A SNP molecular marker associated with the density of pubescence on tea shoots and its application

By screening SNP molecular markers related to the density of pubescence on new tea shoots and amplifying the genomic DNA of tea trees using specific primers, the problems of long breeding cycles and significant environmental impacts of tea tree pubescence traits have been solved, enabling early and accurate prediction and efficient breeding.

CN122128464APending Publication Date: 2026-06-02TEA RESEARCH INSTITUTE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
TEA RESEARCH INSTITUTE CHINESE ACADEMY OF AGRICULTURAL SCIENCES
Filing Date
2026-04-22
Publication Date
2026-06-02

AI Technical Summary

Technical Problem

In existing technologies, the genetic improvement of tea tree pubescence density is greatly affected by the environment, and traditional methods are difficult to accurately locate stable major QTLs, resulting in a long breeding cycle and insignificant effects for tea tree pubescence traits.

Method used

Two SNP molecular markers (SNPtri1 and SNPtri2) associated with the density of pubescence on new tea shoots were provided. These markers were obtained through screening, and tea genomic DNA was amplified using specific primers to determine the genotype and predict pubescence density. KASP or Sanger sequencing technology was then used for efficient screening.

Benefits of technology

It enables accurate prediction of trichome density during the tea seedling stage or early seed germination stage, shortening the breeding cycle, improving selection accuracy and efficiency, and is suitable for large-scale germplasm resource screening.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122128464A_ABST
    Figure CN122128464A_ABST
Patent Text Reader

Abstract

This invention discloses a SNP molecular marker related to the density of pubescence on new shoots of tea trees and its application, belonging to the field of molecular marker technology. This invention develops two SNP molecular markers related to the density of pubescence on new shoots of tea trees: (1) the SNPtri1 molecular marker, whose nucleotide sequence is shown in SEQ ID NO.1. An A / G base polymorphism exists at the 101st base position in this sequence. When the polymorphic site is the AG genotype, it indicates a tea tree with high pubescence density; (2) the SNPtri2 molecular marker, whose nucleotide sequence is shown in SEQ ID NO.2. An A / G base polymorphism exists at the 101st base position in this sequence. When the polymorphic site is the AG genotype, it indicates a tea tree with high pubescence density. Using the molecular markers provided by this invention, tea tree germplasm resources with different pubescence densities can be accurately identified or screened during the seedling stage, possessing significant breeding application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular marker technology, and in particular to an SNP molecular marker related to the density of trichomes on new shoots of tea trees and its application. Background Technology

[0002] tea tree( Camellia sinensis As one of the world's three major beverage crops, tea is widely cultivated in more than 50 countries and possesses extremely high economic value. In the production of high-quality tea, harvesting standards (such as single bud, one bud and one leaf) are strictly controlled. Among these, the downy hairs are a key agronomical trait determining tea quality and yield. Downy hairs not only constitute important characteristics of tea's appearance and taste but are also rich in volatile compounds such as phenols and aldehydes, giving tea its unique "downy aroma." Simultaneously, as a barrier against biotic and abiotic stresses, downy hairs are crucial for tea trees to adapt to harsh environments. However, research on the molecular mechanisms regulating tea tree downy hair density and bud size has long lagged behind, limiting the genetic improvement of related traits and variety selection.

[0003] With breakthroughs in high-throughput sequencing technology, molecular breeding research based on high-quality reference genomes and high-density genetic maps has made significant progress. Due to the self-incompatibility, long breeding cycle, and high heterozygosity of tea plants, constructing permanent mapping populations is challenging. However, some progress has been made in locating quantitative trait loci (QTLs) using the F1 generation testcross strategy. Previous studies have utilized this strategy to achieve breakthroughs in the genetic analysis of tea biochemical components (caffeine, catechins, etc.) and stress resistance traits (drought resistance, disease resistance). For example, Koech et al. located multiple QTLs affecting tea biochemical characteristics and drought stress; Wang et al. screened 23 candidate genes related to the spring budding index (SPI) in the Longjing 43 × Baihaozao population; and Zhang et al. identified a major QTL (qAR-12.4) for anthracnose resistance in the Longjing 43 × Baijiguan population and discovered the positive regulator CsERF105.

[0004] However, as a typical complex microscopic quantitative trait, pubescence density exhibits a significant genotype-environment interaction (GxE) effect in its phenotypic expression. Strong environmental noise severely masks true genetic variation, easily leading to minor or environment-specific QTLs that cannot be stably expressed across years. Furthermore, the difficulty in observing the specialized single-cell structure of pubescence in tea shoots, coupled with the physical obstruction caused by the natural curling of young leaves using traditional artificial methods, further distorts phenotypic data, resulting in a severe underestimation of the LOD value and PVE of QTL mapping. Although there are existing studies on QTL mapping in tea plants, stable major-effect QTLs and their practical molecular markers for pubescence density—a key indicator affecting tea appearance quality—are still lacking, limiting the genetic improvement and variety selection of related traits. Summary of the Invention

[0005] The purpose of this invention is to provide an SNP molecular marker related to the density of pubescence on tea tree shoots and its application, so as to solve the problems existing in the prior art. By screening, two SNP molecular markers that are significantly related to the density of pubescence on tea tree shoots are obtained. Using these molecular markers to screen high-pubescent tea tree germplasm can solve the problems of long breeding cycle and great influence of environment in the prior art for tea tree pubescence traits.

[0006] To achieve the above objectives, the present invention provides the following solution: This invention provides a SNP molecular marker related to the pubescence density trait of tea tree shoots, wherein the SNP molecular marker includes at least one of the following molecular markers: (1) SNPtri1 molecular marker, whose nucleotide sequence is shown in SEQ ID NO.1. There is an A / G base polymorphism at the 101st base in the nucleotide sequence shown in SEQ ID NO.1 (i.e., the 97496559bp base on chromosome 13 of the tea tree genome); (2) SNPtri2 molecular marker, whose nucleotide sequence is shown in SEQ ID NO.2. There is an A / G base polymorphism at the 101st base (67888062 bp base on chromosome 14 of the tea tree genome) in the nucleotide sequence shown in SEQ ID NO.2.

[0007] Preferably, the genotypes of the polymorphic sites of the SNPtri1 molecular marker are AG and GG, and the genotypes of the polymorphic sites of the SNPtri2 molecular marker are AG and AA.

[0008] The present invention also provides primer pairs for amplifying or detecting the SNP molecular markers.

[0009] Preferably, the primer pair sequences for amplifying or detecting the SNPtri1 molecular marker are shown in SEQ ID NO. 3-4, and the primer pair sequences for amplifying or detecting the SNPtri2 molecular marker are shown in SEQ ID NO. 5-6.

[0010] The present invention also provides the application of reagents for detecting the SNP molecular markers or the primer pairs described therein in identifying the pubescence density trait of tea shoots.

[0011] The present invention also provides the application of reagents for detecting the SNP molecular markers or the primer pairs described therein in the breeding of tea shoot pubescence density traits.

[0012] The present invention also provides a product for identifying the density of pubescence on new shoots of tea trees, comprising the primer pair described above.

[0013] The present invention also provides a method for identifying the density of pubescence on new tea shoots, comprising the following steps: Using genomic DNA from the new shoot tissue of the tea plant to be tested as a template, the SNP molecular markers were amplified using primer pairs. The pubescence density trait of the new shoot was determined based on the genotype of the polymorphic sites of the SNP molecular markers. The primer pair sequences for amplifying the SNPtri1 molecular marker are shown in SEQ ID NO.3-4, and the primer pair sequences for amplifying the SNPtri2 molecular marker are shown in SEQ ID NO.5-6. The criteria for judgment are as follows: the A allele at the polymorphic site of the SNPtri1 molecular marker is positively correlated with the tall hair trait; the G allele at the polymorphic site of the SNPtri2 molecular marker is positively correlated with the tall hair trait.

[0014] Preferably, the pubescence density of tea shoots is higher when the polymorphic site of the SNPtri1 molecular marker has the genotype AG than when it has the genotype GG. The density of pubescence on tea shoots was higher when the polymorphic site of the SNPtri2 molecular marker was AG than when the genotype was AA.

[0015] This invention also provides a breeding method for tea tree shoots with high pubescence density, comprising the following steps: Using genomic DNA from the new shoot tissue of the tea plant to be tested as a template, the SNP molecular markers were amplified using primer pairs. Based on the genotypes of the polymorphic sites of the SNP molecular markers, plants with the potential for high hair density trait in the new shoots of the tea plant to be tested were selected. The primer pair sequences for amplifying the SNPtri1 molecular marker are shown in SEQ ID NO. 3-4, and the primer pair sequences for amplifying the SNPtri2 molecular marker are shown in SEQ ID NO. 5-6. The selection criteria are: tea plants with the genotype AG at the polymorphic site of the SNPtri1 molecular marker; and / or tea plants with the genotype AG at the polymorphic site of the SNPtri2 molecular marker.

[0016] The present invention discloses the following technical effects: (1) High accuracy: The SNP molecular markers provided by this invention are derived from major QTL intervals that were stably detected in 2022 and 2024, with a phenotypic contribution rate (PVE) of up to 20.6% and a LOD value as high as 9.53. The developed SNP markers show a highly significant correlation with trichome density at the DNA level. P The value can reach 3.48 × 10 -10 It completely eliminates environmental noise interference and has extremely high reliability and selection accuracy.

[0017] (2) Early screening: This invention breaks through the time and space limitations of traditional breeding. By utilizing the developed SNP molecular markers and matching specific detection primers, only a very small amount of tissue DNA needs to be extracted during the seedling stage of tea trees or even the early stage of seed germination to directly and accurately predict and assist in screening the potential of pubescence density. This advantage eliminates the long process of waiting for the plant to mature and is not limited by the age of the tea tree or the specific harvesting season, which can accelerate the breeding process of superior tea varieties with high pubescence many times over.

[0018] (3) Convenient application: This invention identifies two specific polymorphic sites (SNPtri1 and SNPtri2) that control trichome density, with distinct polymorphisms, and provides experimentally validated specific amplification primer combinations. This technical solution is standardized and simple to operate, and can be seamlessly integrated with KASP (competitive allele-specific PCR), Sanger sequencing, or other high-throughput genotyping platforms, making it suitable for large-scale screening of germplasm resources. Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0020] Figure 1 This is a high-density genetic map of tea plants constructed based on SNP markers, showing the marker distribution of 15 linkage groups (LG1-LG15); Figure 2 The genetic map constructed for this invention and the collinearity diagram of the tea plant reference genome are shown; the correspondence between the genetic map distances of SNP markers on the genetic map and their physical locations on the reference genome for 15 linkage groups is also shown. Figure 3 A heatmap of recombination rates and LOD values ​​between markers on a genetic map shows the linkage and recombination relationships between markers within 15 linkage groups; Figure 4 The distribution of LOD values ​​for QTL localization of the trichome phenotype shows the significant major QTL peaks on Chr13 and Chr14; A: GX202209, B: GX202409; Figure 5 Box plots showing the trichome density phenotypes for different genotypes of SNPtri1 and SNPtri2, demonstrating a highly significant correlation between genotype and phenotype; A: SNPtri1, B: SNPtri2. Detailed Implementation

[0021] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0022] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0023] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0024] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0025] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0026] The tea plant reference genome version used in this invention is the chromosome-level reference genome V2.0 of 'Shuchazao' (Camellia sinensis var. sinensis cv. Shuchazao). This genome sequence data can be obtained from the Tea Plant Information Archive (TPIA, website: http: / / tpdb.shengxin.ren / ) or the NCBI database (BioProject accession number: PRJNA597714). Specifically, it is referenced from: Xia, EH, et al. (2020). The reference genome of tea plant and resequencing of 81 diverse accessions provide insights into its genome evolution and adaptation. Molecular Plant, 13(7), 1013-1026. (Xia et al., 2020).

[0027] Example 1: Construction of the plotting population and collection of phenotypic data 1. Plant materials This study used the pubescent variety 'Guire 2' as the female parent and the pubescent variety 'Jin Mudan' as the male parent, along with 77 F1 offspring plants produced by their hybridization as research materials.

[0028] 2. Phenotypic Data Collection The density of pubescence on new shoots of the parent plants and the F1 generation was investigated in September 2022 and September 2024, respectively. The specific method was as follows: A Canon LiDE 400 portable scanner was used as the image acquisition tool. The harvested tea tree buds were evenly laid on the scanner stage, and a black light-absorbing velvet cloth was selected as the scanning background. Canon IJ Scan Utility Lite software was used for image scanning. The scanning options were set as follows: source "Photograph", color mode "Color", paper size "Full Table", resolution "600 dpi", and data format "PNG". One image was obtained from each resource, with a size of 5100×7016.

[0029] Using the tea bud and leaf image feature extraction software V1.0 developed based on the Python language (calling the OpenCV and NumPy libraries), the tea bud image is first segmented to obtain an RGB image of a single bud, and the color features of the bud image are extracted. Further image preprocessing is performed to obtain grayscale and binarized images, and image feature data related to the bud hair phenotype are extracted as the phenotypic value of the individual plant.

[0030] Example 2: Construction of a high-density genetic map 1. RNA extraction and transcriptome sequencing RNA was extracted using a polysaccharide-polyphenol / complex plant RNA rapid extraction kit, and its concentration was detected using a NanoDrop 2000. Sequencing was performed on an Illumina NovaSeq 6000 platform, yielding a total of 442.41 G of raw data. The average Q20 of the sequencing data was 97.66%, and the average Q30 was 95.73%, indicating excellent overall data quality and providing a reliable underlying data foundation for subsequent accurate SNP variant detection. cDNA was synthesized using a TaKaRa reverse transcription kit (PrimeScript™ RTreagent Kit with gDNA Eraser). The extracted RNA was diluted to 100 ng / μL, and cDNA was synthesized according to the reverse transcription kit instructions. After the reaction, the cDNA was diluted 10-fold for qRT-PCR quantification.

[0031] 2. Identification of SNP variant sites Based on the 'Shuchazao' reference genome, clean reads were aligned to the reference genome using BWA software. The format was converted using SAMtools, and PCR repetitive sequences were removed using GATK. Variation retrieval was performed using GATK best practices (HaplotypeCaller, CombineGVCFs, etc.), with strict hard filtering (e.g., QD < 2.0, MQ < 40.0) to isolate SNP variations. Further filtering of sequencing depth and deletion rate was conducted using Vcftools and Bcftools to retain biallelic genes. Based on parental genotypes, a pseudo-testcross strategy was used to classify the genome into three segregation types, and sites showing significant segregation bias in the chi-square test were removed. p <0.001), obtain high-quality SNP tags.

[0032] 3. Construction of genetic maps Based on variant sites identified at the whole-genome level, a high-density genetic map was constructed using LepMAP3 software. First, the raw data was rigorously filtered using Bcftools and Vcftools (retaining biallelic SNP sites with QUAL≥30, MQ≥20, sequencing depth 3× to 10000×, deletion rate <80%, and MAF>0.05). Further, a sequencing depth of ≥10× for both parents was required. Marker segregation types were classified based on a "testcross" strategy, and sites with significant segregation bias were rigorously removed using a chi-square test. p <0.001) to obtain a high-quality marker set. Subsequently, the LepMAP3 software was run to automatically test LOD values ​​(range 20-40, step size 1) for iterative clustering tests. The optimal LOD value was selected to divide the markers into 15 linkage groups, and the JoinSingles2All and OrderMarkers2 modules were used to complete the addition and optimal sorting of markers. Finally, combined with collinearity and recombination rate analysis, a high-quality, high-density genetic map containing 15 linkage groups, integrating 1785 non-redundant SNP markers, with a total length of 1258.5 cM and an average map distance of 0.71 cM was successfully constructed (Table 1). Figure 1 This laid a solid foundation for the subsequent accurate positioning of the main effect QTL.

[0033] Table 1. Basic information on the construction of genetic maps based on SNP markers. Genetic maps were evaluated using collinearity and recombination rate heatmaps. Figure 2 The constructed genetic map and the reference genome 'Shuchazao' were shown to exhibit collinearity, with all 15 linkage groups showing high collinearity with the reference genome. The recombination rate heatmap reflects the recombination relationships between markers within linkage groups; the closer the markers are, the lower the recombination rate corresponding to the linkage. Figure 3 A brighter diagonal line indicates a lower recombination rate and LOD value between markers, signifying a closer linkage between the two markers. Bright diagonal lines were observed in all 15 linkage groups, indicating a marker order that closely matches recombination patterns. Overall, the constructed map sequence largely matches the marker order on the chromosome, indicating high chromosome quality suitable for subsequent localization.

[0034] Example 3: Development of Main Effect QTL Location and Function Markers 1. QTL positioning Using GACD v2 software, QTL localization was performed using the ICIM-ADD method (step=1cM, LOD threshold based on 1000 permutation tests). Combined with the constructed high-density genetic map, QTL plotting was performed on the collected trichome phenotype data. Figure 4 ).

[0035] 2. Location Results Comprehensive analysis revealed two major-effect QTLs that could be stably identified in data from different years: (1) qtl_tri13: Located in Chr13: 125.0 Mb - 132.7 Mb. In the September 2022 data, the LOD value was as high as 3.79, and the phenotypic contribution rate (PVE) was 7.45%; in the September 2024 data, the LOD value was 4.14, and the PVE was 15.45%.

[0036] (2) qtl_tri14: Located in Chr14: 71.1 Mb - 71.5 Mb. In the September 2022 data, the LOD value was as high as 9.53, and the phenotypic contribution rate (PVE) was 20.60%; in the September 2024 data, the LOD value was 4.88, and the PVE was 18.42%.

[0037] Table 2. Major QTLs related to the two pubescence indices Example 4: Screening and Identification of SNP Functional Markers This embodiment describes how to use bioinformatics methods to screen key SNP markers that are closely related to the density of tea tree hairs within the aforementioned major effect QTL interval.

[0038] 1. Screening Strategy Based on the sequencing data obtained in Example 2 and the major QTL regions (qtl_tri13 and qtl_tri14) located in Example 3, all high-quality SNP variant sites within the regions were extracted.

[0039] 2. Genotype analysis Based on the phenotypic characteristics of the parents ('Gui Re 2' has more hairs, 'Jin Mudan' has less hairs), the genotypic differences of the parents at these loci were analyzed.

[0040] 3. Marking confirmation: Through screening, two Tag-SNP markers with the highest significance were identified: the SNPtri1 molecular marker, which contains the SNPtri1 site (Chr13: 97496559); and the SNPtri2 molecular marker, which contains the SNPtri2 site (Chr14: 67888062).

[0041] Based on multi-year phenotypic survey data, the phenotypic values ​​of the pubescent density of the pubescent maternal parent 'Guire 2' in September 2022 and September 2024 were 87.52 and 37.59, respectively; the phenotypic values ​​of the sparsely pubescent paternal parent 'Jin Mudan' in the corresponding years were 27.38 and 17.78; see Table 3. Comparison of genotypic differences between the parents at the above two loci revealed the following: For the SNPtri1 locus: the genotype of the maternal parent 'Guire 2' was AG, and the genotype of the paternal parent 'Jin Mudan' was GG. Combined with the phenotypic data, it can be seen that plants containing the A allele (AG genotype) had significantly higher pubescent density than plants with the homozygous GG genotype. For the SNPtri2 locus: the genotype of the maternal parent 'Guire 2' was AG, and the genotype of the paternal parent 'Jin Mudan' was AA. Phenotypic data show that plants containing the G allele (AG genotype) have significantly higher trichome density than plants with the homozygous AA genotype.

[0042] Amplification was performed using the following primers: (1) Primer combination for detecting SNPtri1 molecular marker: Forward primer F: 5'-CAACTCGGAGAACAAGTTGGA-3' (SEQ ID NO.3); Reverse primer R: 5'-GGGCTTATGGAGTTGGGATAA-3' (SEQ ID NO.4); (2) Primer combinations for detecting SNPtri2 molecular markers: Forward primer F: 5'- CAAAGCAAATCTGCCAGTCA -3' (SEQ ID NO.5); Reverse primer R: 5'- GCTCCTGGGACATTAGATTCAC-3' (SEQ ID NO.6).

[0043] The amplified sequence is shown below: The nucleotide sequence of the SNPtri1 molecular marker (SEQ ID NO.1): aagccccaactcggagaacaagttggaaaaacaaaaagcattcaatcaaaactgagacagacgttgaatttgtatacaacaaaaggggaaaaaacaaaaa[A / G]gatttatgtttatcccaactccataagcccccaaccgggagaacaagttggaaaaatgagaagttttcaatcaaaactgagatggatgttgaatttgtca.

[0044] The nucleotide sequence of the SNPtri2 molecular marker (SEQ ID NO.2): ttatagcttatttagcaacatccattgtacaggcacaactttaccgcctcactgagcactttttgcgcaaagcaaatctgccagtcatttgcagaactgc[A / G]gatacagagttggcagttgcagatgcagttaatattgagaaagaagtcgctgatagatcgaacagcaagctagtatatgtgaatctaatgtcccaggagc.

[0045] Regarding the SNPtri1 molecular marker, the maternal parent 'Guire 2' has an AG (heterozygous) genotype at the SNPtri1 locus (Chr13: 97496559), while the paternal parent 'Jin Mudan' has a GG (homozygous) genotype at the SNPtri1 locus (Chr13: 97496559). Regarding the SNPtri2 molecular marker, the maternal parent 'Guire 2' has an AG (heterozygous) genotype at the SNPtri2 locus (Chr14: 67888062), while the paternal parent 'Jin Mudan' has an AA (homozygous) genotype at the SNPtri2 locus (Chr14: 67888062).

[0046] Example 5: Validation of the association between SNP markers and trichome density This embodiment uses sequencing genotype data and multi-year phenotypic data of the F1 segregating population to verify the effectiveness of the SNP markers screened in Example 4.

[0047] 1. Verification Method Genotypic data of 77 F1 progeny individuals at SNPtri1 and SNPtri2 loci were extracted and combined with the trichome density phenotype values ​​collected in Example 1. The results were visualized using box plots and statistical significance tests (association analysis) were performed.

[0048] Table 3 Genotypes and trichome index of 77 F1 progeny plants 2. SNPtri1 Validation Results The analysis results are shown in Table 3. Figure 5As shown in the figure, in the F1 segregating population, two genotypes, AG and GG, separated at this locus. Statistical analysis showed that the trichome density of individuals with the AG genotype was significantly higher than that of individuals with the GG genotype, and the difference was statistically significant. P The value is 3.48 × 10 -10 This indicates that the A allele at the SNPtri1 locus (Chr13: 97496559) is significantly positively correlated with the tall hair trait.

[0049] 3. SNPtri2 Validation Results The analysis results are shown in Table 3. Figure 5 As shown in the figure, in the F1 segregating population, two genotypes, AG and AA, separated at this locus. Statistical analysis showed that the trichome density of individuals with the AG genotype was significantly higher than that of individuals with the AA genotype, and the difference was statistically significant. P The value is 1.48 × 10 -6 This indicates that the G allele at the SNPtri2 locus (Chr14: 67888062) is significantly positively correlated with the tall hair trait.

[0050] The results of the above embodiments show that the SNPtri1 locus (Chr13: 97496559) and SNPtri2 locus (Chr14: 67888062) screened by this invention are significantly associated with the pubescence density trait of tea shoots. Using the detection primers and methods provided by this invention, the genotype of individual tea plants can be accurately and rapidly identified, thereby predicting their pubescence trait. This method is unaffected by the tea plant's growing environment, age, or season, and has significant application value for shortening the breeding cycle of superior tea varieties with high pubescence.

[0051] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A SNP molecular marker associated with the trait of pubescence density in tea tree shoots, characterized in that, The SNP molecular marker includes at least one of the following molecular markers: (1) SNPtri1 molecular marker, whose nucleotide sequence is shown in SEQ ID NO.1, and an A / G base polymorphism exists at the 101st base in the nucleotide sequence shown in SEQ ID NO.1; (2) SNPtri2 molecular marker, whose nucleotide sequence is shown in SEQ ID NO.

2. There is an A / G base polymorphism at the 101st base in the nucleotide sequence shown in SEQ ID NO.

2.

2. The SNP molecular marker as described in claim 1, characterized in that, The genotypes of the polymorphic sites of the SNPtri1 molecular marker are AG and GG, and the genotypes of the polymorphic sites of the SNPtri2 molecular marker are AG and AA.

3. Amplify or detect the primer pair of the SNP molecular marker described in claim 1.

4. The primer pair as described in claim 3, characterized in that, The primer pair sequences for amplifying or detecting the SNPtri1 molecular marker are shown in SEQ ID NO. 3-4, and the primer pair sequences for amplifying or detecting the SNPtri2 molecular marker are shown in SEQ ID NO. 5-6.

5. The application of the reagent for detecting the SNP molecular marker as described in claim 1 or 2, or the primer pair as described in claim 3 or 4, in identifying the pubescence density trait of tea tree shoots.

6. The application of the reagent for detecting the SNP molecular marker as described in claim 1 or 2, or the primer pair as described in claim 3 or 4, in the breeding of tea shoot pubescence density trait.

7. A product for identifying the density of pubescence on new tea shoots, characterized in that, Includes the primer pair as described in claim 3 or 4.

8. A method for identifying the density of pubescence on new tea shoots, characterized in that, Includes the following steps: Using genomic DNA from the new shoot tissue of the tea plant to be tested as a template, the SNP molecular markers described in claim 1 or 2 are amplified using primer pairs. The pubescence density trait of the new shoot of the tea plant to be tested is determined based on the genotype of the polymorphic sites of the SNP molecular markers. The primer pair sequences for amplifying the SNPtri1 molecular marker are shown in SEQ ID NO. 3-4, and the primer pair sequences for amplifying the SNPtri2 molecular marker are shown in SEQ ID NO. 5-6. The criteria for judgment are as follows: the A allele at the polymorphic site of the SNPtri1 molecular marker is positively correlated with the tall hair trait; the G allele at the polymorphic site of the SNPtri2 molecular marker is positively correlated with the tall hair trait.

9. The method as described in claim 8, characterized in that, The density of pubescence on tea shoots was higher when the polymorphic site of the SNPtri1 molecular marker was genotype AG than when the genotype was GG. The density of pubescence on tea shoots was higher when the polymorphic site of the SNPtri2 molecular marker was AG than when the genotype was AA.

10. A breeding method for a tea variety with high pubescence density in its new shoots, characterized in that, Includes the following steps: Using genomic DNA from the new shoot tissue of the tea plant to be tested as a template, the SNP molecular markers described in claim 1 or 2 are amplified using primer pairs. Plants with the potential for high hair density trait in the new shoots of the tea plant to be tested are selected based on the genotype of the polymorphic sites of the SNP molecular markers. The primer pair sequences for amplifying the SNPtri1 molecular marker are shown in SEQ ID NO. 3-4, and the primer pair sequences for amplifying the SNPtri2 molecular marker are shown in SEQ ID NO. 5-6. The selection criteria are: tea plants with the genotype AG at the polymorphic site of the SNPtri1 molecular marker; and / or tea plants with the genotype AG at the polymorphic site of the SNPtri2 molecular marker.