Nanobodies specifically binding to adenovirus fiber protein and uses thereof

Abstract

The application belongs to the technical field of targeted adenovirus, and particularly relates to a nanobody specifically combined with adenovirus Fiber protein and application thereof, and the nanobody 252A7, an amino acid sequence of which is shown as SEQ ID NO. 2. The nanobody 252A7 provided by the application can specifically recognize and combine with Fiber proteins of various serotypes of adenovirus (such as HAdV-3, HAdV-4, HAdV-7, HAdV-55), solves the technical bottleneck that traditional antibodies are difficult to recognize the conserved epitope of Fiber protein and lack broad spectrum, can effectively distinguish adenovirus from other common respiratory viruses (such as RSV, SARS-CoV-2), avoids cross reaction, and improves the accuracy and reliability of clinical etiology diagnosis. The nanobody of the application can be used for developing high-sensitivity immunological detection reagents (such as ELISA, immunochromatography, chemiluminescence, etc.), and has potential application value in the fields of targeted therapy and molecular imaging.

Description

Technical Field

[0001] This invention belongs to the field of targeted adenovirus technology, specifically relating to a nanobody that specifically binds to adenovirus fiber protein and its application. Background Technology

[0002] Respiratory infections are a prevalent group of diseases worldwide, caused by a wide variety of pathogens, including adenoviruses, coronaviruses, and respiratory syncytial viruses. The highly similar clinical symptoms caused by these viruses pose a significant challenge to rapid and accurate etiological diagnosis. Currently, there is an urgent clinical need for a diagnostic tool that can efficiently and specifically differentiate adenovirus from other common respiratory viruses to reduce misdiagnosis and guide precise medication.

[0003] Human adenovirus (HAdV) is a non-enveloped icosahedral DNA virus, 90–100 nm in diameter, with a linear double-stranded DNA genome (approximately 34–36 kDa). Based on serological neutralization tests and genomic characteristics, HAdV is classified into seven subgenera (A–G), with over 100 identified types. In my country, acute respiratory infections in children are most commonly caused by types 3, 7, 4, and 55.

[0004] Adenoviral fiber proteins are homotrimeric protrusions composed of three functional domains: an N-terminal tail, a shaft, and a C-terminal knob. The tail domain is anchored to the pentagonal basement membrane of the viral capsid, while the knob domain directly recognizes and binds to specific receptors on the host cell surface (such as CAR, CD46, and GD1a), making it a key molecule mediating adenoviral adsorption to host cells. The knob domain exhibits a dual structural characteristic across different adenovirus types, possessing both a conserved core structure and a type-specific variable loop region, thus possessing broad-spectrum antigenic recognition and typing properties. Due to its structural advantages of being exposed on the viral particle surface and having high protein abundance, fiber proteins have become ideal targets for adenovirus targeting molecule development and are preferred targets for developing adenovirus-specific binding molecules and molecular probes. However, the knob domain, as the core functional region of the fiber protein, has a complex and diverse stereoconformation of its epitopes, making it difficult for traditional IgG-like molecules to penetrate its structural gaps and recognize conserved regions. This presents a technical challenge for developing specific binding molecules that can target this region. Summary of the Invention

[0005] To address the problems in the prior art, this invention provides a nanobody that specifically binds to adenovirus fiber protein and its application. By using phage display library technology, nanobodies that can specifically recognize unique epitopes of adenovirus fiber protein were successfully screened, enabling accurate identification of common phenotypes of adenovirus infection.

[0006] The technical problem solved by this invention is achieved by the following technical solution: The present invention aims to provide a nanobody that specifically binds to adenovirus fiber protein, the amino acid sequence of which is shown in SEQ ID NO.2.

[0007] The DNA molecule encoding the nanobody has the nucleotide sequence shown in SEQ ID NO.1.

[0008] A recombinant expression vector comprising the DNA molecule described above.

[0009] A molecule that specifically binds to adenovirus fiber proteins, including the nanobody described above.

[0010] A bacteriophage containing molecules that specifically bind to adenovirus fiber proteins, with the molecules of the specific adenovirus fiber protein displayed on the surface of the bacteriophage.

[0011] An adenovirus fiber protein detection reagent, comprising the nanobody or the molecule that specifically binds to adenovirus fiber protein.

[0012] Nanobodies are naturally occurring heavy-chain-only antibodies (HCAbs) found in camels. Their antigen-binding unit is solely the variable heavy chain domain (VHH), also known as a single-domain antibody, with a molecular weight of approximately 15 kDa. Compared to traditional IgG (≈150 kDa), nanobodies offer the following significant advantages: (1) Its volume is only 1 / 10 of that of conventional antibodies, and it can penetrate the blood-brain barrier and dense tissues; (2) It has high thermal stability and can withstand temperatures above 70 °C and extreme pH. (3) Both prokaryotic and eukaryotic expression systems can express substances efficiently and solublely, significantly reducing production costs; (4) It can identify hidden or conserved epitopes and has a broad-spectrum neutralizing potential against easily mutated pathogens.

[0013] Based on the biological characteristics of fiber proteins and the advantages of nanobodies in recognizing hidden epitopes and penetrating tissues, the development of nanobodies that can target adenovirus fiber proteins has important scientific value and application prospects for promoting the development of respiratory pathogen detection technology and broad-spectrum neutralization strategies.

[0014] Phage display technology involves fusing exogenous gene fragments into the phage coat protein gene, allowing the exogenous protein to be displayed on the phage surface in a fused form, creating a diverse library. By subjecting the library to multiple cycles of "adsorption-elution-amplification" with target antigens, high-affinity nanobodies can be rapidly enriched in vitro. Due to their short gene fragments, nanobodies exhibit high display efficiency and good stability, significantly shortening the antibody discovery cycle. Furthermore, affinity and specificity can be further optimized through in vitro evolution.

[0015] Compared with the prior art, the beneficial technical effects of the present invention are as follows: 1. High specificity and broad-spectrum recognition capability The nanobody 252A7 provided by this invention can specifically recognize and bind to the fiber proteins of various serotypes of adenovirus (such as HADV-3, HADV-4, HADV-7, and HADV-55), which solves the technical bottleneck of traditional antibodies being unable to recognize conserved epitopes of fiber proteins and lacking broad-spectrum activity. 2. Strong ability to identify hidden epitopes Because of their small size and stable structure, nanobodies can penetrate deep into the conformational epitopes or hidden regions of fiber proteins, recognizing conserved regions that are difficult for traditional IgG to reach, thus possessing stronger neutralization potential and detection sensitivity. 3. High screening efficiency and low preparation cost High-affinity nanobodies can be rapidly obtained by using phage display technology combined with multiple rounds of positive and negative screening. The nanobodies have small gene fragments that are easy to express efficiently in prokaryotic or eukaryotic systems, making them suitable for large-scale production and showing clear industrialization prospects. 4. Broad application prospects The nanobody of this invention can not only be used to develop highly sensitive immunoassay reagents (such as ELISA, immunochromatography, chemiluminescence, etc.), but also has potential application value in targeted therapy and molecular imaging. 5. High diagnostic accuracy This invention can effectively distinguish adenovirus from other common respiratory viruses (such as RSV and SARS-CoV-2), avoid cross-reaction, and improve the accuracy and reliability of clinical etiological diagnosis. 6. Strong virus neutralizing activity With excellent anti-infection blocking ability, this nanobody 252A7 has been validated by fluorescently labeled adenovirus infection neutralization model and IC50 quantitative analysis. It can effectively block the invasion of host cells by mainstream pathogenic adenoviruses such as HAdV-3 and HAdV-7 by specifically binding to fiber proteins to inhibit viral adsorption and invasion. Compared with traditional antibodies, it has a lower half-maximal inhibitory concentration and stronger in vitro neutralization efficacy, which can block viral proliferation and replication from the source, taking into account both detection applications and passive prevention and control value against adenovirus infection.

[0016] The above description is merely an overview of the technical solution of the present invention. In order to better understand the technical means of the present invention, it can be implemented according to the contents of the specification. Furthermore, in order to make the above contents, objectives, features and advantages of the present invention more obvious and understandable, specific embodiments of the present invention are described below. Attached Figure Description

[0017] Figure 1 This is a schematic diagram of the screening process for nanobodies that specifically bind to adenovirus fiber proteins in this invention.

[0018] Figure 2 This is a diagram showing the PCR verification results of monoclonal phage antibodies in 1-3 rounds of phage screening in this invention.

[0019] Figure 3 This invention uses ELISA to identify monoclonal phage antibodies.

[0020] Figure 4 The binding activity of the anti-HAdV fiber protein-specific nanobody in this invention was identified (affinity determination of antibody 252A7-his with HADV-3, HADV-4, HADV-7 and HADV-55 fibers (EC50)).

[0021] Figure 5 The graph shows the affinity test results of 252A7 with RSV F protein and SARS-Cov2 S protein in this invention.

[0022] Figure 6 This is a diagram showing the in vitro binding activity results of 252A7 and HADV-7 Fiber proteins in this invention.

[0023] Figure 7 This is a diagram showing the in vitro binding activity results of 252A7 and HADV-3 Fiber protein in this invention. Detailed Implementation

[0024] The technical solution of the present invention will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are merely illustrative and explanatory of the present invention and should not be construed as limiting the scope of protection of the present invention. All technologies implemented based on the above content of the present invention are covered within the scope of protection intended by the present invention.

[0025] In addition, unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be obtained by purchasing them from the market or prepared by existing methods.

[0026] To address the technical problem of rapid and accurate etiological diagnosis of adenovirus infection using existing technologies, this invention provides a nanobody that can specifically bind to adenovirus fiber proteins for effective identification. The broad-spectrum neutralizing nanobody 252A7 provided by this invention specifically binds to adenovirus fiber proteins. The nanobody is composed of a heavy chain variable region (VHH), which includes complementarity-determining regions as follows: The amino acid sequences are the complementarity-determining region CDR1 at positions 31-35 of SEQ ID 252A7, the complementarity-determining region CDR2 at positions 50-66 of SEQ ID 252A7, and the complementarity-determining region CDR3 at positions 99-113 of SEQ ID 252A7.

[0027] I. Antigen Purification The adenovirus fiber protein gene sequences of four serotypes—HAdV-3 (GenBank: MH985732.1), HADV-4 (GenBank: MN389433.1), HADV-7 (GenBank: OM988084.1), and HADV-55 (GenBank: KY575508.1)—were obtained from the NCBI database. Specific primers were designed targeting these sequences, and the fiber protein genes of each serotype were recombined with the pet28a expression vector using molecular cloning techniques to construct the corresponding recombinant plasmids. The resulting recombinant expression plasmids were transformed into BL21 (DE3) *E. coli* competent cells. The transformed strains were plated on LB solid medium containing kanamycin (50 μg / ml) for selection, and single colonies were picked for amplification. The cultures were then incubated in liquid LB medium (containing kanamycin) at 37°C and 200 rpm with shaking until the OD600 reached 0.5–0.6. Subsequently, isopropyl-β-D-thiogalactoside (IPTG) was added to the culture system to a final concentration of 0.1 mM, and the culture conditions were adjusted to 18℃ and 180 rpm, with expression induction continued for 8-10 hours. After induction, bacterial cells were collected by centrifugation at 12000×g and 4℃ for 20 min. The obtained bacterial cells were resuspended in pre-cooled phosphate-buffered saline (PBS, 50 ml). The bacterial cells were lysed using an ultrasonic homogenizer under ice bath conditions. The ultrasonic parameters were set as follows: power 300-400W, working time 2 seconds, interval 5 seconds, total duration 15-20 minutes. The lysate was centrifuged at 4℃ and 12000×g for 20 min, the supernatant was collected, and filtered through a 0.22 μm filter membrane. The filtered crude protein extract was loaded onto a His Trap HP nickel column pre-equilibrated with binding buffer (20 mM sodium phosphate, 500 mM NaCl, 20 mM imidazole, pH 7.4). Unspecifically bound proteins were washed away with 10-15 column volumes of wash buffer (20 mM sodium phosphate, 500 mM NaCl, 40-50 mM imidazole, pH 7.4). Finally, staged or linear gradient elution was performed using elution buffer containing 250 mM imidazole, and the protein elution peaks were collected. The eluates containing the target protein were combined and placed in an ultrafiltration centrifuge tube with a molecular weight cutoff of 5 kDa. The mixture was centrifuged at 4°C and 4000 × g for concentration and buffer replacement, repeated three times with PBS. The protein sample was finally concentrated to a volume of 1-2 ml and aliquoted into 1.5 ml sterile EP tubes.

[0028] II. Antibody Screening: The principle of phage display technology is to insert a foreign gene into an appropriate position in the structural gene of the phage coat protein. When the reading frame is normal and the normal function of the coat protein is not affected, the foreign gene will be expressed along with the expression of the coat protein, thus displaying the polypeptide or protein as a fusion protein on the phage surface. The displayed protein can maintain a relatively independent spatial structure and biological activity, which is conducive to the binding of the target protein. Therefore, phage display libraries can be rapidly screened using the target protein.

[0029] After the display library is constructed, the target protein is used as the stationary phase and co-incubated with the display library for a period of time. Unbound phages are washed away, and then the adsorbed phages are eluted using a competitive receptor. The eluted phages infect the host bacteria and multiply, then undergo the next round of elution; this is positive screening. Next, other types of viral proteins are used as the stationary phase and co-incubated with the display library for a period of time. Unbound phages are collected, and the collected phages infect the host bacteria and multiply, then undergo the next round of elution; this is negative screening. After 3-5 rounds of "adsorption-elution-amplification" (for some antibodies with weak affinity, more rounds of elution are required), a high enrichment of phages that specifically bind to the target protein can be obtained. (See reference...) Figure 1 .

[0030] The main experimental steps are as follows: The screening of phage antibody libraries mainly includes steps such as phage amplification, rescue, adsorption, elution and infection.

[0031] 1. First, TG1 containing phage particles is amplified, then helper bacteria are added to assist in the packaging of phage antibodies, and then the phage antibodies are isolated from it. Specific steps: (1) On the evening of the first day, M13 single-chain filamentous phages were used to display an alpaca nanobody immune library. The inoculation ratio was 1:100 in 100 ml of 2×YTAG liquid medium and cultured on a shaker at 37°C until the bacterial OD600 was about 0.5. (2) Add M13K07 helper phage, first let it stand in a 37°C water bath for 30 min, then place it on a 37°C shaker and shake for 30 min; (3) Transfer the bacterial culture to a 50ml centrifuge tube and centrifuge (3300×g, room temperature, 10min), discarding the culture supernatant; (4) Resuspend the bacterial pellet in 100 ml of 2×YTAK liquid medium, and then incubate overnight on a shaker at 30°C. (5) On the morning of the second day, centrifuge the bacterial culture (3300×g, 4°C, 10min), and then transfer the supernatant of the culture medium to a new 50ml centrifuge tube; (6) Add 5 ml of PEG / NaCl solution to the culture medium supernatant, mix well and let stand on ice for 60 min; (7) After the ice bath is complete, centrifuge (12000×g, 4°C, 30min). After centrifugation, a small amount of white precipitate can be seen at the bottom. This precipitate is the bacteriophage. Discard the supernatant and try to remove the residual liquid. (8) Resuspend the precipitate with 400 μL PBS, then transfer it to a 1.5 mL centrifuge tube and continue centrifuging (6000 × g, 4°C, 5 min). (9) Transfer the supernatant to a new centrifuge tube. This is to save the phage. Place it at -80°C for later use.

[0032] 2. Next, phage antibodies are adsorbed onto a plate coated with HAdV-7 Fiber protein. After washing, non-specific binding and low-affinity phage antibodies are removed. Then, a strong elution reagent is used to elute the specific binding and high-affinity phage antibodies, which are then used to infect TG1. The specific steps are as follows: (1) On the first day, HAdV-7 Fiber protein coating plate was used with a coating concentration of 10ug / ml, 100ul, and incubated overnight at 4°C; (2) On the morning of the second day, discard the liquid in the plate and wash the plate three times with PBS; (3) Add 300ul of 5% skim milk to the ELISA plate and let it stand overnight at 4°C; (4) Discard the milk in the plate, wash 3 times with PBS, add 100ul to rescue the phage, and place in an incubator at 37℃ for 2.5h; (5) Wash the plate with PBST 20 times, then wash the plate with PBS 20 times, each time for 4 minutes; (6) Add 100 μL of trypsin digestion solution (10 μg / ml) to the plate and let it stand at 37°C for 30 min; (7) Transfer the eluted phage to a 15ml centrifuge tube, add 10ml of TG1 bacterial suspension with an OD600 of about 0.5, and also add 100ul of the bacterial suspension to the ELISA plate; (9) Place the centrifuge tubes in a 37°C water bath for 30 minutes, and place the ELISA plate in a 37°C incubator for 30 minutes; (10) After the time is up, mix the bacterial solutions, centrifuge the bacterial solutions (3300×g, room temperature, 10min) and discard the supernatant; (11) The bacterial precipitate was resuspended in 400 μL of 2×YT liquid culture medium and evenly spread on the surface of two 2×YTAG solid culture plates. The culture plates were then transferred to a 30°C constant temperature incubator and cultured for 12-16 hours. Further, another 2×YTAG solid culture plate was taken and inoculated using the bacterial solution remaining on the spreading stick. It was also placed in a 30°C constant temperature incubator and cultured for 12-16 hours. (12) After a single colony with a clear outline grows on the third culture plate, 3 to 4 colonies are randomly selected and their size is identified by colony PCR to verify whether they contain the target nanobody gene.

[0033] 3. After successful validation, TG1 antibodies infected with phage antibodies are collected. This will be the antibody library used in the next round of screening. The specific steps are as follows: (1) By the third day, very dense colonies had grown on the first two solid culture plates, forming a "bacterial film". Add 2 ml of 2×YT liquid culture medium to the culture plate, scrape off the colonies with a cell scraper, and collect them into a 10 ml centrifuge tube. (2) Add 2 ml of 2×YT liquid culture medium to the culture plate again, rinse the remaining colonies and collect them into the centrifuge tubes mentioned above; (3) Centrifuge the centrifuge tube (3300×g, room temperature, 10min) and discard the supernatant; (4) Resuspend the precipitate in 2 ml of 2×YT liquid culture medium, and then add glycerol at a 1:1 ratio; (5) Dispense the above bacterial solution into portions and store it at -80°C for use in the next round of screening.

[0034] 4. The subsequent rounds of screening are basically similar, with the following changes: (1) The concentrations of the coating antigens in the second, third, and fourth rounds were adjusted to 5 ug / ml for HAdV-7 Fiber protein; 2 ug / ml for HAdV-7 Fiber protein; and 2 ug / ml for HAdV-3, HAdV-4, and HAdV-55. (2) The library bacteria used in the next round of screening were the library bacteria collected from solid culture plates and aliquoted and frozen in the previous round; (3) In the fourth round of screening, the bacterial suspensions from the centrifuge tubes and plates were mixed, and the suspensions were serially diluted tenfold using 2×YT liquid culture. 10 -3 -10 -6 Four dilutions were prepared, and two 50 μL portions of each dilution were evenly spread onto two 2×YTAG solid culture plates. The plates were then inverted and incubated overnight at 30°C for subsequent single-clon selection and identification.

[0035] Colony PCR identification results are as follows Figure 2 As shown, the experiment was independently repeated three times, and the results showed a consistent trend. Figure 2 The results are representative. After three rounds of affinity screening for HADV-7 fiber protein, the brightness and uniformity of the positive target bands improved with each round, and the specific phage clones were significantly enriched, demonstrating that the screening method has excellent enrichment effect and good stability, and can effectively obtain positive nanobody clones targeting HADV-7 fiber protein.

[0036] 5. After the fourth round of screening, single-clone colonies need to be selected for the preparation of single-clone bacteriophages for subsequent ELISA identification. The specific steps are as follows: (1) During the fourth round of screening, after the solid culture plates were cultured overnight, the density of colonies on the culture plates of different dilutions was different. The culture plates with relatively sparse colonies were randomly selected, and the relatively isolated single colonies on the culture plates were selected. 24 colonies were randomly picked and inoculated into 96-well deep well plates. 500ul of 2×YTAG liquid medium had been added to each well beforehand, and the plates were shaken at 37°C for 8 hours. On the same night when the single colonies were picked, the 96-well microplates were coated with HADV-3, HADV-4, HADV-7 and HADV-55 fiber proteins respectively, with a coating concentration of 1ug / ml, 100ul per well, and left to stand at 4°C overnight. (2) Take 50 μL of bacterial culture from each well and transfer it to a new 96-well deep plate. 450 μL of 2×YTAG liquid medium has been added to each well beforehand. Incubate at 37°C with shaking. (3) Add 400 μL of glycerol to the original 96-well deep well plate and then freeze it at -80°C; (4) After shaking the new 96-well deep plate for 2.5 hours, add commercial M13K07 helper phage diluted at 1:200, 50 μL per well; (5) First, incubate at 37°C for 30 min, then incubate at 37°C on a shaker for 30 min; (6) Centrifuge the deep well plate (1800×g, room temperature, 10min), discard the supernatant, add 400ul of 2×YTAK liquid medium to each well to resuspend the bacterial pellet, and incubate overnight at 30°C with shaking; wash the 96-well microplate with PBST three times, and block overnight at 4°C with 5% skim milk; (7) On the second day, centrifuge the 96-well deep well plate (1800×g, room temperature, 15min), and transfer 50ul of supernatant from each well to a new ELISA plate. Add 6% BSA at a 1:1 ratio, mix well, and transfer 50ul from each well to the 96-well deep well plate to resuspend the bacterial pellet. Incubate at 37°C for 1h, wash 5 times with PBST, add M13 Bacteriophage Antibody, incubate at 37°C for 1h, and wash 5 times with PBST. (8) Add 50 μL of colorimetric solution to each well and incubate at 37°C for about 5–15 min; (9) Add 50 μL of stop solution to each well and read the OD450 on the microplate reader.

[0037] Figure 3 This is an ELISA affinity heatmap of the binding activity of monoclonal bacteriophages to different types of HADV fiber proteins. The darker the blue color, the higher the affinity between the nanobody and the corresponding antigen; the lighter the color, the lower the affinity. The horizontal axis represents the HADV-7, HADV-3, HADV-4, and HADV-55 fiber protein groups, and the BSA blank control group, in descending order. A total of 16 positive monoclonal strains were tested in this experiment. The results showed that some clones exhibited significant specific binding to the target HADV type, while showing extremely low non-specific binding to heterologous types and the blank control group, validating the good targeting ability and type specificity of the screened nanobodies.

[0038] III. Acquisition of Nanobody Genes By subtracting the corresponding ELISA OD450 values ​​of phages coated with BSA protein from the ELISA OD450 values ​​of phages coated with HADV-3, HADV-4, HADV-7, and HADV-55 fiber proteins, two strains were selected. The corresponding bacterial cultures were sent to a sequencing company for sequencing. The sequence information that passed the sequencing results was obtained. After removing the vector part of the sequence, the nanobody gene sequence was obtained. It was found that the two sequences were identical and belonged to the same entity.

[0039] After the above screening, the positive clones were amplified by high-fidelity PCR to obtain the coding nucleic acid molecules of A3 and 252A7 and their encoded amino acid sequences.

[0040] Nucleic acid molecule encoding 252A7 nanobody (SEQ ID NO.1): GATGTGCAGCTGCAGGAGTCTGGGGGAGGATCGGTGCAGCCTGGGGACTCTCTGAGACTCTCCTGTTCAGCCTCTGGAGGCACCTTCAGTAGCTATGCCATGGGCTGGTTCCGCCAGGCTTTAGGGAAGGAGCGTGAGTTTGTAGCAGCTATTAACCCGAGTAGTGCGAACACAGACTATGTAGAC TCCGTGAAGGGCCGATTCATCATCTCCAGAGACAACGCCAAGAAAATGGTGTATCTGCAAATGAACGACCTGAAGCCTGAGGACACGGCCGTTTATTACTGTGCAGCAGATCGCTCGGCCTACTACGGTAGTACCCAATGGGGGTATGACTACTGGGGCCAGGGGGACCCAGGTCACCGTCTCCAGC.

[0041] 252A7 nanobody amino acid sequence (SEQ ID NO.2): DVQLQESGGGSVQPGDSLRLSCSASGGTFSSYAMGWFRQALGKEREFVAAINPSSANTDYVDSVKGRFIISRDNAKKMVYLQMNDLKPEDTAVYYCAADRSAYYGSTQWGYDYWGQGTQVTVSS.

[0042] IV. Recombination and Construction of Prokaryotic Expression Vectors The 252A7 bacterial culture was amplified by PCR, and primers were designed to recombine it with the pet28a vector to obtain the recombinant plasmid pet28a-252A7-his. The prokaryotic expression vector pet28a-252A7-his was transformed into BL21 Escherichia coli competent cells, inoculated into LB solid medium containing kanamycin, and cultured at 37℃ and 200 rpm until the OD600 reached 0.5. Then, IPTG was added to the culture system to a final concentration of 0.1 mM, and the culture was induced for another 8 hours at 18℃ and 110 rpm. The bacterial cells were then harvested by centrifugation.

[0043] V. Purification of Antibodies (1) Lysis of bacterial cells: The obtained bacterial cells were resuspended in 50ml PBS, and the bacterial cells were sonicated and then centrifuged at 12000×g for 20 minutes. The supernatant was transferred to a new centrifuge tube.

[0044] (2) Affinity chromatography: a. Filter the sample and all solutions to be used in the purification process using a 0.22µm filter; b. Pump the protein into the His Trap HP pre-packed column; c. Install the pre-packed column into the ATKA go purification instrument and elute the desired protein.

[0045] (3) Concentrate the protein using a 5K ultrafiltration tube, centrifuge at 4000 rpm and 4℃, replace the elution buffer with PBS, repeat 3 times, so that the final volume is 1-2 ml. Collect the protein into a clean EP tube and freeze at -20℃.

[0046] VI. The affinity of 252A7 for HADV-3, HADV-4, HADV-7, HADV-55 fiber proteins, RSVF protein, and SARS-CoV-2 S protein was determined using ELISA. The procedure is as follows: (1) Dilute the protein with coating buffer to a concentration of 2ug / ml, add 50ul / well to a 96-well microplate, and incubate overnight at 4°C; (2) The next day, wash the plate once with PBST and pat dry. Add blocking solution (PBS containing 3% BSA) to 100 μL of each well and incubate at 37°C for 1 h. (3) Wash the plate once with PBST and pat dry; (4) Take another 96-well dilution plate, perform serial dilution of the antibody, and then transfer it to the 96-well microplate at 50 μL / well. Incubate at 37°C for 45 min. (5) Wash the plate three times with PBST and pat dry; (6) Dilute the tag antibody with blocking buffer and add it to a 96-well microplate, 50 μL / well, and incubate at 37°C for 30 min. (7) Wash the plate three times with PBST and pat dry; (8) Add TMB single-component colorimetric solution, 50 μL / well, and incubate at room temperature or 37°C for several minutes; (9) When the color develops to the appropriate depth (usually 5-10 min), add the stop solution, 50 μL / well, and gently tap the plate to mix it. Use an ELISA reader to read the absorbance value at 450 nm.

[0047] Test results are as follows Figure 4 and 5 EC 50The values ​​are the mean ± standard deviation of three independent results. The experiment was independently repeated three times, and the results were similar, showing a representative curve. The results indicate that nanobody 252A7 exhibits significant dose-dependent specific binding to HAdV-3, HAdV-4, HAdV-7, and HAdV-55 fiber proteins, demonstrating good affinity; while it shows no significant non-specific binding to RSV F protein and SARS-CoV-2 S protein, proving that this nanobody has excellent type specificity and target binding activity, and has the potential for specific detection and blocking of related adenovirus infections.

[0048] VII. Using a fluorescently labeled viral infection model, the in vitro binding activity of 252A7 with HAdV-7 and HAdV-3 fiber proteins was verified by detecting the fluorescence signal intensity. The steps are as follows: (1) Material preparation: Recombinant adenovirus EHAdV-7 expressing green fluorescent protein (GFP) (titer: 2.37 × 10⁻⁶) 9 TCID50 / ml), EHAdV-3 (titer: 3.8×10) 8 TCID50 / ml); A549 cells (human lung adenocarcinoma epithelial cells, passaged 2–3 times, stable condition, viability ≥95%) Prokaryotic expression and purification of targeted adenovirus nanobodies (sterilely filtered through a 0.1 μm filter membrane; protein concentration determined). (2) Cell plating and culture A549 cells in logarithmic growth phase were harvested, digested with trypsin, centrifuged at 800 rpm for 5 min, and the supernatant was discarded. The cells were then resuspended in 10% DMEM complete medium and the cell density was adjusted to 5 × 10⁶ cells / year. 4 cells / ml.

[0049] Cell suspension was seeded into 96-well culture plates at 100 μL per well (i.e., 5 × 10³ cells / well); 100 μL of sterile PBS was added to the outer wells of the plate as an evaporation barrier to reduce edge effects.

[0050] Incubate the culture plates in a 37°C, 5% CO2 saturated humidity incubator for 12–24 h. When the cell confluence reaches 60%–70%, proceed with subsequent experiments.

[0051] (3) Gradient dilution of nanobody The sterile filtered nanobodies were serially diluted using 2% DMEM maintenance medium to achieve final concentration gradients of 100, 50, 10, 5, 1, 0.5, 0.1, and 0.05 ug / ml, with three replicates for each concentration.

[0052] During the dilution process, ensure the antibody is thoroughly mixed and avoid the formation of bubbles.

[0053] (4) Preparation of virus working solution Based on the viral titer, EHAdV-7 and EHAdV-3 were diluted with 2% DMEM maintenance medium to prepare a working viral solution with an MOI of 0.5 (the required viral load was calculated based on the A549 cell density to ensure accurate multiplicity of infection).

[0054] (5) Antibody-virus pre-incubation Take a sterile 96-well plate, add 50 μL of nano-antibody diluent of different concentrations and 50 μL of virus working solution to each well, gently pipette to mix, and incubate in a 37°C incubator for 1 h. Gently mix once every 15 min to promote full binding of antibody and virus.

[0055] Set up an experimental control group: Virus control group: Only an equal volume of virus working solution and 2% DMEM maintenance medium (without nanobodies) were added. Cell control group: only an equal volume of 2% DMEM maintenance medium (without virus and nanobody) was added.

[0056] (6) Cell infection and incubation Discard the old culture medium in the A549 cell culture plate, add 100 μL of antibody-virus mixture (or control solution) to each well, and incubate in a 37°C, 5% CO2 incubator for 1 h. Gently shake the culture plate once every 30 min to ensure that the virus and cells are in full contact.

[0057] After incubation, the supernatant in each well was aspirated, and 100 μL of preheated 2% DMEM maintenance medium was added to each well. The wells were then incubated for another 48 h.

[0058] (7) Fluorescence detection and data acquisition After incubation for 48 h, the culture medium in each well was aspirated, and the cells were washed twice with preheated sterile PBS buffer to remove residual culture medium and dead cells. 100 μL of sterile PBS was added to each well, and the fluorescence intensity of GFP was detected using a microplate reader (excitation wavelength 485 nm, emission wavelength 505 nm), and the fluorescence value of each well was recorded.

[0059] (8) Neutralization activity calculation and IC50 analysis The virus neutralization rate of different concentrations of nanobodies was calculated using the following formula: Neutralization rate (fluorescence value of virus control group - fluorescence value of nanobodies group) / (fluorescence value of virus control group - fluorescence value of cell control group) x 100% The mean and standard deviation of the neutralization rate for each concentration in three replicates were calculated. Nonlinear regression analysis was performed using GraphPad Prism software (selecting the "log(inhibitor) vs. response -- Variable slope (fourparameters)" model) to fit the dose-response curve and calculate the half-maximal inhibitory concentration (IC50).

[0060] like Figure 6 and 7 IC 50 The values ​​are the mean ± standard deviation of three independent results. The experiment was independently repeated three times, and the results were similar, showing a representative curve. The results confirm that the nanobody exhibits concentration-dependent in vitro neutralizing activity against both EHAdV-7 and EHAdV-3. This nanobody can effectively block the infection and invasion of host cells by EHAdV-7 and EHAdV-3, possessing excellent broad-spectrum adenovirus neutralizing protective ability, and has extremely high application potential and practical value in the development of drugs for the prevention and treatment of adenovirus infection.

[0061] The sequence numbers of the above embodiments of the present invention are for descriptive purposes only and do not represent the superiority or inferiority of the embodiments.

[0062] The embodiments of the present invention have been described above with reference to the accompanying drawings. However, the present invention is not limited to the specific embodiments described above. The specific embodiments described above are merely illustrative and not restrictive. Those skilled in the art can make many other forms under the guidance of the present invention without departing from the spirit and scope of the claims. All of these forms are within the protection scope of the present invention.

Claims

1. A nanobody that specifically binds to adenovirus fiber protein, characterized in that, Its amino acid sequence is shown in SEQ ID NO.

2.

2. A DNA molecule encoding the nanobody as described in claim 1, characterized in that: Its nucleotide sequence is shown in SEQ ID NO.

1.

3. A recombinant expression vector, characterized in that: Includes the DNA molecule as described in claim 2.

4. A molecule that specifically binds to adenovirus fiber proteins, characterized in that: Including the nanobody as described in claim 1.

5. A phage comprising a molecule that specifically binds to adenovirus fiber protein as described in claim 4, characterized in that: Molecules that specifically bind adenovirus fiber proteins are displayed on the surface of bacteriophages.

6. An adenovirus fiber protein detection reagent, characterized in that: This includes nanobodies as described in claim 1 or molecules that specifically bind adenovirus fiber proteins as described in claim 4.

Images