Application of yheS gene in regulating virulence and immunogenicity of rimerella anatipefae

By constructing yheS gene deletion and complement strains of Riemerella anatipestifer and regulating yheS gene expression, the problem of controlling Riemerella anatipestifer infection was solved, significantly reducing virulence and increasing immunogenicity, providing a novel application for live vaccines.

CN122146547APending Publication Date: 2026-06-05HEBEI NORMAL UNIVERSITY OF SCIENCE & TECHNOLOGY +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610135176.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-30
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively control Riemerella anatipestifer infection, especially given the increasing antibiotic resistance and the limitations imposed by the blood-brain barrier. Developing effective control measures has become an urgent problem to be solved.

Method used

By constructing *Riemerella anatipestifer* strains with and without the yheS gene deletion and complement, the expression level of the yheS gene was regulated to affect the virulence and immunogenicity of the strains. Vaccines were prepared using the yheS gene deletion strains to protect animals.

Benefits of technology

It significantly reduces the virulence of Riemerella anatipestifer, enhances its immunogenicity, decreases the bacterial load of gene-deleted strains in animals, achieves 100% immune protection, and provides a novel live vaccine option.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122146547A_ABST
    Figure CN122146547A_ABST
Patent Text Reader

Abstract

The application discloses yheS The application relates to the field of genetic engineering, and relates to application of a gene in regulation of Riemerella anatipestifer virulence and immunogenicity. ΔyheS The application constructs a gene deletion strain and a gene back-supplementation strain C ΔyheS The results show that yheS Gene deletion can significantly affect growth of the Riemerella anatipestifer, especially under iron limitation conditions; yheS After deletion, the RA bacterial morphology becomes more elongated. yheS Gene deletion leads to significant decrease of virulence of the Riemerella anatipestifer, and the bacterial load in liver, spleen and brain is decreased. yheS The gene deletion strain can realize 100% protection of an animal body through intramuscular injection immunization and / or oral immunization. The above results all show that yheS yheS The gene is an important virulence factor of the Riemerella anatipestifer, and the gene deletion strain can be used as an ideal selection of a new live vaccine of the Riemerella anatipestifer.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and more specifically to... yheS Application of genes in regulating the virulence and immunogenicity of Riemerella anatipestifer. Background Technology

[0002] Riemerella anatipestifer ( Riemerellaanatipestifer Riemerella anatipestifer (RA) is a pathogen that can cause serositis, peritonitis, and meningitis in waterfowl, resulting in high mortality rates. The disease primarily affects chicks under two months old, and once it occurs, prevention and control are extremely difficult, posing a serious threat to the waterfowl industry. Notably, in recent years, there have been increasing reports of Riemerella anatipestifer infection causing serositis and oviductitis in chickens, indicating that the harm caused by this bacterium is becoming increasingly severe.

[0003] Antibiotics were once an effective treatment for RA infection, but in recent years, the increasing drug resistance of strains has caused significant challenges to the clinical application of antibiotics in treating Riemerella anatipestifer. Furthermore, RA infection often involves the brain, and the blood-brain barrier further limits the use of antibiotics.

[0004] Therefore, how to develop effective control methods for Riemerella anatipestifer is a technical problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0005] In view of this, the present invention provides yheS Application of genes in regulating the virulence and immunogenicity of Riemerella anatipestifer.

[0006] To solve the above-mentioned technical problems, this application adopts the following technical solution:

[0007] yheS The application of genes in regulating the virulence of Riemerella anatipestifer, the aforementioned yheS The amino acid sequence encoded by the gene is shown in SEQ ID NO.2.

[0008] Preferably, the yheS The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0009] More preferably, the reduction of the above yheS The expression level of the gene reduces the virulence of Riemerella anatipestifer; enhances the... yheS Gene expression increases the virulence of Riemerella anatipestifer.

[0010] Another object of the present invention is to provide yheS The application of genes in regulating the immunogenicity of Riemerella anatipestifer, the aforementioned yheS The amino acid sequence encoded by the gene is shown in SEQ ID NO.2, and the downregulation of the... yheSGene expression increases the immunogenicity of Riemerella anatipestifer.

[0011] Preferably, the yheS The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0012] Another object of the present invention is to provide Riemerella anatipestifer. yheS Application of gene-deleted strains in the preparation of Riemerella anatipestifer vaccine, wherein Riemerella anatipestifer... yheS The process of constructing gene-deleted strains is as follows: S1. Amplify using primers SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5, SEQ ID NO.6 respectively. yheS The upstream and downstream homologous arms of the gene were obtained, and then the erythromycin resistance gene ERMF was amplified using primers SEQ ID NO.7 and SEQ ID NO.8. The obtained upstream and downstream homologous arm fragments were combined with the erythromycin resistance fragment by overlapping PCR to obtain the homologous fragment carrying the resistance. S2. Riemerella anatipestifer was cultured to the logarithmic growth phase. The culture solution in the logarithmic growth phase was then co-incubated with a homologous fragment carrying resistance. The fragment was then diluted and spread onto erythromycin-resistant GCB solid medium and cultured at 37°C with 5% CO2. This confirmed the successful construction of the gene-deleted strain, yielding the gene-deleted strain ΔyheS.

[0013] As can be seen from the above technical solution, compared with the prior art, the present invention has the following beneficial effects: The present invention constructs *Rimerella anatipestifer*. yheS Gene deletion strain ΔyheS and gene complementation strain C ΔyheS Biological characteristic analysis showed that yheS Gene deletion can significantly affect the growth of Riemerella anatipestifer, especially under iron restriction conditions; yheS After deletion, the RA cells become more elongated; and, yheS Gene deletion can affect the survival of rheumatoid arthritis (RA) under acidic stress. Further animal studies showed that... yheS Gene deletion resulted in a significant decrease in the virulence of *Rimerella anatipestifer*, and a reduction in bacterial load in the liver, spleen, and brain. Immunoprotective assays showed that *Rimerella anatipestifer*... yheS Gene-deleted strains provide 100% protection to animals via intramuscular injection and / or oral immunization. These results demonstrate... yheS Genes are an important virulence factor of Riemerella anatipestifer, and strains with gene deletions are an ideal choice for novel live vaccines against Riemerella anatipestifer. Attached Figure Description

[0014] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0015] Figure 1 For the gene deletion strain RACL-1 Δ yheS and gene complementation strain C ΔyheS The PCR verification results are shown, where A represents the amplification results of primer ID and B represents the amplification results of primers P3 and P4.

[0016] Figure 2 For each strain yheS Gene expression level measurement results.

[0017] Figure 3 The results of growth curve determination for each strain are shown.

[0018] Figure 4 The growth curves of each strain in solutions containing different cations are shown below; where A represents the growth curves of each strain in TSB and TSB with 50 mM DIP added; B and F represent the growth curves of each strain in solutions with different metal cations (50 mM FeSO4, 1 mM MnCl2, 400 mM ZnSO4, 200 mM CuCl2, and 1 mM NiCl2) under DIP restriction. P < 0.001, ns indicates no difference.

[0019] Figure 5 The results show the survival rates of various strains under different environments; where A represents oxidative stress, B represents acid stress, C represents alkaline stress, D represents heat stress, and the results were obtained by incubation in PBS at 42°C for 30 min. E represents the results in goose inactivated serum and non-inactivated serum.

[0020] Figure 6 For wild-type and gene-deleted strains RACL-1 ΔyheS Morphological images, where A is the result of scanning electron microscopy and B is the result of transmission electron microscopy.

[0021] Figure 7 The adhesion and invasion abilities of each strain were determined, where A represents the adhesion assay and B represents the invasion assay; P < 0.001, P < 0.01, P < 0.05.

[0022] Figure 8 For wild-type and gene-deleted strains RACL-1 ΔyheS Colonization assay in in vivo; where A represents the bacterial load in the liver, B in the spleen, and C in the brain. P < 0.001.

[0023] Figure 9 HE staining results of heart, liver, and brain tissues of geese after viral challenge (400×).

[0024] Figure 10 The results are for the immune protection assay, where A is the immunization procedure, B is the muscle immune protection rate, C is the oral immune protection rate, D is the immune level detection, and E is the weight monitoring of immunized geese. Detailed Implementation

[0025] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0026] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0027] Example 1: Riemerella anatipestifer gene deletion strain RACL-1 ΔyheS and gene complementation strain C ΔyheS Construction First, using PCR technology, *R. anatipestifer* RACL-1 (accession number CGMCC No. 37142, deposited on December 23, 2025 at the China General Microbiological Culture Collection Center, address: No. 3, No. 1, Beichen West Road, Chaoyang District, Beijing) was classified and named. Riemerella anatipestiferUsing strain 1 as a template, primers up-F / R (CCTATTCTCTTATTATCAACATTACCTACTGA, SEQ ID NO.3; GGCAATTTCTTTTTTGTCATATTGTAAAGATAAGTTTGATACTGTTAACATATAG, SEQ ID NO.4; product 964bp) and down-F / R (CATCCTTCGTAGAAGAGTAAAAAGGATAATGACAATAGGAA, SEQ ID NO.5; AAGAGATTCATAATCTACAGTTTCTAGCTTT, SEQ ID NO.6; product 956bp) were used to amplify the product. yheS The upstream and downstream homologous arms of the gene were obtained. Then, using Riemerella anatipestifer ATCC11845 (carrying the erythromycin resistance gene ERMF) as a template (Erm-F: ATGACAAAAAAGAAATTGCCCG, SEQ ID NO.7; Erm-R: TTACTCTTCTACGAAGGATGAAATTTTTCAGGG, SEQ ID NO.8; product 791bp), the obtained upstream and downstream homologous arm fragments were combined with the erythromycin fragment by overlap PCR to obtain the homologous fragment with resistance.

[0028] yheS

[0029] yheS protein: MLTVSNLSLQFGKRVLFDEVNIKFTKGNCYGIIGANGAGKSTFLKILSGKQDPTTGNVSLEPGKRMSVLEQDHFAYDQYTVLETVLRGNKKLFEIKEEMDALYAKPDFSDEDGIKAGELGVIYDEMGGWNAEADAQTMLSNVGIKEDMHYQVMSELENKDKVRVLLAQALFGSPDVLILDEPTNDLDIDTISWLEDFLADYENTVIVVSHDRHFLDAVCTHIGDLDYSKLNLYTGNYSFWYQASQLATKQRQQANKKAEEKKKELQEFIARFSSNVAKAKQATARKKMLDKLNIEDIKPTSRRYPAIIFEQEREAGDQILEIKDLEKTKDGELLFSGINLNLKKGDKVAVLSKNSLAITEFFQIISGNSKADKGSYQWGVTTSQSYMPLDNTEFFQEDINLVDWLRQFTKNDEERHEEYMRGFLGKMLFSGDEALKSCRVLSGGEKMRCMFSRMMLQRANILLLDEPTNHLDLESITTLNNSLVAFKGTLLLASHDHEMLETVCNRIIELTPKGIIDRHMTYDEYLQDKKVKELRQQMYS, SEQ ID NO.2.

[0030] Following the natural transformation method described by Liu M et al. (Use of Natural Transformation To Establish an Easy Knockout Method in Riemerella anatipestifer. Appl Environ Microbiol. 2017;83(9):e00127-17. Published 2017 Apr 17. doi:10.1128 / AEM.00127-17), RACL-1 was cultured to the logarithmic growth phase. 1 μg of the fusion fragment was added to 200 μL of the logarithmic phase bacterial culture and incubated at 37°C for 1 h. The culture was then diluted and spread onto erythromycin-resistant GCB solid medium (containing 15 g peptone, 1 g corn starch, 4 g K₂HPO₄, 1 g KH₂PO₄, 5 g NaCl, and 12 g agar per liter). The medium was incubated at 37°C with 5% CO₂. After single colonies emerged, primer ID-F / R (TACCCACATCTTTCATCTTCT, SEQ ID) was used. NO.9; ACGATACCTCCACAAACACTT, SEQ ID NO.10; Product 2608bp) Validation (see appendix) Figure 1 (A), due to yheS Genes were Erm The gene was replaced, and the amplified fragment of the ID primer changed from 2608 bp to 1809 bp, proving that the gene-deleted strain was successfully constructed, and the gene-deleted strain RACL-1 was obtained. ΔyheS .

[0031] Complementary strains were constructed using a binding transfer method: amplification was performed using primers CE-F / R (ATGCATTGGCTGCAGGTCGACTACCCACATCTTTCATCTTCTTACTCC, SEQ ID NO.11; ATGATGATGATGATGCTCGAGTTAAGAGTACATCTGTTGTCTTAGTTCTTTT, SEQ ID NO.12; product 2022bp). yheS A complete open reading frame was obtained, and then cloned into the pLMF03 plasmid (pLMF03 plasmid purchased from Wuhan Miaoling Biotechnology Co., Ltd. (catalog number P53004)) using the Beyotime Seamless Cloning Kit. The complement plasmid pLMF03-yheS was then plasmidized and transformed into E. coli S17-1 lamp pir (Beijing Huayueyang Biotechnology Co., Ltd.) as the donor bacterium. The gene-deleted strain RACL-1 was used as the donor. ΔyheSAs recipient bacteria, donor and recipient bacteria in logarithmic phase were mixed at a 4:1 ratio and incubated in TSA medium lined with nitrocellulose membrane. The resulting culture was then transferred to erythromycin- and ampicillin-resistant TSA plates. The reintroduced strains were validated by PCR using references P3 and P4 (ATCATCGGTGCTAATGGTGC, SEQ ID NO. 13; TCTAAGTCGTTGGTAGGCTCGT, SEQ ID NO. 14; product 470bp) (see Appendix). Figure 1 (B) The results showed that only wild-type strains and complement strains were identified. yheS Gene fragments indicate that the complement strain was successfully constructed, and gene complement strain C was obtained. ΔyheS .

[0032] Validated using qPCR technology yheS Genes in RACL-1 ΔyheS strains and their C ΔyheS The expression level in cDNA was determined. The specific procedure is as follows: First, RNA was extracted from each bacterial strain using the bacterial RNA extraction kit from Beijing Adson Biotechnology Co., Ltd. (product number RN63). After reverse transcription to generate cDNA, qPCR was performed using primers P7 and P8 (AAAGACGGAGAGCTACTGTTCT, SEQ ID NO.15; GACTGTGAAGTGGTTACGCC, SEQ ID NO.16; product 170bp) to finally determine the expression level. yheS Gene expression levels.

[0033] qPCR method detection yheS Gene expression in different strains: no gene expression was detected in the deleted strains, but it was detected in the complemented strains. yheS Gene expression indicates that the deletion strain and the complement strain were successfully constructed (see appendix). Figure 2 ).

[0034] Example 2: Riemerella anatipestifer gene deletion strain RACL-1 ΔyheS and gene complementation strain C ΔyheS Performance testing 1. Growth curve determination Wild-type Riemerella anatipestifer RACL-1 and gene-deleted strain RACL-1 were used. ΔyheS and gene complementation strain C ΔyheS The cultures were inoculated into TSB liquid medium and cultured overnight. The overnight cultures were then transferred 1:100 to fresh TSB medium and incubated at 37°C with shaking at 180 rpm. OD values ​​were measured every hour. 600nm The value was continuously monitored for 15 hours. This experiment was independently repeated three times.

[0035] The results showed that, compared with RACL-1 and C ΔyheS In comparison, RACL-1 ΔyheS The growth rate was significantly inhibited, indicating that yheS Genes influence the growth of Riemerella anatipestifer (see appendix) Figure 3 ).

[0036] 2. Metal ion determination growth curve Wild-type Riemerella anatipestifer RACL-1 and gene-deleted strain RACL-1 were used. ΔyheS and gene complementation strain C ΔyheS The cultures were inoculated into TSB liquid medium and cultured overnight. The overnight cultures were then transferred at a 1:100 ratio to TSB, TSB+DIP (2,2'-bipyridine, 50 mM), and TSB+DIP (50 mM) + various metal ion media (50 mM FeSO4, 1 mM MnCl2, 400 mM ZnSO4, 200 mM CuCl2, 1 mM NiCl2). OD values ​​were measured every 5 hours. 600nm Value, continuously monitored for 10 hours.

[0037] The results showed that, after adding 50 mM DIP to the culture medium, compared with the wild-type strain and the gene-restored strain, the gene-deleted strain RACL-1... ΔyheS The growth of [a specific organism] was significantly inhibited, while this inhibition was weakened by the addition of FeSO4; however, the addition of other metal cations did not have a significant impact. This indicates [the following]. yheS Genes play a crucial role in iron uptake and participate in YA iron ion transport (see appendix). Figure 4 ).

[0038] 3. Stress tolerance test Each bacterial culture in the logarithmic phase was transferred to 5 mM H2O2 and incubated at 37°C for 15 min (oxidative stress), in pH 4 physiological saline at 37°C for 30 min (acid stress), in pH 10 physiological saline at 37°C for 1 h (alkali stress), and in PBS at 42°C for 30 min (heat stress). After incubation, bacterial counts were performed using droplets. The survival rate was calculated as: (number of bacteria after stress / number of bacteria before stress) × 100%.

[0039] The results showed that yheS The gene deletion did not affect the survival of *Rimerella anatipestifer* under oxidative stress, alkaline stress, heat stress, or in serum, but it did affect its survival under acid stress (see Appendix). Figure 5 (Chinese AD).

[0040] 4. Serum viability test Following the method described by Huang M et al. (Functional characterization of Fur in iron metabolism, oxidative stress resistance and virulence of Riemerella anatipestifer. VetRes. 2021;52(1):48. Published 2021 Mar 19. doi:10.1186 / s13567-021-00919-9), the viability of each strain in goose serum was determined. Serum was collected from 2-week-old goslings that had not been vaccinated against RA or had not experienced RA infection (RA antibody negative). The serum was filtered through a 0.22 μm filter membrane for sterilization, and RACL-1 and RACL-1 in the logarithmic phase were separated. ΔyheS Adjust the bacterial solution to 10 5 CFU / ml was added in equal proportions of uninactivated serum, serum inactivated at 56℃ for 30 min, and PBS, and incubated at 37℃ for 30 min. Bacterial counts were performed before and after incubation.

[0041] The results showed that yheS The deletion of the gene did not affect its sensitivity in goose inactivated and non-inactivated serum (see Appendix). Figure 5 (E).

[0042] 5. Electron microscopy observation The morphology of each bacterial strain was observed using scanning electron microscopy (SEM) and transmission electron microscopy (TEM). RA cultures in the logarithmic growth phase were collected and washed twice with phosphate-buffered saline (PBS, pH 7.2). The cell pellet was fixed overnight at 4°C with 2.5% glutaraldehyde. The samples were then prepared into ultrathin sections and observed under the control of a Hitachi SU-8100 SEM system. For TEM detection, the treated bacterial samples were mixed with 2% phosphotungstic acid for negative staining, added to a copper retina membrane, and observed under a Hitachi HT-7800 transmission electron microscope.

[0043] The results showed that, due to yheS The deletion of the gene causes the bacterial morphology to change from short rods to elongated rods, resulting in a change in bacterial morphology (see appendix). Figure 6 ).

[0044] 6. Antibiotic susceptibility testing Following the method described by Zhang X et al. (Contribution of RaeB, a Putative RND-Type Transporter to Aminoglycoside and Detergent Resistance in Riemerella anatipestifer. Front Microbiol. 2017;8:2435. Published 2017 Dec 8. doi:10.3389 / fmicb.2017.02435), RACL-1 and RACL-2 were determined using the broth dilution method according to CLSI standards. ΔyheS The minimum inhibitory concentration (MIC) was determined. 100 μL / well of TSB medium was pre-added to a 96-well plate. After adding the antibiotic to the first well, subsequent wells were diluted 2-fold, with 20 μL added to each well. 5 CFU / mL bacterial culture was incubated at 37℃ with CO2 for 24 hours.

[0045] The results are shown in Table 1. Compared with the wild-type RACL-1 strain, RACL-1 ΔyheS The deletion strain showed increased sensitivity to polymyxin B, spectinomycin, and chloramphenicol, but no significant change in sensitivity to gentamicin and ampicillin.

[0046] Table 1. Effects of different antibiotics on RACL-1 and RACL-2 ΔyheS MIC value of strain

[0047] 7. Bacterial adhesion and invasion The adhesion and invasion assay of bacteria in goose embryo fibroblasts was performed according to the method of Hu Q et al. (OmpA is a virulencefactor of Riemerella anatipestifer. Vet Microbiol. 2011;150(3-4):278-283. doi:10.1016 / j.vetmic.2011.01.022). 10 5 Goose embryo fibroblast cells were seeded into 24-well plates. After the wells were confluent, dead cells were washed away with PBS. RACL-1 strain and RACL-1... ΔyheS Infect cells with a fold increase of 100, incubate at 37°C with CO2 for 1.5 h, then wash three times with PBS to remove unattached bacteria. Add 0.25% trypsin and incubate at 37°C with CO2 for 10 min. Collect the cell suspension and dilute it 10-fold on TSA plates for counting.

[0048] Adhesion rate = Number of bacteria after incubation / Number of bacteria infecting the well. Relative survival rate = KO adhesion rate / mean WT adhesion rate, where KO represents the gene-deleted strain RACL-1. ΔyheS WT represents the wild-type strain RACL-1.

[0049] Intrusion Experiment: 10 5 Goose embryo fibroblast cells were seeded into 24-well plates. After the wells were confluent, dead cells were washed away with PBS. RACL-1 strain and RACL-1... ΔyheS Cells were infected with a fold increase of 100, incubated at 37°C with CO2 for 1.5 h, washed three times with PBS, added DMEM containing 100 ug / ml gentamicin, incubated at 37°C with CO2 for 1 h and then discarded. The cells were washed three times with PBS, added 0.25% trypsin and incubated at 37°C with CO2 for 10 min. The cell suspension was then collected for bacterial counting.

[0050] Invasion rate = Number of bacteria after incubation / Number of bacteria infecting the well Relative survival rate = KO invasion rate / WT mean invasion rate.

[0051] The results showed that yheS The deletion of genes reduces the cell's ability to adhere and invade (see appendix). Figure 7 ).

[0052] Example 3: Riemerella anatipestifer gene deletion strain RACL-1 ΔyheS and gene complementation strain C ΔyheS animal testing One-week-old goslings were purchased from a goose farm in Qinhuangdao City. After oral and cloacal tests showed negative results for Riemerella anatipestifer, they were fed with routine care for one week before the experiment was conducted.

[0053] 1. Determination of median lethal dose (LD50): To evaluate wild-type RACL-1 and gene deletion strain RACL-1 ΔyheS To assess the toxicity, goslings were randomly divided into 14 groups of 8 each, and logarithmic RACL-1 and RACL-1 were collected from each group. ΔyheS The bacterial culture was centrifuged, washed twice with PBS, and then diluted to 6.7 × 10⁻⁶. 2 -6.7×10 7 CFU / ml, challenged with intramuscular injection in the leg, 0.5ml per animal; blank control group injected with an equal volume of PBS. Mortality was recorded for one week, and LD50 was calculated using the modified Kohl's method.

[0054] From RACL-1 group, RACL-1 ΔyheS One goose was randomly selected from each of the PBS and PBS groups. On the fourth day after the viral challenge, heart, liver, spleen, and brain tissues were collected, fixed with 4% paraformaldehyde, and sent to a biotechnology company for HE staining (see Appendix). Figure 8 ).

[0055] The results (see Table 2) show that the LD50 of the wild type is 3 × 10⁻⁶. 4 No deaths were observed in the CFU group, gene deletion group, and control group, indicating a more than 1000-fold decrease in virulence. yheS The deletion of the gene reduces the virulence of RA; comparisons of in vivo colonization show that RACL-1 ΔyheS Its ability to colonize the body is significantly lower than that of the wild type (see appendix). Figure 9 ).

[0056] Table 2. RACL-1 and RACL-1 in two-week-old goslings ΔyheS LD50 determination

[0057] 2. Organ bacterial load determination: Two-week-old goslings were randomly divided into two groups, with 10 4 CFU was injected intramuscularly into the leg. At 24h, 48h, 72h, and 96h of infection, three sterile animals from each group were randomly selected, and their liver, brain, and spleen were ground and inoculated onto TSA plates. After 24h of culture, the bacteria were counted.

[0058] The results showed that the RACL-1 ΔyheS deletion strain had a significantly weaker proliferation capacity in geese than the wild-type strain. In the liver, spleen, and brain tissues, the bacterial load of the deletion strain remained at a low level, indicating that the yheS gene may be involved in the colonization and proliferation of this bacterium in geese.

[0059] 3. Immunization test (see appendix for immunization procedure) Figure 10 (A) Intramuscular injection immunization test: Two-week-old goslings were randomly divided into 8 groups of 8 birds each. Groups 1-6 were treated with PBS to adjust RACL-1 levels. ΔyheS The bacterial concentration is 2×10 2 -2×10 7 CFU / ml, 0.5ml / animal intramuscular injection in the leg, followed by injection of RACL-1 strain 10 oz 14 days later. 7 CFU / animal, as the challenge group after immunization, Group 7 was directly injected with RACL-1 strain 10 7 CFU was used as the direct challenge group, while group 8 was the control group, which was injected with only an equal amount of PBS.

[0060] Oral immunization test: Goslings were randomly divided into two groups of 8 each, and RACL-1 was adjusted. ΔyheS bacterial concentration, one group at 10 5 CFU was administered orally to one group, while another group received an equal volume of PBS orally. 14 days after immunization, the other group was injected with 10 μg of RACL-1 strain. 7 CFU / each.

[0061] Blood samples were collected at 7, 14, 21, and 28 days after infection with the deletion strain for subsequent antibody level detection experiments. Antibody levels in experimental goslings were measured according to the method described by Liu M et al. (Roles of B739_1343 in iron acquisition and pathogenesis in Riemerella anatipestifer CH-1 and evaluation of the RA-CH-1ΔB739_1343 mutant as anattenuated vaccine. PLoS One. 2018;13(5):e0197310. Published 2018 May 30. doi:10.1371 / journal.pone.0197310). The experimental groups were observed for 14 consecutive days, and mortality was recorded for each group. Simultaneously, the levels of PBS and RACL-1 were monitored. ΔyheS Weight changes in the challenge group. Immunoprotection rate = Mortality rate / Total number × 100%.

[0062] The results showed that when RACL-1 was administered via intramuscular injection, ΔyheS The bacterial suspension immunization dose reached 0.5 ml. 10 4 At concentrations above CFU / ml, the immune protection rate can reach 100%, while the PBS group died within 7 days (see appendix). Figure 10 (B). Immunization is administered orally at a dose of 10. 5 Oral administration of CFU at the same dose can also achieve 100% immune protection (see appendix). Figure 10 (C)

[0063] Collect samples from the intramuscular injection immunization group (10) 5 Serum samples from the CFU group and the PBS group at 7, 14, 21, and 28 days were analyzed using indirect ELISA to detect RA-specific antibody levels, RACL-1. ΔyheS It can induce geese to produce specific antibodies, which remain at a high level after 21 days (see appendix). Figure 10 (D). Determination of RACL-1 ΔyheS The body weight of geese in the immunized group and the PBS control group was monitored for 30 consecutive days. There was no significant difference in body weight between the immunized group and the PBS group (see Appendix). Figure 10 (E).

[0064] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.

[0065] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. yheS The application of genes in regulating the virulence of Riemerella anatipestifer is characterized by, The yheS The amino acid sequence encoded by the gene is shown in SEQ ID NO.

2.

2. As described in claim 1 yheS The application of genes in regulating the virulence of Riemerella anatipestifer is characterized by, The yheS The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

3. As described in claim 1 or 2 yheS The application of genes in regulating the virulence of Riemerella anatipestifer is characterized by, Lower the yheS The expression level of the gene reduces the virulence of Riemerella anatipestifer; enhances the... yheS Gene expression increases the virulence of Riemerella anatipestifer.

4. yheS The application of genes in regulating the immunogenicity of Riemerella anatipestifer is characterized by, The yheS The amino acid sequence encoded by the gene is shown in SEQ ID NO.2, and the downregulation of the... yheS Gene expression increases the immunogenicity of Riemerella anatipestifer.

5. As described in claim 4 yheS The application of genes in regulating the immunogenicity of Riemerella anatipestifer is characterized by, The yheS The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

6. Riemerella anatipestifer yheS The application of gene-deleted strains in the preparation of Riemerella anatipestifer vaccine is characterized by, The duck plague Riemerella yheS The process of constructing gene-deleted strains is as follows: S1. Amplify using primers SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5, SEQ ID NO.6 respectively. yheS The upstream and downstream homologous arms of the gene were obtained, and then the erythromycin resistance gene ERMF was amplified using primers SEQ ID NO.7 and SEQ ID NO.

8. The obtained upstream and downstream homologous arm fragments were combined with the erythromycin resistance fragment by overlapping PCR to obtain the homologous fragment carrying the resistance. S2. Riemerella anatipestifer was cultured to the logarithmic growth phase. The culture solution in the logarithmic growth phase was then co-incubated with a homologous fragment carrying resistance. The fragment was then diluted and spread onto erythromycin-resistant GCB solid medium and cultured at 37°C with 5% CO2. This confirmed the successful construction of the gene-deleted strain, yielding the gene-deleted strain ΔyheS.