Bacillus velezensis bswq55, microbial inoculant and application thereof
By screening and applying Bacillus belyss BZWQ55, the problem of poor control effect of Bacillus in existing technologies has been solved, achieving effective control of a variety of soil-borne diseases and promoting plant growth, and providing a safe and environmentally friendly biological control solution.
Patent Information
- Application Number
- CN202610553075.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-24
- Publication Date
- 2026-06-05
Smart Images

Figure CN122146537A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of microbiology, and in particular to a strain of Bacillus belye BZWQ55, its inoculum, and its application. Background Technology
[0002] Currently, soil-borne diseases have become a significant factor affecting plant production and quality. Soil-borne diseases refer to diseases caused by pathogens (such as fungi, bacteria, nematodes, and viruses) that overwinter in the soil or plant debris and infect the roots or stems of plants under suitable conditions. Due to their characteristics of being insidious, delayed, cumulative, and devastating, soil-borne diseases are generally difficult to detect in their early stages, only occurring in large numbers a year or several years later. Furthermore, they are difficult to control and can cause devastating damage to plants. Currently, chemical control is commonly used. However, using chemical agents to control soil-borne diseases can lead to a series of adverse consequences, including soil pollution, pesticide residues, the development of pesticide resistance, and disruption of the ecological balance.
[0003] Currently, the use of beneficial microorganisms for the biological control of plant diseases is a research hotspot and a development trend, and Bacillus (Bacillus) Bacillus Due to its strong resistance to adverse conditions and extracellular activity, it has been widely used in industrial and agricultural production, and its role in the biological control of plant diseases is becoming increasingly prominent.
[0004] Bacillus is a common, strictly aerobic or facultative anaerobic Gram-positive bacterium found in the microbial environment. Its sources are widespread, including air, water, the human and animal intestines, and it can be isolated from soil near plant roots, root surfaces, and the surfaces of plant stems and leaves. Several Bacillus species with biocontrol activities have been reported, including Bacillus subtilis (…). Bacillus subtilis Bacillus subtilis is characterized by its wide distribution and strong adaptability. It can successfully colonize the rhizosphere, surface, or interior of plants, competing with pathogenic microorganisms for nutrients around the plant. It can also secrete antibacterial substances to inhibit the growth of surrounding pathogens. Simultaneously, it can induce systemic resistance in plants, enhancing their overall resistance and thus preventing pathogen invasion. While Bacillus has been widely used in biological control of various plant diseases, such as bacterial wilt, root rot, blight, anthracnose, gray mold, and nematode diseases, its control efficacy remains unsatisfactory, and most biocontrol strains can only control a single type of pathogen. Therefore, there is an urgent need to provide a biocontrol strain with outstanding control efficacy and broad-spectrum control capabilities. Summary of the Invention
[0005] The purpose of this invention is to provide a strain of Bacillus belyssus BZWQ55, a fungal agent, and its application to solve the problems existing in the prior art. The Bacillus belyssus BZWQ55 provided by this invention has a broad-spectrum control effect on pathogens, providing a new strain resource for the biological control of soil-borne plant diseases and the promotion of plant growth.
[0006] To achieve the above objectives, the present invention provides the following solution: This invention provides a strain of Bacillus belye ( Bacillus velezensis BZWQ55, the Bacillus belyeis, was deposited on November 27, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.36805, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.
[0007] The present invention also provides the application of the above-mentioned Bacillus belye BZWQ55 in the preparation of products that promote plant growth and / or control soil-borne diseases.
[0008] Furthermore, the plants include potatoes, cucumbers, pumpkins, radishes, wheat, and corn.
[0009] Furthermore, the soil-borne diseases include potato powdery scab, sweet potato root rot, potato black scurf, potato wilt, potato early blight, potato scab, and peanut fruit rot.
[0010] Furthermore, the product is a microbial inoculant.
[0011] The present invention also provides a microbial agent for promoting plant growth and / or preventing soil-borne diseases, wherein the microbial agent uses the above-mentioned Bacillus berleis BZWQ55 as the active ingredient.
[0012] Furthermore, the microbial agent is in the form of a liquid agent or a solid agent; When the microbial agent is in liquid form, the effective viable count of *Bacillus bellis* BZWQ55 is not less than 2.50 × 10⁻⁶. 9 CFU / mL; When the microbial agent is in the form of a solid agent, the effective viable count of Bacillus bellis BZWQ55 is not less than 1.50 × 10⁻⁶. 8 CFU / g.
[0013] The present invention also provides the application of the above-mentioned Bacillus berberis BZWQ55 or the above-mentioned microbial inoculant in promoting plant growth, wherein the plants include potatoes, cucumbers, pumpkins, radishes, wheat and corn.
[0014] This invention also provides the application of the above-mentioned Bacillus berberis BZWQ55 or the above-mentioned microbial agent in inhibiting pathogenic microorganisms, wherein the pathogenic microorganisms include Streptomyces scabies ( Streptomyces scabies ), Alternaria alternifolia ( Alternaria solani Rhizoctonia solani ( ), Rhizoctonia solani Rhizoctonia solani Fusarium solani () Fusarium solani Fusarium oxysporum ( Fusarium oxysporum ) and Neocaridia ectenes ( Neocosmospora vasinfecta ).
[0015] The present invention also provides the application of the above-mentioned Bacillus berberis BZWQ55 or the above-mentioned microbial agent in the prevention and control of soil-borne diseases, including potato powdery scab, sweet potato root rot, potato black scurf, potato wilt, potato early blight, potato scab and peanut fruit rot.
[0016] The present invention discloses the following technical effects: This invention screened a strain of *Bacillus belye* BZWQ55 from the rhizosphere soil of a potato scab-infected field (CGMCC No. 36805). Experimental results showed that *Bacillus belye* BZWQ55 possesses the ability to produce cellulase, protease, amylase, siderophores, and to solubilize phosphorus, potassium, and fix nitrogen, effectively promoting plant growth. *Bacillus belye* BZWQ55 also stably inhibited the growth of *Fusarium solani*, *Fusarium oxysporum*, *Alternaria alternata*, *Streptomyces scabica*, *Rhizoctonia solani*, and *Neococcus sanguinis*, demonstrating significant control efficacy against various soil-borne diseases such as potato powdery scab, sweet potato root rot, potato scab, and peanut fruit rot. This invention provides a new strain resource for the biological control of soil-borne plant diseases and for promoting plant growth. Attached Figure Description
[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0018] Figure 1 This is a colony morphology diagram of Bacillus belyssus BZWQ55. Figure 2 The graph shows the physiological and biochemical function test results of Bacillus belyssus BZWQ55; where A represents the protease production ability test result; B represents the cellulase production ability test result; C represents the siderophore production ability test result; D represents the inorganic phosphorus solubilization ability test result; E represents the potassium solubilization ability test result; and F represents the amylase production ability test result. Figure 3 Based on purH Phylogenetic tree of Bacillus belyss BZWQ55 constructed from genes; Figure 4 The graph shows the inhibitory effect of Bacillus belyssioides BZWQ55 on six pathogens; where A represents the inhibitory effect on Neocarobacter invasiveus (…). Neocosmospora vasinfecta The inhibitory effect of GF-1; B is the inhibitory effect on Rhizoctonia solani ( ) Rhizoctonia solani The inhibitory effect of RS-5; C represents the inhibitory effect on Streptomyces cuspidatum (S. scabbingis). Streptomyces scabies The inhibitory effect of CPS-1; D represents the inhibitory effect on Fusarium oxysporum (CPS-1); Fusarium oxysporum The inhibitory effect of FO-2; E represents the inhibitory effect on Alternaria solanacearum ( Alternaria solani The inhibitory effect of AS-8; F represents the inhibitory effect on Fusarium solani (…). Fusarium solani The inhibitory effect of FS-1; Figure 5 This study investigated the growth-promoting effects of Bacillus belyssus BZWQ55 liquid inoculant on plant growth. Specifically, A represents the growth-promoting effect on pumpkin seedlings 10 days after treatment; B represents the growth-promoting effect on radish seedlings 10 days after treatment; C represents the growth-promoting effect on cucumber seedlings 10 days after treatment; D represents the growth-promoting effect on potato seedlings 10 days after treatment; E represents the growth-promoting effect on corn seedlings 10 days after treatment; and F represents the growth-promoting effect on wheat seedlings 10 days after treatment. In AF, a represents plants treated with Bacillus belyssus BZWQ55 liquid inoculant, and b represents control plants. Figure 6 Figure 1 shows the results of an experiment on the control of miniature potato scab by Bacillus vesicle BZWQ55 inoculum; where a represents the treatment with Bacillus vesicle BZWQ55 inoculum and b represents routine management. Figure 7 The figure shows the results of the experiment on the control of potato powdery scab by Bacillus vesicle BZWQ55 inoculum; where a represents the treatment with Bacillus vesicle BZWQ55 inoculum and b represents routine management. Figure 8 Figure 1 shows the results of an experiment on the control of sweet potato root rot by Bacillus vesicle BZWQ55 inoculum; where a represents the treatment with Bacillus vesicle BZWQ55 inoculum; b represents routine management; and 0-4 represent different disease severity levels. Figure 9 The figure shows the results of the experiment on the control of peanut fruit rot by Bacillus vesicularis BZWQ55 inoculum; where a represents the treatment with Bacillus vesicularis BZWQ55 inoculum and b represents routine management.
[0019] Biological Preservation Information: Bacillus belesiensis ( Bacillus velezensisBZWQ55 was deposited on November 27, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.36805. The deposit address is No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences. Detailed Implementation
[0020] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0021] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0022] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0023] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0024] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0025] Example 1: Isolation, screening, and identification of Bacillus belye BZWQ55 1. Isolation and screening of strain BZWQ55 Soil samples were taken from the root system of diseased potato scab-infected plants in fields where potatoes had been continuously cropped for many years. These samples were then placed in a 200-mesh sieve and coated with a fungicide containing the potato scab pathogen. Streptomyces scabiesCPS-1 was placed in a PDA culture dish and incubated at 30°C for 48 hours. The central colony with the inhibition zone was picked, purified by streak plating, and then cultured on a PDA slant for 24 hours. It was then stored in a refrigerator at 4°C for later use. After the isolated bacteria were propagated in LB liquid medium, 5 μL of each strain was evenly inoculated onto filter paper discs of culture plates coated with different soil-borne pathogens. The strains were cultured at 28℃ for 72 h. Each treatment was repeated 3 times. The strain that showed inhibitory effects against different soil-borne pathogens was selected and recorded as strain BZWQ55.
[0026] 2. Identification of strain BZWQ55 2.1 Morphological observation of strain BZWQ55 Strawberry strain BZWQ55 was streaked onto a PDA agar plate, which was then inverted and incubated at 30°C for 24 hours. Colony growth was observed and recorded. Initially, the colonies on the plate were round, milky white, and opaque, resembling... Figure 1 As shown; the edges of the colonies become irregular in the later stages.
[0027] 2.2 Physiological and biochemical functional determination of strain BZWQ55 The information on the culture media required for physiological and biochemical functional assays is as follows: Inorganic phosphorus medium: 10.0g glucose, 0.5g (NH4)2SO4, 0.3g MgSO4·7H2O, 0.3g NaCl, 0.3g KCl, 0.03g FeSO4·7H2O, 0.03g MnSO4·7H2O, 5.0g Ca3(PO4)2, 17.0g agar, add distilled water to a final volume of 1.0L, maintain pH between 7.0 and 7.4, autoclave at 121℃ for 20min.
[0028] Nitrogen-fixing medium: KH2PO4 0.2g, MnSO4 0.2g, NaCl 0.2g, CaCO3 5.0g, mannitol 10.0g, CaSO4 0.1g, agar 18.0g, add distilled water to a final volume of 1.0L, pH 7.0, autoclave at 121℃ for 30min.
[0029] Potassium-solubilizing medium: Na2HPO4 2.0g, FeCl3 0.005g, MgSO4·7H2O 0.5g, CaCO3 0.1g, sucrose 5.0g, potassium feldspar powder (washed 5 times with deionized water) 1.0g, bromothymol blue 0.1g, agar 20.0g, add distilled water to a final volume of 1.0L, pH 7.0, autoclave at 121℃ for 20min.
[0030] Protease medium: 15.0g skim milk powder, 15.0g agar, add distilled water to a final volume of 1.0L, set pH to normal, autoclave at 110℃ for 15min.
[0031] Starch hydrolase culture medium: 2.0g soluble starch, 3.0g beef extract, 5.0g peptone, 2.5g glucose, 18.0g agar, add distilled water to a final volume of 1.0L, pH 7.0, autoclave at 121℃ for 20min.
[0032] IAA medium: Add 0.1g of L-tryptophan to LB medium and autoclave at 121℃ for 20min.
[0033] Cellulase medium: 10.0g peptone, 10.0g sodium carboxymethyl cellulose (CMC-Na), 5.0g yeast extract, 5.0g NaCl, 0.2g MgSO4, 1.0g KH2PO4, 20.0g agar, add distilled water to a final volume of 1.0L, autoclave at 115℃ for 30min.
[0034] Siderophore culture medium (CAS): CAS 0.0605g, HDTMA 0.0729g, FeCl3·6H2O 0.002645g, NaH2PO4·2H2O 0.29525g, Na2HPO4·12H2O 1.2135g, NH4Cl 0.125g, KH2PO4 0.0375g, NaCl 0.0625g, agar 9.0g, diluted with distilled water to a final volume of 1.0L, autoclaved at 116℃ for 30min, purchased from Haibo Biotechnology Co., Ltd.
[0035] Salkowski colorimetric solution: 15 mL of 0.5 mol / L FeCl3 solution, 300 mL of H2SO4, and 500 mL of distilled water. Mix well before use and store away from light.
[0036] Strains BZWQ55 were inoculated onto protease, cellulase, and amylase media, respectively, and incubated at 28°C for 4 days. The presence of a clear zone around the strain on the protease and amylase media was observed. The presence of a clear zone indicated that strain BZWQ55 possessed the function of producing the corresponding enzyme; otherwise, it did not.
[0037] After culturing strain BZWQ55 on cellulase medium for 5 days, an appropriate amount of Congo red solution (1 mg / mL) was added to the medium. After staining for 1 hour, the Congo red solution was poured out, and the strain was repeatedly washed with distilled water. Finally, it was soaked and eluted with an appropriate amount of NaCl solution (1 mol / L) for 30 minutes. The NaCl eluent was then poured out. If a clear zone was formed around the strain, it indicated that cellulase could be produced; otherwise, it could not.
[0038] The selected strain BZWQ55 was spotted onto an inorganic phosphorus medium plate and incubated at 28°C for 2-5 days. The presence or absence of a clear zone was observed to determine the phosphorus solubilizing ability of strain BZWQ55.
[0039] The selected strain BZWQ55 was inoculated onto potassium-solubilizing and nitrogen-fixing medium plates using the three-zone streak method and cultured at 28℃ for 2-5 days. The results showed that strain BZWQ55 could produce smooth, transparent, oil-drop-shaped colonies.
[0040] The selected strain BZWQ55 was inoculated onto CAS plates and cultured at 28°C for 2-5 days. The presence of transparent orange circles was observed to determine the strength of the siderophore production capacity of strain BZWQ55.
[0041] The selected bacterial strain BZWQ55 was inoculated into IAA medium and cultured at 28℃ and 180 r / min for 48 h. Then, 1.0 mL of the bacterial suspension was mixed with Salkowski colorimetric solution. A control was prepared by mixing 1.0 mL of 50 mg / L IAA standard solution with an equal volume of the colorimetric solution. All mixtures were incubated in the dark for 30 min and observed. If the solution turned red, strain BZWQ55 could produce IAA; otherwise, it could not.
[0042] The test results are shown in Table 1 and Figure 2 As shown.
[0043] Table 1. Statistical analysis of functional test results for strain BZWQ55 Note: "+" indicates a positive result, and "-" indicates a negative result.
[0044] From Table 1 and Figure 2 The test results show that strain BZWQ55 has the ability to produce protease, cellulase, amylase, siderophore and IAA, and also has the functions of phosphorus solubilization, potassium solubilization and nitrogen fixation.
[0045] 3. Combined with 16S rRNA , purH Multi-gene molecular identification of gene sequences DNA was extracted from strain BZWQ55 using a bacterial genomic DNA extraction kit from Tiangen Biotech Co., Ltd., and analyzed using 27F / 1492R... purH -70F / purH-PCR amplification was performed using 1013R bacterial primers (primer sequences are detailed in Table 2). PCR products were detected by 1% agarose gel electrophoresis and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. After sequencing, the obtained sequences were submitted to the GenBank nucleic acid database for BLAST alignment. Sequences of strains with high similarity were selected for analysis. A phylogenetic tree of different genes of strain BZWQ55 was constructed using the neighbor-joining method in Mega 5.0 software.
[0046] Table 2 Primer sequences for molecular biological identification The obtained PCR products were sequenced by Tianjin Qingke Biotechnology Co., Ltd. The nucleotide sequences of different genes of strain BZWQ55 are as follows: 16S r RNA The nucleotide sequence is shown in SEQ ID NO.5.
[0047] SEQ ID NO.5: purH The nucleotide sequence of the gene is shown in SEQ ID NO.6.
[0048] SEQ ID NO.6: GAGGAACAAAAAAACTTCTTCAGGAAAACGGTGTGGATGTCATCGGCATTTCAGAAGTGACCGGATTTCCTGAAATTATGGACGGACGGTTAAAAACGCTCCATCCTAATATTCACGGCGGACTGCTTGCCGTAAGAGACAATGAAGAGCATATGGCGCAGATCAATGAGCATGGCATTGCCCCCATTGACCTTGTGGTCGTCAACCTTTACCCGTTTAAAGAAACGATTTCGAAAGAAGACGTAACATACGATGAAGCGATAGAAAACATTGATATCGGCGGTCCCGGCATGCTGCGCGCCGCATCGAAAAACCATCAGGATGTGACGGTCATCACAGATCCGGCCGATTACAGCTCCGTGCTCAATGAGATGAAAGAACACGGCGGCGTTTCGCTTAAAAGAAAACGCGAGCTTGCGGCCAAAGTATTCCGCCATACCGCGGCATACGACGCATTAATCGCTGATTACTTAACACGCGAGGCCGGTGAGAAAGACCCTGAGCAATTCACCGTTACATTTGAGAAAAAACAATCGCTCCGCTATGGTGAAAACCCTCACCAAGAGGCTGTTTTCTATCAAAGCGCACTTCCCGTCTCCGGTTCCATCGCGGCGGCAAAACAGCTTCACGGCAAAGAGCTTTCTTACAACAATATTAAGGACGCAGATGCGGCCGTTCAAATCGTCCGGGAATTTACAGAACCCGCAGCTGTTGCCGTTAAACATATGAACCCGTGCGGAGTCGGTACGGGAGCTTCAATTGAGGAAGCATTCAATAAAGCGTATGAAGCTGATAAAACCTCCATTTTCGGCGGCATCATCGCGCTGAACCGTGAAGTTGATCAGGCAACGGCTGAAGCCCTTCACGGCATCTTTTTAGAAATCATTATCGCCCCT。
[0049] The obtained nucleotide sequences were subjected to BLAST homology sequence alignment analysis using the NCBI database, yielding sequences with high similarity. A phylogenetic tree was constructed using MEGA 6.0 software. Figure 3 The 16S of strain BZWQ55 isolated in this invention rRNA Sequence and Bacillus belesiensis ( Bacillus velezensis ) of 16S rRNA and purH The homology of the genes reached 99.93% and 99.91%, respectively.
[0050] Based on the above morphological observations, physiological and biochemical characteristics, and multi-gene sequence identification results, the strain screened in this embodiment can be identified as *Bacillus belyssae*. Bacillus velezensis It was named Bacillus belyssus BZWQ55.
[0051] 4. Strain preservation Bacillus belesiensis ( Bacillus velezensis BZWQ55 was deposited on November 27, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 36805. The deposit address is No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences.
[0052] Example 2: In-plate inhibition test of Bacillus belycetamol BZWQ55 against soil-borne pathogens Test pathogen: Streptomyces scabies ( Streptomyces scabies CPS-1 (the pathogen of potato scab, abbreviated as CPS-1), Alternaria alternata ( Alternaria solani AS-8 (the pathogen of early blight of potato, abbreviated as AS-8), Rhizoctonia solani ( Rhizoctonia solani RS-5 (the pathogen of potato black scurf, abbreviated as RS-5), Fusarium solani ( Fusarium solani FS-1 (the pathogen causing sweet potato root rot, abbreviated as FS-1), Fusarium oxysporum ( Fusarium oxysporum FO-2 (the pathogen of potato wilt, abbreviated as FO-2), *Neocytotrichum spp.* Neocosmospora vasinfecta GF-1 (the pathogen causing peanut rot, abbreviated as GF-1).
[0053] The plate confrontation method was used for detection, with various soil-borne pathogens as indicator bacteria. The antibacterial activity of *Bacillus vesiculosus* BZWQ55 was tested. The specific steps were as follows: A 6mm diameter perforator was used to create a bacterial disc on a pathogen plate. The disc was then inverted and inoculated into the center of a PDA medium. The medium was incubated in an inverted state at 28℃ for 2 days. When the pathogen diameter reached approximately 2cm, *Bacillus vesiculosus* BZWQ55 was inoculated. A 6mm diameter filter paper disc was placed 2cm from the edge of the pathogen using sterile forceps. Four points were inoculated on each PDA plate (three inoculation points and one control). 2µL of a *Bacillus vesiculosus* BZWQ55 suspension (effective viable count 5.0 × 10⁻⁶) was aspirated using a micropipette. 6 CFU / mL was added to filter paper, with filter paper without Bacillus belyceta var. brevis inoculated with pure culture medium as a control. The experiment was repeated three times. The culture dishes were placed in an incubator at 28°C for 4 days. The radius of the pathogen in the control group and the treatment group (the distance between the edge of the pathogen at the time of inoculation and the edge of the colony at the time of measurement) was measured to calculate the inhibition rate and measure the width of the inhibition zone.
[0054] The formula for calculating the antibacterial rate is as follows: Inhibition rate (%) = (radius of pathogen in control group - radius of pathogen in confrontation group) / radius of pathogen in control group × 100.
[0055] The antibacterial test results are shown in Table 3 and Figure 4 As shown, the results indicate that *Bacillus belye* BZWQ55 exhibits good antibacterial activity against all six tested soil-borne pathogens. It forms a distinct inhibition zone against each tested pathogen, effectively inhibiting their growth, with the highest inhibition rate reaching 67.72%. Therefore, *Bacillus belye* BZWQ55 demonstrates good antibacterial activity against various soil-borne pathogens.
[0056] Table 3. Results of antibacterial tests of strain BZWQ55 against six soil-borne pathogens. Example 3: Preparation of Bacillus belye BZWQ55 inoculum 1. Preparation of liquid inoculum of Bacillus belyssus BZWQ55 Bacillus belye BZWQ55 was inoculated into LB medium and activated at 28℃ for 48 h. The activated strain was then propagated in 500 mL Erlenmeyer flasks to obtain a fermentation seed culture. This seed culture was inoculated into medium 5 at a 5% inoculation rate, and continuous fermentation was carried out in 500 mL shake flasks and a 50 L fermenter under the following conditions: rotation speed 200 r / min, fermentation temperature 32℃, and fermentation time 24 h. This yielded a liquid Bacillus belye BZWQ55 inoculum with a bacterial count of approximately 2.50 × 10⁻⁶. 9CFU / mL. Samples were taken promptly after each fermentation was completed, and serial dilution counting was performed using the plate dilution method to determine the bacterial count in the fermentation broth.
[0057] The formula for culture medium No. 5 is as follows: 1.5 wt.% peanut cake powder, 2.2 wt.% soybean powder, 1.0 wt.% wheat bran powder, 1.5 wt.% glucose, 0.5 wt.% ammonium sulfate, 0.5 wt.% magnesium sulfate, 0.5 wt.% sodium chloride, 0.2 wt.% calcium carbonate, 0.1 wt.% potassium nitrate, 0.1 wt.% monosodium glutamate, and distilled water to a final volume of 1000 mL. After mixing, autoclave at 121℃ for 20 min.
[0058] 2. Preparation of Bacillus belyssus BZWQ55 solid inoculum The liquid fermentation broth obtained from Bacillus vesiculosus BZWQ55 (effective viable count of 2.50 × 10⁻⁶) 9 CFU / mL) was inoculated into the solid fermentation substrate at an inoculum size of 0.5 mL / g. Medium No. 5 was added at an initial substrate-to-water ratio of 1 mL:1 g. Fermentation was carried out at 25°C for 48 hours to obtain *Bacillus belyssiensis* BZWQ55 solid inoculum, with a viable count of 1.50 × 10⁻⁶ cells / mL. 8 CFU / g.
[0059] The solid fermentation substrate formula consists of peanut meal powder, precipitated silica, and wheat bran, with a mass ratio of 1:8:1.
[0060] Example 4: Safety determination of Bacillus belyss BZWQ55 seedlings Bacillus berberis BZWQ55 liquid inoculum (2.50×10⁻⁶) 9 The safety of the liquid inoculant (CFU / mL) in seedlings of potato, cucumber, radish, pumpkin, corn, and wheat was tested. One week after emergence, the liquid inoculant was diluted 20 times and applied as a root drench, with water used as a control (CK). Plant growth was monitored, and after 15 days of treatment, various growth indicators were investigated and statistically analyzed. Results are shown in Table 4. Figure 5 .
[0061] Table 4. Statistical results of growth indicators of different crop seedlings after treatment with Bacillus belyssus BZWQ55 fermentation broth. From Table 4 and Figure 5 It is known that the application of Bacillus vesiculosus BZWQ55 liquid inoculant is safe for seedlings of potatoes, cucumbers, radishes, pumpkins, corn, and wheat, and has a significant effect on promoting root length or plant height.
[0062] Example 5: Control effect of Bacillus belye BZWQ55 on potato scab. Microbial inoculants prepared from Bacillus vesicles BZWQ55 were applied to control potato scab in miniature potato seedbeds. The tested potato variety was Wotu 5, and the seed material consisted of first-generation small potatoes propagated from test-tube seedlings. The substrate used was recycled vermiculite that had previously caused scab occurrences to ensure the disease would definitely develop. Each treatment area was 2.0 m². 2 Each treatment was repeated three times, with a control group treated using standard management methods. The specific method is as follows: Before sowing, use Bacillus vesiculosus BZWQ55 solid formulation (1.50 × 10⁻⁶ viable cells). 8 Seeds were treated with a seed dressing solution containing CFU / g, and planted at a row spacing of 6.0cm, a plant spacing of 5.0cm, and a sowing depth of 8.0cm. After emergence, when the seedlings reached a height of 10cm, a first application of Bacillus vesiculosus BZWQ55 liquid inoculant (2.50 × 10⁻⁶ viable cells) was applied. 9 (CFU / mL), a second treatment with Bacillus vesicles BZWQ55 liquid inoculant was applied during the tuber enlargement period, with a dosage of 0.2 L / mL each time. 2 The dilution was 20 times, with conventional management as the control. During the period of observation, it was found that the plants grew vigorously in the middle stage, the leaves were darker green than the control, and the plant stems were thicker than the control. The results were investigated after harvest.
[0063] As shown in Table 5 and Figure 6 As shown, the results indicated that 307 tubers were harvested in the control group and 313 in the treatment group. The disease index was 16.50 in the control group and 1.28 in the treatment group, with a control efficacy of 92.24% against potato scab.
[0064] Table 5. Statistical results of the survey on the control of miniature potato scab by Bacillus vesicularis BZWQ55 inoculum. Example 6: Control effect of Bacillus belye BZWQ55 on potato powdery scab In 2025, a potato powdery scab control experiment was conducted in Shuangaitang Village, Guyuan County, Zhangjiakou City. The experimental plots were potato fields infected with powdery scab that had been continuously cropped for many years. Each treatment area was 66.6 m². 2 The potato variety used in the experiment was Wotu No. 5, and the specific steps were as follows: When sowing on May 8, 2025, a solid formulation of Bacillus bereaves BZWQ55 (with a viable count of 1.50 × 10⁻⁶) was administered. 8 Seed dressing (CFU / g) at a dosage of 1.5%. During plant growth, administer Bacillus beleibasis BZWQ55 liquid inoculant (2.50 × 10⁻⁶ viable cells). 9Two drip irrigation treatments (CFU / mL) were administered. The first treatment was applied on July 5, 2025, during the tuber formation stage, and the second treatment was applied on August 10, 2025, during the tuber enlargement stage. Each treatment used 1.0 L of the solution at a 50-fold dilution. Conventional management served as a control. Before potato harvest, a five-point diagonal sampling survey was conducted to count the number of tubers at each stage. Disease incidence, disease index, and control efficacy were calculated.
[0065] As shown in Table 6 and Figure 7 As shown, the experimental results indicate that the incidence of potato powdery scab in the control group of Wotu 5 variety was 83.61%, and the disease index was 47.68. The incidence of potato powdery scab in the treatment group treated with Bacillus vesicles BZWQ55 was 53.91%, and the disease index was 12.76. The control efficacy of Bacillus vesicles BZWQ55 against potato powdery scab was 73.24%.
[0066] Table 6. Statistical results of the survey on the control of potato powdery scab by biocontrol agents. Example 7: Control effect of Bacillus belye BZWQ55 on sweet potato root rot The experiment was conducted in Daren Village, Dongluobao Town, Dingxing County, Baoding City, in a field that had been infected with sweet potato root rot for many years. The experimental variety was sweet potato "Yan 25". The treatment area was 66.6 m². 2 At sowing time (May 17, 2025), use Bacillus belyeh BZWQ55 solid inoculum (live count 1.50 × 10⁻⁶). 8 Roots were treated with a CFU / g solution, and during the sweet potato growth period, Bacillus veitchii BZWQ55 liquid inoculant (2.50 × 10⁻⁶ CFU / g) was applied on June 9, 2025 and July 3, 2025, respectively. 9 Drip irrigation was applied (CFU / mL) as a control, with conventional production management as the reference. At harvest (October 20, 2025), a five-point sampling survey was conducted using the diagonal method.
[0067] As shown in Table 7 and Figure 8 As shown, the experimental results indicate that the incidence of sweet potato root rot in the control group was 61.48%, and the disease index was 29.93; the incidence of Bacillus vesiculosus BZWQ55 inoculant treatment group was 25.94%, the disease index was 9.49, and the control effect was 68.30%.
[0068] Table 7. Statistical results of the control experiment of BZWQ55 inoculant against sweet potato root rot. Example 8: Control effect of Bacillus belye BZWQ55 on peanut fruit rot. The experimental plot was a peanut field infected with peanut pod rot due to continuous cropping for many years. The experimental variety was Yunnan Seven-Color Peanut, and the treatment area was 320m². 2 The specific steps are as follows: During the peanut plant growth period, administer Bacillus vesiculosus BZWQ55 liquid inoculant (live count of 2.50 × 10⁻⁶). 9 The fertilizer was applied three times via drip irrigation (CFU / mL). The first application was on July 8, 2024, during the flowering and pegging stage; the second application was on August 7, 2022; and the third application was on August 28, 2024. Each application was 0.1 L / mL. 2 Dilute 50 times before application, with conventional management as the control. Before peanut harvest, the pods of the treatment group and the control group were investigated, and the incidence rate, disease index, and control efficacy of each treatment were calculated.
[0069] As shown in Table 8 and Figure 9 As shown, the results indicate that the incidence rate in the control plot was 76.75%, and the disease index was 34.59; after treatment with Bacillus belyssus BZWQ55 inoculant, the incidence rate was 47.15%, the disease index was 17.54, and the control efficacy was 49.29%.
[0070] Table 8. Statistical results of the control experiment of BZWQ55 inoculant against peanut fruit rot. The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A strain of Bacillus belye ( Bacillus velezensis BZWQ55, characterized in that, The Bacillus belyssus BZWQ55 was deposited on November 27, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.36805, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.
2. The use of Bacillus belye BZWQ55 as described in claim 1 in the preparation of products that promote plant growth and / or control soil-borne diseases.
3. The application as described in claim 2, characterized in that, The plants mentioned include potatoes, cucumbers, pumpkins, radishes, wheat, and corn.
4. The application as described in claim 2, characterized in that, The soil-borne diseases mentioned include potato powdery scab, sweet potato root rot, potato black scurf, potato wilt, potato early blight, potato scab, and peanut fruit rot.
5. The application as described in any one of claims 2-4, characterized in that, The product is a microbial inoculant.
6. A microbial inoculant for promoting plant growth and / or controlling soil-borne diseases, characterized in that, The microbial agent uses Bacillus berberis BZWQ55 as the active ingredient as described in claim 1.
7. The microbial agent as described in claim 6, characterized in that, The microbial agent is in the form of a liquid agent or a solid agent; When the microbial agent is in liquid form, the effective viable count of *Bacillus bellis* BZWQ55 is not less than 2.50 × 10⁻⁶. 9 CFU / mL; When the microbial agent is in the form of a solid agent, the effective viable count of Bacillus bellis BZWQ55 is not less than 1.50 × 10⁻⁶. 8 CFU / g.
8. The application of Bacillus belye BZWQ55 as described in claim 1 or the microbial agent as described in claim 6 or 7 in promoting plant growth, characterized in that, The plants mentioned include potatoes, cucumbers, pumpkins, radishes, wheat, and corn.
9. The application of Bacillus belye BZWQ55 as described in claim 1 or the microbial agent as described in claim 6 or 7 in inhibiting pathogenic microorganisms, characterized in that, The pathogenic microorganisms include Streptomyces cuspidatum (Sterilaria esculenta). Streptomyces scabies ), Alternaria alternifolia ( Alternaria solani Rhizoctonia solani ( ), Rhizoctonia solani Rhizoctonia solani Fusarium solani () Fusarium solani Fusarium oxysporum ( Fusarium oxysporum ) and Neocaridia ectenes ( Neocosmospora vasinfecta ).
10. The application of Bacillus belye BZWQ55 as described in claim 1 or the microbial agent as described in claim 6 or 7 in the prevention and control of soil-borne diseases, characterized in that, The soil-borne diseases mentioned include potato powdery scab, sweet potato root rot, potato black scurf, potato wilt, potato early blight, potato scab, and peanut fruit rot.