-21 recombinant protein three times in a dialysis bag with PBS buffer, centrifuge at 12000 rpm and 4℃ for 10 min, and take 100µL of supernatant for SDS-PAGE and Coomassie Brilliant Blue staining to analyze protein expression, it was confirmed that the expressed protein was grass carp IL-21 recombinant protein.

[0018] This invention also provides applications of the above-mentioned genes, recombinant proteins, and recombinant plasmids, in the following aspects: (1) As a functional feed and feed additive for grass carp to enhance the integrity of the intestinal barrier, inhibit the load of pathogenic bacteria in the intestine, repair intestinal damage caused by bacterial infection, and protect intestinal homeostasis; (2) Application as a targeted therapeutic repair agent for enteritis that enhances the integrity of the intestinal barrier of grass carp, inhibits the load of pathogenic bacteria in the intestine, repairs intestinal damage caused by bacterial infection, and protects intestinal homeostasis; (3) Application as a special intestinal health care product for seedling cultivation to enhance the integrity of grass carp intestinal barrier, inhibit the load of pathogenic bacteria in the intestine, repair intestinal damage caused by bacterial infection, and protect intestinal homeostasis; (4) Development of genetic breeding targets for disease resistance in grass carp: This optimized gene will be used as the core molecular marker / gene editing target for breeding against bacterial enteritis, and new disease-resistant and high-yielding strains will be cultivated. (5) Basic research tools for fish intestinal immunity and homeostasis regulation.

[0019] Furthermore, this invention also found that the grass carp IL-21 recombinant protein enhances the intestinal barrier integrity of grass carp by upregulating the expression of intestinal mucin and tight junction protein-related genes and promoting intestinal epithelial cell proliferation. The intestinal mucin-related genes include... agr2 , muc2 and klf4 Tight junction protein genes include zo-1 , claudin-3 and occludin Genes that regulate cell proliferation include Ki-67 , Cyclin D1 and mcm 2.

[0020] In summary, this invention, through the adoption of the above-mentioned technical solutions, has achieved significant beneficial effects: On the one hand, it has conducted in-depth analysis and systematic optimization of the grass carp IL-21 gene and its encoded protein, achieving efficient soluble expression of the grass carp IL-21 recombinant protein in *Escherichia coli*, significantly reducing the complex denaturation and renaturation steps required for inclusion body formation, thereby simplifying the process for obtaining high-purity grass carp IL-21 recombinant protein and effectively reducing production costs and time investment. On the other hand, this recombinant protein exhibits important biological functions in regulating intestinal homeostasis, providing a new solution for the prevention and treatment of bacterial enteritis in aquatic animals, and has good application potential and broad market prospects. Attached Figure Description

[0021] Figure 1 For Example 1, the construction and verification of the grass carp IL-21 recombinant expression plasmid pET-28a-IL-21 are shown in Figure A, which is a colony PCR electrophoresis analysis diagram (M: Marker, 1-16: selected single colonies). Figure B is a verification diagram of pET-28a-IL-21 double enzyme digestion (NcoI / XhoI) (M: Marker, 1: plasmid and IL-21 after enzyme digestion). Figure 2 This is an SDS-PAGE electrophoresis image of the grass carp IL-21 recombinant protein from Example 2, where M represents the marker and 1 represents the purified grass carp IL-21 recombinant protein.

[0022] Figure 3 The grass carp IL-21 recombinant protein (r) in Example 3 Ci IL-21) is effective against Aeromonas hydrophila ( Aeromonas hydrophila , Ah The protective effect of IL-21 on the intestinal mucosal barrier in grass carp. The intestinal mucin-related genes in grass carp infected with Aeromonas hydrophila for 3 days were detected using qPCR. agr2 (A) muc2 (B) and klf4(C) Tight junction protein gene zo-1 (D) claudin-3 (E) and occludin (F), genes regulating cell proliferation Ki-67 (G) Cyclin D1 (H) and mcm 2 (I) Expression changes, data are expressed as mean ± standard deviation (N=3), and significant differences are defined as follows: p<0.05 and p<0.01 indicates that there is no significant difference; ns indicates that there is no significant difference. Figure 4 In Example 4, the plate assay was used to detect the changes in Aeromonas hydrophila load in the intestines of grass carp infected with recombinant IL-21 protein at 1, 3, and 7 days. Data are expressed as mean ± standard deviation (N=3), and significant differences are defined as follows: p<0.05 and p<0.01 indicates that there is no significant difference; ns indicates that there is no significant difference. Figure 5 This is an example of the effect of grass carp IL-21 recombinant protein on intestinal inflammation in grass carp infected with Aeromonas hydrophila in Example 5. (AC) Pathological sections of the intestinal tract of grass carp treated with grass carp IL-21 recombinant protein (10 μg / tail). Grass carp in r Ci Infection with Aeromonas hydrophila occurred 12 h after IL-21 treatment. Three days after infection, intestinal segments were harvested for histological observation using hematoxylin-eosin staining (scale bar = 200 μm). Red arrows indicate lamina propria separation, green arrows indicate stratum corneum degeneration and blurring, and black and white arrows represent goblet cells and leukocytes, respectively. Figure 6 This study investigated the effect of the recombinant grass carp IL-21 protein in Example 5 on intestinal inflammation-related factors in grass carp infected with Aeromonas hydrophila. (AC) The study used three randomized field-view analysis to examine the effect of the protein on intestinal inflammation-related factors in grass carp infected with Aeromonas hydrophila. Figure 5 The thickness of the middle mucosal layer (A), the width of submucosal edema (B), and the length of villi (C) were quantitatively analyzed. (DG) Inflammatory regulators in the gut. il-1β (D) il-10 (E) nf-κbp52 (F) and nf-κ bp65 Relative mRNA expression levels of (G). Data are expressed as mean ± standard error (N=3). Significant differences are expressed as... p<0.05 and p<0.01 indicates that there is no significant difference, and ns indicates that there is no significant difference. Detailed Implementation

[0023] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments will be clearly and completely described below with reference to the accompanying drawings. The following embodiments are used to illustrate the present invention, but are not intended to limit the scope of the present invention.

[0024] Example 1: This example demonstrates the construction of a recombinant plasmid for high-efficiency expression of grass carp IL-21 in Escherichia coli.

[0025] 1. The grass carp IL-21 gene was searched via NCBI (Genbank: XM_051861036.1). The nucleotide sequence of the grass carp IL-21 gene is shown in SEQ ID NO.15, where positions 4-57 are the signal peptide. Codon optimization was performed based on the expression system. The optimized nucleotide sequence of the grass carp IL-21 gene without the signal peptide is SEQ ID NO.1, and the mature peptide sequence of grass carp IL-21 (amino acids 20-150) is SEQ ID NO.2.

[0026] 2. Using the target gene SEQ ID NO.1 sequence, 10 primers were designed using NCBI: primers 1-10, for PCR amplification of the optimized grass carp IL-21 sequence (where the underlined portion represents the pET-28a vector terminal homologous sequence, the italicized portion CCATGG represents the NcoI restriction site, the italicized portion CCATGG represents the XhoI restriction site, and the bolded portion represents the C-terminal 6×His tag sequence). The primer sequences are as follows: Primer 1: 5'- CGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTA AGAAGGAGATATA CCATGG AACTGTC-3' (SEQ ID NO:3); The gene sequences of primers 2-9 are shown in SEQ ID NO.4-SEQ ID NO.11; Primer 10: 5'- TTTGTTAGCAGCCGGATCTCAGTGGTGGTGGTGGTGGTG CTCGAG TTAGTGGTGGTGGTGGTGGTGTGCCTGGCT-3' (SEQ ID NO: 12).

[0027] 3. The optimized IL-21 sequence of grass carp was amplified by two rounds of PCR. The reaction system is as follows: Round 1: Polymerase (PV2) 0.5 μL, 5×PV2 buffer 10 μL, primers 1-10 (50 pmol / μL) 0.5 μL each, 10 mM dNTP 1 μL, and replenished to 50 μL with sterile ddH2O. The PCR reaction program was: 95℃, 3 min; 95℃, 25 s, 62℃, 20 s, 72℃, 40 s, 25 cycles; 72℃, 1 min; 4℃, forever.

[0028] Second round: 1 μL of the first round product as template, 0.5 μL of polymerase (PV2), 10 μL of 5×PV2 buffer, 0.5 μL each of primer 1 and primer 10 (50 pmol / μL), 1 μL of 10 mM dNTP, and replenished to 50 μL with sterile ddH2O. The PCR reaction program was: 95℃, 3 min; 95℃, 25 s, 62℃, 20 s, 72℃, 40 s, 25 cycles; 72℃, 1 min; 4℃, forever.

[0029] 4. The pET-28a vector was double-digested with NcoI and XhoI enzymes. Then, the second-round PCR product and the pET-28a vector double-digestion product were recovered from the gel using a gel extraction kit (purchased from Beijing Qingke Biotechnology Co., Ltd.). After gel extraction, the recombinant plasmid pET-28a-IL-21 was constructed via homologous recombination. The recombination reaction system consisted of: 2 μL of pET-28a vector double-digestion product, 3 μL of the second-round PCR gel-recovered product, and 5 μL of recombinase (GN-Trelief SoSoo Cloning Kit, Qingke). The reaction was incubated at 50°C for 25 min. Then, 50 μL of E. coli DE3 competent cells were added to the recombinant expression vector pET-28a-IL-21, incubated on ice for 30 min, heat-shocked in a 42℃ water bath for 90 s, and immediately placed on ice for 3 min; 200 μL of antibiotic-free LB medium (A507002-0250, Sangon Biotech) was added, and the culture was shaken and incubated for 1 h (37℃, 150 rpm); 100 μL of bacterial culture was evenly spread on a plate (LB solid plate containing kanamycin) (B530113-0010, Sangon Biotech). After incubation at 37℃ overnight, single colonies were picked for detection. The reaction system was 10 µl (1 µl bacterial culture as template, 1 µl each of primer 11 and primer 12, 5 µl ExTaq DNA polymerase, 2 µl lddH2O). The reaction conditions were: 95℃ for 3 min; 95℃ for 10 s, 55℃ for 10 s, 72℃ for 30 s, 30 cycles; 72℃ for 10 min; 16℃ forever. The results are as follows. Figure 1As shown in the figure. Then, three positive clones were selected for sequencing and plasmid re-entry. The plasmid was then subjected to double enzyme digestion for verification (37℃, 1 h). The results are shown in the figure. Figure 1 As shown, *E. coli* expressing grass carp IL-21 recombinant protein was obtained after identification. The double enzyme digestion verification system is shown in Table 1. Table 1

[0030] The primers used, 11 and 12, are shown in SEQ ID NO.13-14.

[0031] Example 2: This example demonstrates the expression and purification of recombinant IL-21 protein from grass carp.

[0032] The *E. coli* strain containing the grass carp IL-21 recombinant protein from Example 1 was cultured in two 1 L LB liquid medium (kanamycin) at 37 °C on a shaker. The LB liquid medium was model B540113-0100 (B540113-0100, Sangon Biotech). When the OD value reached 0.6, IPTG was added to a final concentration of 0.2 mM. After induction at 30 °C for 16 h, the induced bacterial cells were collected, and the bacteria were treated with a cell disruptor. After centrifugation (8000 rpm, 4 °C, 10 min), the protein sample was obtained by filtration through a 0.45 µm filter membrane. The sample was added to a Ni-NTA chromatography column and bound at 4℃ for 3 h. It was then washed with different concentrations of imidazole (20 mM, 40 mM, 60 mM, 80 mM, and 100 mM, 20 mM NaH2PO4, 500 mM NaCl, pH 7.4), 2 mL each time. The grass carp IL-21 recombinant protein was then collected using protein elution buffer (500 mM imidazole, 20 mM NaH2PO4, 500 mM NaCl, pH 7.4). The grass carp IL-21 recombinant protein was dialyzed three times in a dialysis bag with PBS buffer and then centrifuged (12000 rpm, 4℃, 10 min). 100 µL of the supernatant was used for SDS-PAGE and Coomassie Brilliant Blue staining to analyze protein expression. Figure 2 The image shows a band of approximately 15.6 kDa, which represents the recombinant IL-21 protein from grass carp.

[0033] It should be noted that in the recombinant protein expression step of this invention, the concentration of IPTG can be 0.1-0.3 mM, and the induction conditions can be within the range of 16-30℃ and 15-18 h to obtain recombinant proteins. For example, the concentration of IPTG is 0.1 mM or 0.3 mM, the temperature is 16℃, 30℃ or 25℃, and the induction time is 15h, 18h or 16h. Since the recombinant proteins obtained are all of consistent performance, they will not be described in detail one by one.

[0034] Example 3: The recombinant protein obtained in Example 2 was tested to detect the protective effect of grass carp IL-21 recombinant protein on the intestinal mucosal barrier of grass carp infected with Aeromonas hydrophila.

[0035] Grass carp (15±2 g) were randomly divided into three groups, with 50 fish in each group. The Aeromonas hydrophila infection group ( Ah group) and r Ci IL-21+ Ah Grass carp were injected intraperitoneally with PBS and r Ci IL-21, 12 h later, was administered at a concentration of 1×10⁻⁶ μL. 7 Grass carp were infected with *Aeromonas hydrophila* at CFU / mL. The control group received no treatment. Three days after infection, intestinal tissue was collected for real-time quantitative PCR detection of intestinal mucin-related genes. agr2 , muc2 and klf4 Tightly linked protein genes zo-1 , claudin-3 (E) and occludin Genes that regulate cell proliferation Ki-67 , Cyclin D1 and mcm 2 Changes in gene expression. Gene primers are shown in Table 2, and the results are as follows: Figure 3 As shown, treatment with grass carp IL-21 recombinant protein significantly promoted the expression of intestinal mucin-related genes, tight junction protein genes, and genes regulating cell proliferation. This indicates that grass carp IL-21 recombinant protein helps restore intestinal barrier damage caused by Aeromonas hydrophila infection.

[0036] Table 2

[0037] Example 4: The recombinant protein obtained in Example 2 was used to detect the effect of grass carp IL-21 recombinant protein on the load of Aeromonas hydrophila in the grass carp intestine.

[0038] Grass carp (15±2 g) were randomly divided into three groups, with 50 fish in each group. The Aeromonas hydrophila infection group ( Ah group) and r Ci IL-21+ Ah Grass carp were injected intraperitoneally with PBS and r Ci IL-21, 12 h later, was administered at a concentration of 1×10⁻⁶ μL. 7 Grass carp were infected with *Aeromonas hydrophila* at CFU / mL. The control group received no treatment. Intestinal tissue was collected 1, 3, and 7 days after infection, and the expression changes of *Aeromonas hydrophila* load in the intestine were detected using a plate count method. Results are as follows: Figure 4As shown, treatment with recombinant IL-21 protein in grass carp significantly inhibited the proliferation of Aeromonas hydrophila in the intestine, and the Aeromonas hydrophila load in the intestine decreased significantly over time. This indicates that recombinant IL-21 protein in grass carp helps to enhance the antibacterial immune defense level of grass carp intestine.

[0039] Example 5: This example examines the effect of the grass carp IL-21 recombinant protein obtained in Example 3 on intestinal inflammation in grass carp induced by Aeromonas hydrophila infection.

[0040] Grass carp (15±2 g) were randomly divided into three groups, with 50 fish in each group. The Aeromonas hydrophila infection group ( Ah group) and r Ci IL-21+ Ah Grass carp were injected intraperitoneally with PBS and r Ci IL-21, 12 h later, was administered at a concentration of 1×10⁻⁶ μL. 7 Grass carp were infected with *Aeromonas hydrophila* at CFU / mL. The control group received no treatment. Three days after infection, intestinal tissue was collected, and HE staining was used to detect whether recombinant IL-21 protein in grass carp promoted the recovery of intestinal pathological damage. Results are as follows: Figure 5 As shown in Figure A, the intestinal structure of the control group fish exhibited a normal morphology, with a small number of goblet cells and leukocytes, and tightly packed microvilli. In contrast, the fish infected with Aeromonas hydrophila showed submucosal edema, lamina propria separation, indistinct cuticle, and extensive leukocyte infiltration in the intestinal tissue. Figure 5 B). rCiIL-21 treatment significantly alleviated the intestinal pathological changes induced by Aeromonas hydrophila (B). Figure 5 C). Specifically, r Ci IL-21 treatment significantly increased the thickness of the intestinal mucosal layer. Figure 6 A), while reducing the width of submucosal edema ( Figure 6 B). Compared with the untreated infection group, villus length was significantly preserved ( Figure 6 C). Furthermore, Aeromonas hydrophila infection induces pro-inflammatory cytokines in the gut ( il-1β )( Figure 6 D) and inflammatory regulatory factors ( nf-κbp52 and nf-κbp65 () Figure 6 F and 6G) ​​are upregulated, but both can be expressed by r Ci IL-21 treatment significantly inhibited [the activity]. And r Ci IL-21 promotes the development of anti-inflammatory cytokines ( il-10 The expression of () Figure 6 E), the gene primers used in this embodiment are shown in Table 3. These results indicate that r CiIL-21 can effectively alleviate intestinal inflammation induced by Aeromonas hydrophila in grass carp by reducing pathological damage and regulating the expression of key inflammatory cytokines.

[0041] Table 2

[0042] This patent analyzed, optimized, and cloned the grass carp IL-21 gene, and expressed soluble grass carp IL-21 recombinant protein using an E. coli expression system, making the operation more convenient. Changes in the intestinal mucosal barrier, intestinal pathogen load, and intestinal pathology were detected after grass carp were injected with the recombinant IL-21 protein. The results showed that the grass carp IL-21 recombinant protein can increase the intestinal mucin-related genes (…). agr2 , muc2 and klf4 ) and tight junction proteins ( zo-1 , claudin-3 and occludin Gene expression and promotion of intestinal epithelial cell proliferation ( Ki-67 , Cyclin D1 and mcm 2 This study enhanced the intestinal barrier integrity of grass carp. Furthermore, the recombinant IL-21 protein from grass carp could inhibit the load of pathogenic bacteria in the intestine and repair intestinal damage caused by bacterial infection. This indicates that the recombinant IL-21 protein from grass carp has a significant effect on protecting intestinal homeostasis and shows promising application prospects for the prevention and treatment of bacterial enteritis in aquatic animals.

[0043] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some modifications or alterations to the above-described technical content to create equivalent embodiments without departing from the scope of the present invention. Any simple modifications, equivalent changes, and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.

Claims

1. An optimized IL-21 gene for grass carp, characterized in that, The gene sequence includes the sequence shown in SEQ ID NO.1 and its 90%-95% homologous sequence, wherein positions 4-57 are signal peptides.

2. A recombinant IL-21 protein from grass carp, characterized in that, The recombinant protein is encoded by the gene of claim 1, and the amino acid sequence of the recombinant protein is as shown in SEQ ID NO.

2.

3. A recombinant plasmid containing the optimized IL-21 gene of grass carp, characterized in that, It contains the plasmid vector pET-28a and the nucleotide sequence from position 58 to 497 as described in claim 1.

4. The recombination method of the recombinant plasmid according to claim 3, characterized in that, The steps include: (1) Design primers 1-10 based on the optimized nucleotide sequence of the grass carp IL-21 gene, and amplify the optimized nucleotide sequence encoding the mature peptide of grass carp IL-21 from position 58 to 497 by PCR technology. The sequences of primers 1-10 for PCR are shown in SEQ ID NO.3-SEQ ID NO.

12. (2) The amplification product obtained in step (1) is ligated into the plasmid vector pET-28a to obtain the recombinant expression plasmid pET-28a-IL-21 containing the optimized grass carp IL-21 mature peptide gene fragment. pET-28a-IL-21 is transformed into Escherichia coli expressing DE3 strain. Colony screening is performed using primers 11 and 12. The plasmid is extracted after the positive strain is amplified and then subjected to enzyme digestion verification and sequencing. The gene sequences of primers 11 and 12 are shown in SEQ ID NO.13-SEQ ID NO.

14.

5. The method according to claim 4, characterized in that, The step (1) includes two rounds of PCR amplification. The first round of PCR amplification uses primers 1-10. The second round of PCR amplification uses the PCR product of the first round as the template for the second round of PCR. The optimized nucleotide sequence encoding the mature peptide of grass carp IL-21, from position 58 to 497, is obtained by combining primers 1 and 10. The system and procedure for the first round of PCR amplification reaction in step (1) are as follows: 0.5 μL polymerase PV2, 10 μL 5×PV2 buffer, 0.5 μL each of primers 1-10 with a mass concentration of 50 pmol / μL, 1 μL 10 mM dNTP, and 50 μL supplemented with sterile ddH2O; the PCR reaction procedure is as follows: pre-denaturation: 95℃, 3 min; Denaturation: 95℃, 25s; Annealing: 62℃, 20s; Extension: 72℃, 40s, 25 cycles; 72℃, 1 min; Store at 4℃. And / or, the system and procedure for the second round of PCR amplification reaction are as follows: 1 μL of the first round product as template, 0.5 μL of polymerase PV2, 10 μL of 5×PV2 buffer, 0.5 μL each of primer 1 and primer 10 with a mass concentration of 50 pmol / μL, 1 μL of 10 mM dNTP, and supplemented to 50 μL with sterile ddH2O; the PCR reaction procedure is as follows: pre-denaturation: 95℃, 3 min; Denaturation: 95℃, 25s; Annealing: 62℃, 20s; Extension: 72℃, 40s, 25 cycles; 72℃, 1 min; Store at 4℃.

6. The method for expressing the recombinant protein according to claim 2, characterized in that, The recombinant protein obtained by transforming the recombinant plasmid pET-28a-IL-21 of claim 3 into Escherichia coli expressing DE3 strain, and then inducing, expressing and purifying it in LB medium with 0.1-0.3 mM IPTG at 16-30℃ for 15-18 h.

7. The recombination method according to claim 5, characterized in that, In step (2), the pET-28a vector was double-digested with NcoI and XhoI enzymes. Then, the second-round PCR product and the pET-28a vector double-digested product were recovered from the gel using a gel recovery kit. After gel recovery, the recombinant plasmid pET-28a-IL-21 was constructed by homologous recombination. The recombination reaction system was as follows: 2 μL of pET-28a vector double-digested product, 3 μL of second-round PCR gel recovery product, 5 μL of recombinase from the GN-Trelief SoSooCloning Kit, incubated at 50℃ for 25 min, then 50 μL of E. coli DE3 competent cells were added to the recombinant expression vector pET-28a-IL-21, incubated on ice for 30 min, heat-shocked at 42℃ for 90 s, and immediately placed on ice for 3 min; 200 μL of LB medium (A507002-0250) was added, and the cells were cultured at 37℃ and 150 rpm for 1 h with shaking; 100 μL of LB medium (A507002-0250) was taken. μL of bacterial suspension was evenly spread onto an LB solid plate containing kanamycin, model B530113-0010. After incubation at 37°C overnight, single colonies were picked for detection. The reaction system consisted of 1 µL of bacterial suspension as template, 1 µL each of primer 11 and primer 12, 5 µL of ExTaq DNA polymerase, and 2 µL of ddH2O, for a total of 10 µL. The reaction conditions were: pre-denaturation: 95°C, 3 min. Denaturation: 95℃, 10 s; Annealing: 55℃, 10 s; Extension: 72℃, 30 s, 30 cycles; 72℃, 10 min; Store at 16℃. Then, three positive clones were selected for sequencing and plasmid was returned. The plasmid was verified by double enzyme digestion at 37℃. After identification, it was confirmed that the *E. coli* expressing grass carp IL-21 recombinant protein was obtained. The double enzyme digestion system is as follows: Reagent dosage (µl) 1 each of Nco I and Xho I pET-28a / pET-28a-IL-21 25 10×buffer 3 Total system 30.

8. The method according to claim 6, characterized in that, Grass carp IL-21 recombinant protein *E. coli* was cultured in two 1 L tubes of LB broth containing kanamycin (model B540113-0100) at 37°C using a shaker. When the OD value reached 0.6, IPTG was added to a final concentration of 0.1-0.3 mM. After induction at 16-30°C for 15-18 h, the induced bacterial cells were collected and treated with a cell disruptor. The cells were centrifuged at 8000 rpm at 4°C for 10 min and then filtered through a 0.45 µm filter to obtain the protein sample. The sample was added to a Ni-NTA chromatography column and bound at 4°C for 3 h. It was then washed stepwise with 20 mM, 40 mM, 60 mM, 80 mM, and 100 mM imidazole solutions. These imidazole solutions also contained 20 mM NaH₂PO₄ and 500 mM NaCl, with a pH of 7.

4. Each wash consisted of 2... mL, and then collect grass carp IL-21 recombinant protein with protein elution buffer, which includes 500 mM imidazole, 20 mM NaH2PO4, 500 mM NaCl, and pH 7.

4. After dialyzing the grass carp IL-21 recombinant protein three times in a dialysis bag with PBS buffer, centrifuge at 12000 rpm and 4℃ for 10 min, and take 100 µL of supernatant for SDS-PAGE and Coomassie Brilliant Blue staining to analyze protein expression. It was confirmed that the expressed protein was grass carp IL-21 recombinant protein.

9. The application of the optimized gene, recombinant protein, or recombinant plasmid according to any one of claims 1-3, characterized in that, Applications include the following: (1) As a functional feed and feed additive for grass carp to enhance the integrity of the intestinal barrier, inhibit the load of pathogenic bacteria in the intestine, repair intestinal damage caused by bacterial infection, and protect intestinal homeostasis; (2) Application as a targeted therapeutic repair agent for enteritis that enhances the integrity of the intestinal barrier of grass carp, inhibits the load of pathogenic bacteria in the intestine, repairs intestinal damage caused by bacterial infection, and protects intestinal homeostasis; (3) Application as a special intestinal health care product for seedling cultivation to enhance the integrity of grass carp intestinal barrier, inhibit the load of pathogenic bacteria in the intestine, repair intestinal damage caused by bacterial infection, and protect intestinal homeostasis; (4) Development of genetic breeding targets for disease resistance in grass carp: This optimized gene will be used as the core molecular marker / gene editing target for breeding against bacterial enteritis, and new disease-resistant and high-yielding strains will be cultivated. (5) Basic research tools for fish intestinal immunity and homeostasis regulation.

10. The application according to claim 9, characterized in that, The recombinant grass carp IL-21 protein enhances the intestinal barrier integrity of grass carp by upregulating the expression of intestinal mucin and tight junction protein-related genes and promoting intestinal epithelial cell proliferation. Intestinal mucin-related genes include... agr2 , muc2 and klf4 Tight junction protein genes include zo-1 , claudin-3 and occludin Genes that regulate cell proliferation include Ki-67 , Cyclin D1 and mcm 2.

Citation Information

Patent Citations

  • A recombinant interleukin-21 protein from grass carp and its preparation method

    CN108822202B