Method for improving gene editing efficiency of eimeria tenella, tool and application thereof

By knocking out the KU80 gene in Eimeria tenella, inhibiting the NHEJ repair pathway, and promoting HR repair, a KU80-deleted strain of Eimeria tenella was constructed using the CRISPR Cas9 system. This solved the problem of low gene editing efficiency in Eimeria tenella and achieved efficient and stable gene editing results.

CN122128340APending Publication Date: 2026-06-02SHANGHAI VETERINARY RESEARCH INSTITUTE CAAS (CHINESE ANIMAL HEALTH & EPIDEMIOLOGY CENTER SHANGHAI BRANCH)
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SHANGHAI VETERINARY RESEARCH INSTITUTE CAAS (CHINESE ANIMAL HEALTH & EPIDEMIOLOGY CENTER SHANGHAI BRANCH)
Filing Date
2026-03-11
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

In existing technologies, gene editing efficiency of Eimeria tenella is low, especially the efficiency of homologous recombination, which leads to long gene function research cycles and difficulty in obtaining positive clones, thus limiting the development of Eimeria tenella genetic engineering.

Method used

By knocking out KU80, a key DNA repair factor in Eimeria tenella, the non-homologous end joining (NHEJ) repair pathway was inhibited, promoting the repair of DNA double-strand breaks through homologous recombination (HR). A KU80-deleted strain based on the CRISPR Cas9 system was constructed, and specific homologous recombination repair plasmids were designed to improve gene editing efficiency.

Benefits of technology

It significantly improved the efficiency of targeted integration of exogenous DNA at specific sites in the genome, reduced random integration events, constructed a stable and efficient gene editing platform, shortened the screening cycle of positive recombinant strains, and improved experimental reproducibility.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122128340A_ABST
    Figure CN122128340A_ABST
Patent Text Reader

Abstract

This invention provides a method, tool, and application for improving the gene editing efficiency of *Eimeria tenella*. The *Eimeria tenella* strain with KU80 deletion is obtained by knocking out the KU80 gene in *Eimeria tenella* using a CRISPR-Cas9 gene editing system. Compared with existing technologies, the tool and method of this invention can significantly improve gene-targeted integration efficiency, significantly reduce random integration events of exogenous DNA, and improve the accuracy and stability of gene editing. It is a universal gene editing platform that can be widely applied to gene knockout, gene knock-in, and endogenous marker research. The strain using this tool can significantly shorten the screening cycle for positive recombinant strains, improve experimental reproducibility, and provide important technical support for functional genomics research on *Eimeria tenella*.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, specifically to a method, tool, and application for improving the gene editing efficiency of Eimeria tenella. Background Technology

[0002] Eimeria coccidia ( Eimeria spp .) is an important protozoan pathogen causing coccidiosis in poultry, among which Eimeria tenella ( Eimeria tenella Infection of the chicken cecum with Eimeria protozoa causes severe hemorrhagic enteritis, often leading to growth retardation, increased feed conversion ratio, and significant economic losses. Due to its complex life cycle, strong host specificity, and reliance on host proliferation, the development of its molecular genetics research has long been severely limited. Although recent advancements in gene function research on Eimeria protozoa have been made with the introduction of transfection technology, drug screening systems, and nuclease-mediated gene editing systems, the overall efficiency of gene manipulation remains low, and the lack of a stable and reliable genetic manipulation system remains a key bottleneck restricting the development of this field.

[0003] In eukaryotic cells, the repair of DNA double-strand breaks (DSBs) primarily relies on two competing mechanisms: homologous recombination (HR) and non-homologous end joining (NHEJ). HR, by precisely pairing with homologous template sequences, enables targeted substitution or insertion of the desired fragment, making it an ideal pathway for gene knockout, gene tagging, and site-specific knock-in. However, in most wild-type protozoa, the NHEJ pathway dominates, leading to rapid DSB repair and random insertion, significantly reducing the efficiency of homologous recombination-based gene targeting. The key initiation factor of the NHEJ repair pathway, the Ku70 / Ku80 protein complex, rapidly recognizes the ends of broken DNA and recruits downstream repair factors such as DNA-PKcs and Lig4 to complete direct end joining. Clear evidence exists in multiple eukaryotic microorganisms and apical protozoa that disrupting key NHEJ genes (such as Ku70, Ku80, or Lig4) can significantly improve gene-targeted integration efficiency. For example, in fungi such as *Aspergillus* and *Magnaporthe grisea*, constructing Ku80 or lig4 deletion strains can increase gene targeting efficiency from less than 5% to over 80%. In the apical protozoan *Toxoplasma gondii*, knocking out Ku80 results in a gene knockout / knock-in efficiency that jumps hundreds of times, making it the most widely used "affinity background strain" in protozoan genetics. These studies collectively demonstrate that inhibiting or deleting NHEJ is a core strategy for improving targeted editing efficiency.

[0004] In Eimeria coccidia, although nucleases such as Cas9 and FnCas12a have been successfully applied to genome editing, achieving the knockout or labeling of some genes, the overall editing efficiency remains low, and random integration is prevalent. This makes site-specific gene substitutions (such as labeling, deletion, and point mutations) difficult to achieve. Especially in applications such as gene function research, antigen screening, and analysis of immune-related genes, inefficient homologous recombination (HR) leads to long research cycles, difficulty in obtaining positive clones, and poor reproducibility, greatly restricting the development of Eimeria coccidia genetic engineering. Therefore, constructing a "compatible background strain" with efficient homologous recombination capability has become an urgent need to achieve efficient and reproducible genetic operations.

[0005] Currently, gene editing research on *Eimeria tenella* mainly focuses on sgRNA design optimization or gene editing vector improvement, lacking a systematic technical solution to enhance editing efficiency at the level of the organism's DNA repair mechanism. Ku80 is known to be a core scaffold protein in the NHEJ pathway, playing an irreplaceable role in DNA break recognition and repair initiation. Theoretically, knocking out Ku80 in *Eimeria tenella* can inhibit NHEJ activity, making DNA damage repair more likely to occur via homologous recombination (HR), thereby significantly improving homologous recombination efficiency and reducing random integration events. Therefore, developing a *Eimeria tenella* gene editing tool strain based on Ku80 knockout to achieve efficient homologous recombination and reduce random integration has significant research value and application prospects. Summary of the Invention

[0006] To address the aforementioned shortcomings of existing technologies, this invention inhibits the non-homologous end joining (NHEJ) repair pathway by knocking out KU80, a key DNA repair factor in *Eimeria tenella*. This makes DNA double-strand breaks more likely to be repaired via homologous recombination (HR), thereby significantly improving the targeted integration efficiency of exogenous DNA at specific sites in the genome. Compared to existing methods that mainly improve gene editing efficiency by optimizing sgRNA sequences or improving vector structures, this invention regulates at the level of the host DNA repair mechanism, establishing a stable, efficient, and universally applicable gene editing platform for *Eimeria tenella*.

[0007] To achieve the above-mentioned objectives, the technical solution adopted by this invention is as follows: First, the present invention provides a strain of Eimeria tenella lacking KU80.

[0008] Furthermore, the KU80-deficient Eimeria tenella strain was obtained by knocking out the KU80 gene in Eimeria tenella using a CRISPR Cas9 gene editing system.

[0009] Furthermore, the present invention provides a homologous recombination repair plasmid, which is a homologous recombination repair plasmid based on the pBM16A backbone. The preparation method is as follows: a selection expression cassette (such as DHFR-mCherry element) is inserted between the 1977bp 5′ homologous arm (5′ARM) and the 2000bp 3′ homologous arm (3′ARM). At the same time, sgRNA expression cassettes driven by the U6 promoter are added before the 5′ homologous arm (5′ARM) and after the 3′ homologous arm (3′ARM) to improve the targeting efficiency.

[0010] Furthermore, the core sequence of the homologous recombination repair plasmid is composed of: U6+sgRNA1+ scaffold+5′ARM+DHFR+mCherry+3′ARM+U6+sgRNA2+ scaffold, wherein the specific sequences of each component are as follows: U6: (SEQ ID NO.1); sgRNA1:ATCGGCTAAAGGATTGTGGG(SEQ ID NO.2); scaffold:GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAGTGGCACCGAGTCGGTGCTTTTTTGAGCTCCAGCTTTTGTTCCCTTTAGTGAGGGTTAATTTCG(SEQ ID NO.3); mCherry:ATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGTAG (SEQ ID NO.6); sgRNA2:AGACTGGCCTGCTAAACTAG (SEQ ID NO.8); scaffold: (SEQ ID NO.3).

[0011] Furthermore, this invention provides a highly efficient gene editing method for a KU80 deletion-type tool strain of *Eimeria tenella*, the method comprising the following steps: 1) EtKU80 gene target analysis and sgRNA design; 2) Construction of the repair plasmid; 3) Coccidia transfection and screening of KU80 deletion strains.

[0012] Specifically, step 1) involves designing two sgRNAs (sgRNA1 and sgRNA2) on either side of the KU80 CDS to target the 5′ and 3′ regions of the KU80 gene, thereby increasing cleavage efficiency to achieve large fragment deletion and inserting selection markers through homologous recombination. Further preferred formulations include the 5' homologous arm (F: TGCAGCCCTGAACAGCAAAATG (SEQ ID NO. 9); R: TGAATTTTTGCTGCGCCTGCGTC (SEQ ID NO. 10)) and the 3' homologous arm (F: ATGGAAGAAGCAGCCGTTTA (SEQ ID NO. 11); R: TAGCGACAGCAACTGGAGTG (SEQ ID NO. 12)), two sgRNAs, namely sgRNA1: ATCGGCTAAAGGATTGTGGG (SEQ ID NO. 2) and sgRNA2: AGACTGGCCTGCTAAACTAG (SEQ ID NO. 8), followed by amplification of DHFR (F: ATGCAGAAGCCGGTGTGTCT (SEQ ID NO. 13), R: GGTGGCGACAGGATCCAAGA (SEQ ID NO. 14)) and mCherr (F: ATGGTGAGCAAGGGCGAGGA (SEQ ID NO. 15)). R:CTACTTGTACAGCTCGTCCA (SEQ ID NO.16) sequence, for future reference; Step 2) specifically involves constructing a homologous recombination repair plasmid based on the pBM16A backbone: inserting a selection expression cassette (such as the DHFR-mCherry element) between the 1977bp 5′ homologous arm (5′ARM) and the 2000bp 3′ homologous arm (3′ARM), and simultaneously adding a U6 promoter-driven sgRNA expression cassette before the 5′ homologous arm (5′ARM) and after the 3′ homologous arm (3′ARM) to improve targeting efficiency; finally, the constructed circular plasmid is double-digested to obtain a linear fragment of U6+sgRNA1+scaffold+5′ARM+DHFR+mCherry+3′ARM+U6+sgRNA2+scaffold for later use; Step 3) specifically involves collecting E. tenella sporozoites and co-transferring the linear repair model into the sporozoites using electroporation. After infecting chicks with the transfected sporozoites, in vivo screening was performed under conditions containing pyrimidine antagonists. Through multiple passages and drug screening, a stable KU80 deletion strain (KU80-KO) expressing DHFR and mCherry was obtained.

[0013] Furthermore, the present invention provides an EtKU80 deletion strain obtained using the above method; Furthermore, this invention provides an application of the above-described method or the obtained EtKU80 deletion strain in coccidia functional genomics research.

[0014] Compared with existing technologies, this invention has at least the following beneficial effects: By knocking out the KU80 gene and inhibiting the NHEJ repair pathway, this invention makes DNA double-strand breaks more likely to be repaired via the HR pathway, thereby significantly improving gene-targeted integration efficiency; the KU80-deficient tool strain constructed by this invention can significantly reduce random integration events of exogenous DNA, improving the accuracy and stability of gene editing; the tool strain provided by this invention is not targeted at a single gene, but is a universal gene editing platform that can be widely applied to gene knockout, gene knock-in, and endogenous marker studies; this tool strain can significantly shorten the screening cycle of positive recombinant strains, improve experimental reproducibility, and provide important technical support for functional genomics research on Eimeria tenella. Attached Figure Description

[0015] Figure 1: PCR identification of the KU80-KO strain and the PCR identification results of the deletion strain. HCYA represents the amplification product using wild-type genomic DNA as a template. 5' lns: primers with one end located outside the 5' homologous arm of the genome and the other end located inside DHFR / mCherry, with a size of 2365bp; 3' lns: primers with one end located outside the 3' homologous arm of the genome and the other end located inside DHFR / mCherry, with a size of 2390bp; KU80 CDS detection: amplification of the internal fragment of KU80CDS using specific primers, with a size of 573bp. Figure 2 Identification of the KU80-KO strain by genome resequencing; Figure 3 Validation of EtKU80-KO gene editing efficiency: A: Gene knockout diagram: The Cas9-YFP-KO vector was transfected into EtKU80-KO and EtHCYA strains, respectively, to disrupt and homologously recombine the Cas9-YFP gene sequence. This Cas9-YFP-KO vector contains a gRNA targeting the YFP gene sequence, initiated by the EtU6 promoter, and a DIC (diclazuril resistance frame) coding frame (without promoter) with 5' and 3' homologous arms. Endogenous Cas9-YFP gene knockout was identified by PCR (B) and flow cytometry analysis of fluorescence (C and D).

[0016] Figure 4 The pathogenicity of the EtKU80-KO strain was tested, and the oviposition curves (A), total number of oviposition cysts (B), intestinal pathogenicity (C), and weight gain (D) of the EtKU80-KO and EtHCYA strains were compared and analyzed. For the oviposition curve and total oviposition cyst count, 1000 oviposition cysts were inoculated per chicken (6 chickens / group), and the oviposition cysts were counted daily, repeated 3 times. For the pathogenicity experiment, the inoculation dose was 10000 oviposition cysts / chicken (5 chickens / group), and intestinal lesions were observed 7 days after inoculation. Ns: Not significant; p<0.05.

[0017] Figure 5 The immune protection effect of the EtKU80-KO strain was evaluated, and the total number of oocysts (A), oocyst production rate (B), weight gain rate (C), and enteric pathogenicity (D) of the EtKU80-KO immunized group were compared with those of other groups. The immunization dose was 1000 oocysts (6 chickens / group), and the challenge dose after immunization was 20000 oocysts. Ns: Not significant; p<0.05. Detailed Implementation

[0018] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.

[0019] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0020] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0021] Example 1 Construction of EtKU80 deletion strain Experimental insect strains and host animals The coccidia strain used in this experiment was the Houghton strain of *Eimeria tenella* (HCYA) (Tang et al. Genetic modification of the protozoan *Eimeria tenella* using the CRISPR / Cas9 system. Vet Res. 2020 Mar 11;51(1):41.), which stably expresses the Cas9 protein, thus eliminating the need to construct a Cas9 plasmid. All coccidia were passaged and maintained in SPF chicks. The SPF chicks used in the experiment were purchased from an experimental animal center and raised under sterile conditions with free access to food and water.

[0022] EtKU80 gene target analysis and sgRNA design According to the E. tenella genome database ( E. tenellaThe coding sequence (CDS) of the KU80 gene (gene ID ETH2_0702700) is 3932 bp in length. To achieve complete knockout of the KU80 gene, two sgRNAs (sgRNA1 and sgRNA2) were designed flanking the KU80 CDS, targeting the 5′ and 3′ ends of the KU80 gene to increase cleavage efficiency for large-fragment deletion and insert selection markers via homologous recombination. The sgRNAs are driven by the U6 promoter and form a complex with the Cas9 protein via a scaffold sequence. Among them, the 5' homologous arm (F: TGCAGCCCTGAACAGCAAAATG (SEQ ID NO.9); R: TGAATTTTTGCTGCGCCTGCGTC (SEQ ID NO.10)) and the 3' homologous arm (F: ATGGAAGAAGCAGCCGTTTA (SEQ ID NO.11); R: TAGCGACAGCAACTGGAGTG (SEQ ID NO.12)), and two sgRNAs, namely sgRNA1: ATCGGCTAAAGGATTGTGGG (SEQ ID NO.2) and sgRNA2: AGACTGGCCTGCTAAACTAG (SEQ ID NO.8), were amplified using the Cas9-KO plasmid preserved in the laboratory as a template (Qiao et al. EtMIC2 overexpression attenuates pathogenicity while enhancing oocyst production and immunogenicity in Eimeria tenella. Int J Biol Macromol. 2025;331(Pt 1):148361) to amplify DHFR (F: ATGCAGAAGCCGGTGTGTCT (SEQ ID NO. 13), R: GGTGGCGACAGGATCCAAGA (SEQ ID NO. 14)) and mCherr (F: ATGGTGAGCAAGGGCGAGGA (SEQ ID NO. 15), R: CTACTTGTACAGCTCGTCCA (SEQ ID NO. 16)) sequences, spare.

[0023] Construction of the repair plasmid A homologous recombination repair plasmid based on the pBM16A backbone was constructed: a selection expression cassette (such as the DHFR-mCherry element) was inserted between the 1977bp 5′ homologous arm (5′ARM) and the 2000bp 3′ homologous arm (3′ARM). Simultaneously, U6 promoter-driven sgRNA expression cassettes were added before the 5′ homologous arm (5′ARM) and after the 3′ homologous arm (3′ARM) to improve targeting efficiency. Finally, the constructed circular plasmid was double-digested to obtain a linear fragment of U6+sgRNA1+scaffold+5′ARM+DHFR+mCherry+3′ARM+U6+sgRNA2+scaffold for later use.

[0024] Coccidia transfection and screening of KU80 deletion strains collect E. tenella The linear repair model was co-transfected into sporozoites using electroporation. After infection of chicks with the transfected sporozoites, in vivo screening was performed under conditions containing pyrimidine antagonists. Through multiple passages and drug screening, a stable KU80 deletion strain expressing mCherry (KU80-KO) was obtained.

[0025] PCR molecular identification of KU80 deletion strain Genomic DNA was extracted from KU80-KO and wild-type coccidia, and the following PCR identification methods were performed: 5′ integration identification (5′Ins): primers with one end located outside the 5′ homologous arm of the genome and the other end located inside DHFR / mCherry were used; 3′ integration identification (3Ins): primers with one end located outside the 3′ homologous arm of the genome and the other end located inside DHFR / mCherry were used; KU80 CDS detection: 5′ Ins (F: CCTATGCTCTCAGTTACGAC (SEQ ID NO.17), R: TTGCAAATTTCCTGGGAAGC (SEQ ID NO.18)), 3′ Ins (F: AGATCAAGCAGAGGCTGAAG (SEQ ID NO.19), R: AAGCTGCTGCACAAGAGGAG (SEQ ID NO.20)), and KU80 CDS internal fragment (F: ATGACCAGCGTGCAATCGGT (SEQ ID NO.21), R: ATAAGCGGCTGCAAGCGAATC (SEQ ID NO.22) was amplified, and the PCR product was analyzed by agarose gel electrophoresis and then recovered from the gel for sequencing. PCR results showed ( Figure 1The expected 5′ Ins and 3′ Ins bands were amplified in the KU80-KO strain; these integration bands were not detected in the wild-type strain. KU80 CDS-specific amplification was detected only in the wild-type strain and was completely absent in KU80-KO. These results indicate that the DHFR-mCherry selection cassette has been successfully integrated into the KU80 gene locus and replaced the original KU80 coding sequence, demonstrating that CRISPR / Cas9-mediated homologous recombination can achieve precise substitution at specific sites in the *Eimeria tenella* genome. Compared to random integration, the strategy employed in this invention achieves more stable and controllable genome editing, laying the foundation for the subsequent construction of efficient gene-editing tool strains.

[0026] Whole genome sequencing and IGV alignment analysis Genomic DNA extracted from the KU80-KO strain was subjected to Illumina next-generation sequencing. Sequencing data were aligned with the *E. tenella* reference genome, and the KU80 gene region was visualized using IGV software to verify whether the KU80 CDS was completely deleted and correctly replaced by the DHFR-mCherry box. Coverage analysis of the KU80 gene region was performed based on the next-generation sequencing data. The degree of deletion of the KU80 gene in the KU80-KO strain was assessed by comparing the sequencing depth of the KU80 CDS region with its upstream and downstream gene regions. IGV alignment results (Figure 2) showed that the KU80-KO strain had almost no sequencing reads covering the KU80 gene CDS region, while the coverage of its upstream and downstream gene regions was normal, indicating that the KU80 CDS was completely deleted without any residual copies. Coverage analysis based on next-generation sequencing showed that the KU80CDS region coverage was close to 0, while the coverage of upstream and downstream regions was consistent with the average level of the whole genome. This result further demonstrates that the KU80 gene was completely deleted in the KU80-KO strain without any partial residue or abnormal rearrangement, indicating that the KU80-deleted strain constructed in this invention has high genomic stability. Simultaneously, this result also demonstrates that the tool strain constructed using this invention can achieve high-precision gene-targeted substitution, providing a reliable genetic background for subsequent gene function studies, which is a first in this field.

[0027] Example 2: Validation of gene editing efficiency in EtKU80 deletion strains To investigate the efficiency of our constructed EtKU80-deleted strain and EtHCYA strain in disrupting target genes, we designed a gRNA donor plasmid specifically targeting the EYFP gene. By comparing the gene targeting efficiency of the KU80-deleted strain and the wild-type strain under the same CRISPR / Cas9 editing system, we can assess the impact of KU80 deletion on homologous recombination efficiency. Theoretically, since KU80 is a key protein in the NHEJ repair pathway, its deletion will significantly reduce NHEJ repair activity, making DNA double-strand breaks more likely to be repaired through homologous recombination, thereby improving the targeted integration efficiency of exogenous DNA fragments at the target gene site. First, there are homologous recombination arms at both ends, including a 5′ homologous arm (5′ARM) of approximately 500 bp and a 3′ homologous arm (3′ARM) of approximately 500 bp. Their sequences correspond to the upstream and downstream genomic regions of the EYFP gene, respectively, and are used to mediate homologous targeted repair after Cas9 cleavage. Second, there is a selection cassette (DIC, diclazuril resistance expression cassette) inserted between the two homologous arms, which is used to replace the original EYFP coding sequence and achieve drug screening. In addition, the donor fragment also contains an sgRNA expression cassette driven by the U6 promoter (containing a specific gRNA sequence and a scaffold backbone sequence), which is used to continuously guide Cas9 to target the EYFP site to generate double-strand breaks after transfection, thereby improving homologous recombination efficiency.(5’ARM:ACGAGATTATTGAGCAGATTAGCGAGTTCAGCAAGCGCGTGATTCTGGCAGACGCAAACCTGGACAAGGTGCTGAGCGCATACAACAAGCACCGCGACAAGCCCATTCGCGAGCAGGCAGAGAACATTATTCACCTGTTCACACTGACAAACCTGGGCGCACCCGCAGCATTCAAGTACTTCGACACAACAATTGACCGCAAGCGCTACACAAGCACAAAGGAGGTGCTGGACGCAACACTGATTCACCAGAGCATTACAGGCCTGTACGAGACACGCATTGACCTGAGCCAGCTGGGCGGCGACGCATACCCCTACGACGTGCCCGACTACGCAAGCCTGGGCAGCGGCAGCCCCAAGAAGAAGCGCAAGGTGGAGGACCCCAAGAAGAAGCGCAAGGTGGACCCATGGGATTACAAGGATGACGACGATAAGGGAAGCGGAGCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCT(SEQ ID NO.23);。 3' ARM: CCTAGGGTTTGCAGCAGAGTAGTTCATGACTTGCGAAACGGCCTCTCGATTAATAATACGCTTTGCCGCAACGTGAAGTAGGCGTTATTGTGTGCTGCCTGTCGCTGAGCTCCTGCATCGAGCGGCAAGGGGTTCAACCGAGCGCAAATTCTGTGGAAATAGCTGGACAAAAGCATCTGCGACGGGTGGGGGCAGGCGCAGCTAGCTGTTGCTCCCGACATCAGTCATGGAAATGCGTTTCAGGCTAAGCAAGTAGCTGCCCGCCTGGTGGGAAGATGAGGCTAGGAACTGCTATGTTTGCCCCTCACTTGGCGGTATTGCAGTGTAGTACGTGCATTGTGAACCCAGAGAAATGTGCTCCGCGTGACGCAGCGAGGCACAGGGGAACAGCAAGAGGGGCCGTTATTGCTCAGCGTGCTGGACCCCCTTGTTCCTTCAAACCTTACTTATGAGGGCTTACGCATCGCACCTGATGGGTCGGTGTAGCGTGATCATT (SEQ ID NO.25); U6: (SEQ ID NO.1); gRNA: GTAGCTCAGGTAGTGGTTGT (SEQ ID NO.26); scaffold: (SEQ ID NO.3)). The constructed Cas9-EYFP-KO homologous recombination donor fragment (including 5' ARM (~500 bp) + DIC (diclazuril resistance screening cassette) + 3' ARM (~500 bp) + U6 + gRNA + scaffold) ( Figure 3A) After transfection into the EtKU80 deletion strain and the EtHCYA strain, respectively, the vector contained both a gRNA transcription frame targeting the YFP gene and a homologous recombination frame targeting the Cas9-YFP sequence. However, this homologous recombination frame did not contain an additional promoter and could only initiate gene expression within the homologous frame by relying on the His4 promoter upstream of the original Cas9. Therefore, only after homologous recombination occurred and was accurate could the diclazuril (DIC) resistance gene within the homologous frame be expressed, simultaneously replacing the entire YFP fragment. After screening for positive strains with diclazuril, the first generation of sporulated oocysts were collected and sporangia were extracted. The YFP fluorescence percentage was analyzed using flow cytometry to accurately assess the target gene disruption efficiency (i.e., editing efficiency). PCR sequencing of the obtained oocyst progeny confirmed the successful construction of the KU80-KO-Cas9-YFP knockout strain. Figure 3 B). Further flow cytometry analysis showed that the proportion of correct homologous recombination in the EtKU80-KO strain was 11.8%, while the proportion of correct homologous recombination in the EtHCYA strain was only 1.3%. Figure 3 C). This data indicates that the homologous recombination efficiency of the EtKU80-KO strain is approximately nine times that of the EtHCYA strain, with the former exhibiting significantly higher recombination efficiency.

[0028] Pathogenicity assessment of KU80 deletion strains SPF chicks were randomly assigned to groups and infected with the same doses of KU80-KO, HCYA, and wild-type coccidia, respectively. Pathogenicity was assessed using the following indicators: changes in body weight gain, cecal lesion score, and number of oocysts (OPG). Compared to wild-type, chicks infected with EtKU80-KO showed no significant changes in body weight gain and cecal lesion score, but a slightly reduced number of oocysts, indicating that the absence of KU80 slightly reduced the pathogenicity of coccidia. Figure 4 ).

[0029] Immunogenicity assessment of KU80 deletion strains Chicks were initially infected with KU80-KO and then challenged with wild-type coccidia after a certain period. The effectiveness of immunoprotection was assessed using the following indicators: changes in body weight gain, cecal lesion score, and number of oocytes released (OPG). The results of the immunoprotection experiment showed that, compared with other immunization groups, the KU80-KO immunization group had no significant impact on cecal lesion score, oocyte release, or body weight change after challenge. Figure 5 This indicates that the KU80 deletion strain still possesses good immunogenicity.

[0030] In summary, this invention has constructed a tool strain of *Eimeria tenella* with highly efficient homologous recombination capabilities by knocking out the KU80 gene. Experimental results show that this strain not only exhibits stable inheritance but also significantly improves the efficiency of CRISPR / Cas9-mediated gene substitution and reduces random integration events. This tool strain can be widely applied in research fields such as *Eimeria tenella* gene knockout, gene knock-in, endogenous markers, and functional gene screening, demonstrating significant scientific research value and application prospects.

[0031] The above description of the embodiments is intended to enable those skilled in the art to understand and use the present invention. It will be apparent to those skilled in the art that various modifications can be made to these embodiments, and the general principles described herein can be applied to other embodiments without inventive effort. Therefore, the present invention is not limited to the above embodiments. Improvements and modifications made by those skilled in the art based on the principles of the present invention, without departing from the scope of the invention, should be within the protection scope of the present invention.

Claims

1. A homologous recombination repair plasmid, characterized in that, The homologous recombination repair plasmid is a homologous recombination repair plasmid based on the pBM16A backbone. Its preparation method is as follows: a selection expression cassette is inserted between the 1977bp 5′ homologous arm and the 2000bp 3′ homologous arm. Simultaneously, sgRNA expression cassettes driven by the U6 promoter are added before the 5′ homologous arm and after the 3′ homologous arm to improve targeting efficiency. The core sequence of the homologous recombination repair plasmid is: U6+sgRNA1+scaffold+5′ARM+DHFR+mCherry+3′ARM+U6+sgRNA2+scaffold, where the nucleotide sequence of sgRNA1 is shown in SEQ ID NO.2; and the nucleotide sequence of sgRNA2 is shown in SEQ ID NO.

8.

2. The homologous recombination repair plasmid as described in claim 1, wherein, The specific sequences of each component are as follows: the nucleotide sequence of U6 is shown in SEQ ID NO.1; the nucleotide sequence of scaffold is shown in SEQ ID NO.3; the nucleotide sequence of 5'ARM is shown in SEQ ID NO.4; the nucleotide sequence of DHFR is shown in SEQ ID NO.5; the nucleotide sequence of mCherry is shown in SEQ ID NO.6; and the nucleotide sequence of 3'ARM is shown in SEQ ID NO.

6.

3. A method for efficient gene editing of the KU80 deletion type of *Eimeria tenella* using the homologous recombination repair plasmid as described in claim 1 or 2, the method comprising the following steps: 1) EtKU80 gene target analysis and sgRNA design; 2) Construction of the repair plasmid; 3) Coccidia transfection and screening of KU80 deletion strains. in, Step 1) Specifically, sgRNA1 and sgRNA2 are designed on both sides of the KU80 CDS to target the 5′ and 3′ regions of the KU80 gene, respectively, to increase cleavage efficiency, achieve large fragment deletion, and insert selection markers through homologous recombination.

4. The method of claim 3, wherein the amplification primers for the 5' homologous arm are: F: TGCAGCCCTGAACAGCAAAATG (SEQ ID NO. 9); R: TGAATTTTTGCTGCGCCTGCGTC (SEQ ID NO. 10); the amplification primers for the 3' homologous arm are: F: ATGGAAGAAGCAGCCGTTTA (SEQ ID NO. 11); R: TAGCGGACAGCAACTGGAGTG (SEQ ID NO. 12); the primers for amplifying DHFR are: F: ATGGAAGAAGCCGGTGTGTCT (SEQ ID NO. 13), R: GGTGGCGACAGGATCCAAGA (SEQ ID NO. 14); and the primers for amplifying mCherr are: F: ATGGTGAGCAAGGGCGAGGA (SEQ ID NO. 15), R: CTACTTGTACAGCTCGTCCA (SEQ ID NO. 16).

5. The method of claim 3, wherein, Step 2) Specifically, construct a homologous recombination repair plasmid based on the pBM16A backbone: insert a selection expression cassette between the 1977bp 5′ homologous arm and the 2000bp 3′ homologous arm, and add a U6 promoter-driven sgRNA expression cassette before the 5′ homologous arm and after the 3′ homologous arm to improve targeting efficiency; finally, perform double digestion on the constructed circular plasmid to obtain a linear fragment of U6+sgRNA1+scaffold+5′ARM+DHFR+mCherry+3′ARM+U6+sgRNA2+scaffold for later use.

6. The method of claim 3, wherein, Step 3) Specifically: Collect E. tenella sporozoites and co-transfer the linear repair model into the sporozoites using electroporation; after the transfected sporozoites are infected with chicks, in vivo screening is performed under conditions containing pyrimidine antagonists. Through multiple generations of passage and drug screening, a KU80 deletion strain that stably expresses DHFR and mCherry is obtained and named KU80-KO.

7. A strain of *Eimeria tenella* lacking KU80, characterized in that... The KU80-deficient Eimeria tenella strain is obtained by using the method described in any one of claims 3-6, based on the CRISPR Cas9 gene editing system to knock out the KU80 gene in Eimeria tenella.

8. The homologous recombination repair plasmid according to claim 1 or 2, the method according to any one of claims 3-6, and / or the application of a KU80-deleted Eimeria tenella strain according to claim 7 in coccidia functional genomics research.