NK cell exosome capable of targeted killing of lung cancer and preparation method thereof
By extracting and knocking out the PD-1 gene from umbilical cord blood NK cells and combining it with efficient purification technology, high-purity PD-1LNK-EXO was prepared, which solved the purity and targeting problems of NK cell exosomes in lung cancer treatment and achieved efficient and safe lung cancer treatment.
Patent Information
- Application Number
- CN202610113315.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-28
- Publication Date
- 2026-06-05
AI Technical Summary
The current methods for obtaining NK cell-derived exosomes suffer from limited sources, low extraction purity, insufficient enrichment of functional proteins, and unclear targeting functions, which limit their application in lung cancer treatment.
By extracting exosomes from NK cells derived from umbilical cord blood, knocking out the PD-1 gene using CRISPR-Cas9 technology, and combining IL-21-induced differentiation with ultra-high-speed centrifugation and size exclusion chromatography purification, high-purity PD-1 knockout NK cell exosomes (PD-1LNK-EXO) containing granzyme and perforin were prepared to achieve targeted killing of lung cancer.
The prepared PD-1LNK-EXO significantly prolonged the survival of a mouse model of lung cancer, reduced tumor size, and had clear lung cancer targeting and specific killing functions, with high safety and low toxicity.
Smart Images

Figure CN122146600A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of cell exosomes and tumor immunotherapy, specifically to an NK cell exosome capable of targeting and killing lung cancer and its preparation method. Background Technology
[0002] Lung cancer is one of the leading causes of cancer-related deaths worldwide, with non-small cell lung cancer (NSCLC) accounting for approximately 85% of cases. Current clinical treatments include chemotherapy, targeted therapy, and immunotherapy, but these still face challenges such as poor targeting, high toxicity, and easy drug resistance.
[0003] Natural killer (NK) cells, as key effector cells of the innate immune system, can directly recognize and kill tumor cells, showing significant potential in lung cancer immunotherapy. Especially in the tumor microenvironment, PD-1 / PD-L1 signaling can inhibit NK cell function. The combined application of NK cells and PD-1 immune checkpoint inhibitors is hailed as a powerful anti-tumor combination. However, adoptive therapy based on living NK cells faces challenges such as susceptibility to inhibition by the tumor microenvironment, difficulties in storage and transportation, and significant batch-to-batch variability.
[0004] Exosomes are extracellular vesicles with a diameter of approximately 30-150 nm, possessing good biocompatibility, excellent tissue penetration, and natural targeting properties, making them ideal drug delivery carriers. NK cell-derived exosomes (NK-EXO) not only inherit the recognition and killing capabilities of their parent cells but also exhibit advantages such as high stability and low immunogenicity, representing an emerging strategy for anti-tumor therapy. However, current technologies for obtaining NK cell-derived exosomes still face challenges such as limited cell sources, low extraction purity, insufficient enrichment of functional proteins, and unclear characteristic and targeting functions, thus limiting their clinical application. Therefore, there is an urgent need to develop a method for preparing NK cell exosomes with abundant sources, high extraction purity, and clearly defined targeted killing functions. Summary of the Invention
[0005] The purpose of this invention is to provide an NK cell exosome capable of targeting and killing lung cancer and its preparation method. By extracting and characterizing exosomes with lung cancer-targeting killing function from NK cells derived from umbilical cord blood, the application of these exosomes in anti-lung cancer drugs is verified. This aims to solve the problems of limited sources, poor safety and stability, and insufficient targeting in existing NK cell therapies, and to achieve high-purity, high-activity, and low-toxicity targeted therapy for lung cancer.
[0006] To achieve the above objectives, the following technical solution is adopted: A method for preparing NK cell exosomes capable of targeting and killing lung cancer includes the following steps: (1) Fresh umbilical cord blood was collected and CBMCs and upper plasma were separated. (2) Construct a lentivirus-loaded CRISPR-Cas9-PD-1 knockout recombinant plasmid, and co-transfect 293T cells with the packaging plasmid psPAX2, the envelope plasmid pMD2.G and the recombinant plasmid. Collect the viral supernatant 48-72 hours after transfection, filter it through a 0.45μm filter membrane, and concentrate it by ultracentrifugation to obtain the viral solution. Infect CBMCs with the obtained viral solution, and then perform puromycin drug screening to obtain transfected CBMCs. (3) Differentiation culture: CBMCs were mixed with serum-free NK cell induction medium containing IL-21, upper plasma and pretreated feeder cells for culture; (4) Centrifuge and change the medium on day 3 of culture. On days 4-6, supplement with NK cell culture medium containing 5% upper plasma according to the cell status. On day 7, the cell concentration is 0.8-1.0×10⁻⁶. 6 Cells / ml, add 1% supernatant plasma and continue culturing; maintain cell concentration at 1.0-2.0 × 10⁶ cells / ml on days 8-12. 6 NK cells / ml were collected on days 13-15 during the logarithmic growth phase, and CD3+ cells were collected by flow cytometry. - CD56 + cell; (5) Take the CD3 purified by flow cytometry as described above. - CD56 + Centrifuge the NK cell supernatant, and concentrate the supernatant through a tangential flow filtration system with a molecular weight cutoff of 100 kDa. Collect the concentrate. (6) Centrifuge the concentrate obtained in step (5), collect the precipitate, purify the exosomes by size exclusion method, and collect the elution fraction to finally obtain the purified NK cell exosomes.
[0007] Furthermore, the method for constructing the virus delivery PD-1 low expression vector in step (2) is as follows: The method for constructing the CRISPR-Cas9-PD-1 knockout recombinant plasmid is to clone the PD-1-targeting sgRNA oligonucleotide pair into the lentiCRISPRv2 vector digested with BsmBI, then transform it into Stbl3 competent cells, extract the plasmid, and verify it by sequencing. The sequence of the sgRNA oligonucleotide pair is 5'-TGGGATGACGTTACCTCGTGGTTTTAGAGCTAGAAATAGCAA GTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAGTGGCACCGAGTCGGTGC-3'.
[0008] Furthermore, in step (3), the concentration of IL-21 is 10~30 ng / mL.
[0009] Furthermore, in step (5), the centrifugation parameters are 4°C, 300×g for 15 minutes, and the resulting supernatant is centrifuged again at 4°C, 2000×g for 20 minutes; the concentration factor is 10 times.
[0010] Furthermore, the centrifugation parameters in step (6) are 4℃, 100000×g, and centrifugation for 90 minutes.
[0011] An NK cell exosome prepared by the above method, wherein the NK cell exosome has PD-1 knocked out and contains granzyme B, perforin and FasL.
[0012] The aforementioned NK cell exosomes can be used to prepare anti-lung cancer drugs.
[0013] Furthermore, the lung cancer in question is non-small cell lung cancer.
[0014] The beneficial effects of this invention are as follows: This invention utilizes NK cells derived from umbilical cord blood stem cells, and rapidly induces umbilical cord blood stem cells to transform into CD3+ cells via IL-21. - CD56 + NK cells differentiated and matured, and then were efficiently purified by tandem ultracentrifugation and size exclusion chromatography to obtain NK cell exosomes (PD-1 knockout NK cells containing NK cell functional killing substances including granzyme, perforin, and FasL). L NK-EXO). The NK cell exosome PD-1 constructed in this invention. L NK-EXO treatment significantly prolonged the survival of a mouse model of lung cancer and reduced tumor size, while also demonstrating clear lung cancer targeting and specific killing functions. More importantly, this invention discovered that PD-1 knockout of NK cell exosomes (PD-1...) H NK-EXO is crucial for the targeting and killing of tumors. Attached Figure Description
[0015] Figure 1 Directed induction culture and identification of umbilical cord blood NK cells; (A) lentivirus construction of PD-1 high expression vector; (B) lentivirus construction of PD-1 knockout vector; (C) NK cell directed induction culture process; (D) NK cell flow cytometry identification: CD56, CD3; (E) NK exosome extraction process and electron microscopy identification.
[0016] Figure 2 Identification of NK exosomes; where (A) NK exosome particle size; (BC) PD-1 H NK-EXO, PD-1 L Zeta potential of NK-EXO; (D) Western blot analysis of PD-1H NK-EXO, PD-1 L Protein expression was identified using NK-EXO.
[0017] Figure 3 For PD-1 H NK-EXO, PD-1 L NK-EXO's inhibitory and killing effects on A549 (human lung cancer cells); among which (A) CCK8 assay for PD-1 H NK-EXO, PD-1 L Cytotoxic effects of NK-EXO on A549 cells, *compared to untreated control group; #compared to PD-1 H Compared to the NK-EXO group, n=3; (B) PD-1 H NK-EXO, PD-1 L Apoptosis of cells after co-culturing NK-EXO and DOX with A549 for 12 h; (C) Quantitative graph of apoptotic cells.
[0018] Figure 4 Results of fluorescently labeled NK-EXO and mouse in vivo imaging; where (A) shows A549 cells with DIO-labeled PD-1. H NK-EXO and PD-1 L Results of incubation with NK-EXO (50 μg, green) for 4 hours, scale bar 25 μm; (B) PD-1 H NK-EXO, PD-1 L NK-EXO's tumor-targeting effect in mice; (C) PD-1 injection H NK-EXO, PD-1 L Distribution of NK-EXO in major organs and tumors 24 hours later; (D)PD-1 H NK-EXO, PD-1 L Distribution of average radiance values at different time points after NK-EXO injection.
[0019] Figure 5 The effects of in vivo injection of NK exosomes on tumor-bearing mice; (A) Schematic diagram of treatment in a BALB / c nude mouse model with subcutaneous A549 cell xenograft tumor model, iv is intravenous injection; sc is subcutaneous injection (n=3); (B) Using PD-1 H NK-EXO, PD-1 L Tumor growth curves after NK-EXO, DOX, and PBS treatment (n=3); (C) Tumor growth curves after PBS and PD-1 treatment. H NK-EXO and PD-1 L Tumor size after NK-EXO treatment; (D) Using PD-1 HNK-EXO, PD-1 L (a) Survival rate of mice after treatment with NK-EXO, DOX and PBS (n=3); (e) Body weight of mice in each group during treatment (n=3).
[0020] Figure 6 The results of the safety evaluation of NK exosomes are shown; (A) HE staining images of major organs of mice after sacrifice in each group; (B) Statistical graphs of AST, ALT, ALP, BUN and LDH in each group of mice. Detailed Implementation
[0021] The technical solutions of the present invention will be described in detail below through exemplary embodiments. However, these embodiments should not be construed as limiting the scope of protection of the present invention. All technologies implemented based on the above content of the present invention are covered within the scope of protection intended by the present invention.
[0022] Unless otherwise stated, all raw materials and reagents described in the examples are commercially available products.
[0023] Example 1
[0024] 1. PD-1 knockout from umbilical cord blood (PD-1 knockout) L ) and high expression (PD-1) H NK cell induction culture (1) Autologous plasma separation: Fresh blood was centrifuged at 2500 rpm for 10 min, and the upper light yellow plasma was collected. 8% calcium gluconate injection was added to a 50 ml centrifuge tube, mixed well, and then inactivated in a 56 ℃ water bath for 30 min. Then, the plasma was centrifuged at 2500 rpm for 10 min to remove the precipitate. The upper plasma was transferred to a new centrifuge tube and stored in a 4 ℃ refrigerator for later use.
[0025] (2) Isolation of cord blood mononuclear cells (CBMCs): Dilute the blood cell layer with physiological saline at a ratio of 1:1 and mix well. Add the mixture to a centrifuge tube containing 12 ml of lymphocyte separation medium (SolarBio, P8900), taking care not to disrupt the interface between the lymphocyte separation medium and the liquid. Centrifuge at 800×g for 20 minutes. Aspirate the intermediate leukocyte layer, wash twice with PBS (pH=7.2-7.4) and count the cells. Centrifuge at 350×g for 10 minutes, discard the supernatant, collect the cell pellet, resuspend the pellet, and count the cells to obtain purified cord blood mononuclear cells (CBMCs) for later use.
[0026] (3) Construction of PD-1 knockout and high-expression CBMCs using lentiviruses: VectorBee was used to design lentivirus delivery vectors for PD-1 knockout and high expression, which simultaneously contained the drug screening gene puromycin and the green fluorescent protein EGFP. Lentiviral production and purification were carried out. The vector structure is shown in [reference needed]. Figure 1 A and Figure 1B, specifically divided into three stages: 1) First Stage: Plasmid Construction. The PD-1 knockout vector is constructed by cloning a designed PD-1-targeting sgRNA oligonucleotide (5'-TGGGATGACGTTACCTCGTGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC-3') into a BsmBI-digested lentiCRISPRv2 vector, transforming it into Stbl3 competent cells, extracting the plasmid, and performing sequencing verification. The PD-1 overexpression vector is constructed by cloning the full-length CDS sequence of PD-1 into the multiple cloning site of a lentiviral overexpression vector (such as pCDH) via enzyme digestion and ligation or homologous recombination, and also requires sequencing verification. After sequencing verification, PD-1 knockout recombinant transfer plasmids and PD-1 overexpression recombinant transfer plasmids are obtained, respectively. This embodiment does not describe the specific construction steps in detail; those skilled in the art should refer to the relevant documentation. Figure 1 A and Figure 1 The construction of this vector can be completed by obtaining the vector diagram of B.
[0027] 2) Second stage: Virus production employed the classic three-plasmid system, namely the packaging plasmid psPAX2, the envelope plasmid pMD2.G, and the two recombinant transfer plasmids prepared in step 1), transfected into 293T cells at a mass ratio of 1.5:0.5:1. Viral supernatant was collected 48-72 hours post-transfection, filtered through a 0.45 μm filter, and then concentrated by ultracentrifugation as needed for experiments. The viral genome titer (TU / mL) was quantified using qPCR, which is fundamental for determining the multiple of infection (MOI) in subsequent experiments.
[0028] 3) Third stage: Infection and validation (using CBMCs as target cells), CBMCs (3-5 × 10⁻⁶ cells) were infected. 7CBMCs were seeded in 30 ml of serum-free NK cell induction medium containing 20 ng / ml IL-21. Activated CBMCs were infected with viruses of different MOIs (e.g., 5, 10, 20, 50), with polybrene (final concentration 4-8 μg / mL) added to enhance infection efficiency. 6-12 hours post-infection, the medium was replaced with fresh serum-free NK cell induction medium containing 20 ng / ml IL-2 (purchased from Corning Incorporated). After 72 hours, the initial expression of the target gene (PD-1) was observed by Western blotting. Cells with an infection efficiency of over 70% and in good condition were selected for puromycin screening. The optimal screening concentration was determined by the complete death of untransfected CBMCs within 2-3 days, and the cell number in the transfected group no longer decreasing. CBMCs obtained through screening were used for subsequent formal experiments.
[0029] (4) Differentiation culture: Take 3-5 × 10⁻⁶ of each of the two types of CBMCs prepared in step 3). 7 1000 NK cells were inoculated with 30 ml of serum-free NK cell induction medium containing 20 ng / ml IL-21 (purchased from Corning Incorporated), 1.5 ml of autologous plasma (the upper plasma prepared in step (1)), and 5 × 10⁻⁶ cells. 5 Mixed trophoblast cells (Biocorner (Xiamen) Technology Co., Ltd.) that have been irradiated to a lethal dose, and placed in a 75cm container. 2 Incubate in culture flasks at 37°C in a 5% CO2 incubator.
[0030] (5) Expanded culture: On day 3, centrifuge the cell suspension in the culture flask, discard the supernatant, and resuspend the cell pellet in 30 ml of fresh serum-free NK cell induction medium containing 20 ng / ml IL-21 + 1.5 ml of supernatant plasma for continued culture; on days 4-6, supplement with NK cell culture medium containing 5% supernatant plasma (Corning Incorporated) according to the cell status; on day 7, count and adjust the cell concentration to 0.8-1.0 × 10⁻⁶ cells / year. 6 Cells / ml, add 1% supernatant plasma; maintain cell concentration at 1.0-2.0×10⁻⁶ cells / ml on days 8-12. 6 cells / ml; NK cells in the logarithmic growth phase were collected on days 13-15. Two CD3+ cells were collected by flow cytometry. - CD56 + Cells, confirming NK cell purity >90% ( Figure 1 D).
[0031] 2. Extraction of NK exosomes (1) Take the two CD3 groups purified by flow cytometry as described above.- CD56 + Centrifuge the NK cell supernatant at 300×g for 15 minutes at 4°C and discard the precipitate (to remove dead cell precipitate from the supernatant). Centrifuge the supernatant again at 2000×g for 20 minutes at 4°C and discard the precipitate (to remove live cells from the supernatant). Retain the supernatant for subsequent processing.
[0032] (2) The supernatant after step (1) is concentrated by passing it through a tangential flow filtration (TFF) system with a molecular weight cutoff of 100 kDa, and the concentrate is collected.
[0033] (3) Centrifuge the concentrate obtained in step (2) at 4°C, 100000×g for 90 minutes, discard the supernatant, and resuspend the precipitate in PBS.
[0034] (4) Exosomes were purified using a clearFirst-3000 protein purification system via size exclusion. Solution preparation: 20% ethanol, PBS (pH=7.2-7.4), pure water, filtered through a 0.22μm aqueous membrane at 100% power, sonicated for 40 minutes, and pre-cooled at 4℃. The instrument was rinsed with 50ml of pure water, and the pre-packed column was connected after the baseline stabilized. The pre-packed column was rinsed with 10 column volumes of pure water, and then equilibrated with 10 column volumes of PBS. After the UV detection baseline stabilized, 6ml of exosomes was aspirated using a 10ml sterile syringe and loaded at a flow rate of 2ml / min. After loading, PBS was continued, and the sample entered the column bed, eluting according to particle size and molecular weight. Larger particles and molecules eluted first. The eluted fraction was collected and stored at 4℃ for later use, yielding the final purified NK cell exosomes, specifically PD-1... L NK-EXO (PD-1 knockout NK cell exosomes) and PD-1 H NK-EXO (NK cell exosomes with high PD-1 expression).
[0035] The obtained exosomes were further characterized as follows: (1) The concentration of purified exosomal protein was determined by BCA method, and the concentration was 5 mg / ml.
[0036] (2) The morphology of exosomes was observed using transmission electron microscopy, and they exhibited a cup-shaped structure. Figure 1 E).
[0037] (3) Nanoparticle tracking analysis detected a particle size distribution between 30-150 nm, with a negative Zeta potential. Figure 2 AC).
[0038] (4) Western blot analysis of exosome markers CD9 and CD63 showed that PD-1 HNK-EXO can stably express PD-1 protein. L NK-EXO does not express PD-1 protein, and PD-1 L NK-EXO and PD-1 H NK-EXO molecules all contain NK cell functional killing-related effector molecules such as granzyme B, perforin, and FasL. Figure 2 D).
[0039] This embodiment employs a purification process combining ultracentrifugation and size exclusion chromatography, which significantly reduces lipoprotein contamination and improves the purity and functional protein enrichment of target exosomes compared to ultracentrifugation alone.
[0040] Example 2
[0041] This embodiment further verifies PD-1 L NK-EXO and PD-1 H The application of NK-EXO in lung cancer treatment involves the detection of cytotoxic components, cytotoxic function, apoptosis induction function, cellular uptake assay, safety and toxicology testing, antitumor activity testing, and targeting detection. The specific experimental steps are as follows: (1) Western blot detection of cytotoxic components: After quantification of exosomes by BCA, 5× loading buffer was added by volume to dilute to 1×, and denatured at 100 °C for 10 min. After electrophoresis by 12% SDS-PAGE and transfer to PVDF membrane, the membrane was blocked with 5% skim milk at room temperature for 2 h, and primary antibodies β-actin, PD-1, FsaL, Perforin, Granzyme B, Cleaved-PARP, Cleaved-Caspase-3, and Cleaved-Caspase-8 were added. The membrane was incubated overnight at 4 °C, washed with TBST, and then secondary antibody (1:8000 dilution) was added and incubated at room temperature for 2 h. The surface was covered with ECL chemiluminescent solution, washed with TBST, and the membrane was imaged and developed using a gel imaging system. The gray values of the protein bands were analyzed using ImageJ.
[0042] (2) Cell-killing function test: A549 cells were seeded at a density of 5000 cells / well in 96-well plates. After overnight cell adhesion, the cells were treated with different concentrations of PD-1. L NK-EXO (20~300μg / mL) and PD-1 HNK-EXO (20–300 μg / mL) was co-cultured at 37 °C and 5% CO2 for 12 and 24 h, with a negative control group (no exosomes). After culture, 10 μL of CCK-8 solution was added to each well, and the mixture was incubated at 37 °C for 2 h. The absorbance (OD) was measured at 450 nm using a microplate reader after incubation. 450 ), calculate the survival rate of co-cultured cells relative to negative control group cells.
[0043] (3) Apoptosis induction function test: A549 cells were inoculated at 5×10 5 Cells were seeded at a density of 100 cells / well in 6-well plates. After overnight adhesion, the cells were seeded with PD-1. L NK-EXO (100μg / ml), PD-1 H NK-EXO (100 μg / ml) and DOX (5 μg / ml) were co-cultured for 12 h, with a control group (no treatment). After co-culture, cells were collected and resuspended in 500 μL binding buffer (Dalian Meilun Biotechnology). The resuspended cells were then stained with 5 μL Annexin V-FITC and incubated with 10 μL PI staining solution in the dark at room temperature for 15 min. Within 2 hours, the stained cells were analyzed using a cell sorting flow cytometer.
[0044] (4) Cell uptake assay: A549 cells were incubated at 5 × 10⁻⁶ cells per day. 4 Cells were seeded at a density per well on confocal dishes, and resuspended PD-1 cells were labeled with the green fluorescent dye DIO according to the manufacturer's instructions (Dalian Meilun Biotechnology). L NK-EXO and PD-1 H NK-EXO was then added to an exosome purification column to elute and remove free dye, and DIO-labeled PD-1 was added. L NK-EXO and PD-1 H NK-EXO (50 μg) was co-incubated with A549 cells at 37°C for 4 h. After incubation, cells were washed three times with PBS and stained with DAPI to observe the nuclei. PD-1 cells were observed using a confocal laser scanning microscope. L NK-EXO and PD-1 H Cellular uptake of NK-EXO.
[0045] (5) Antitumor activity assay: A549 cells were cultured in DMEM high glucose medium (Dalian Meilun Biotechnology, MA0212-Sep-26K), 5% CO2, at 37℃. Cell pellets were collected by centrifugation and counted, and 5×10⁻⁶ cells were taken. 5A549 cells were diluted with 200 μL of PBS and subcutaneously inoculated into the right thigh of nude mice (n=3). Tumor volume and weight were measured every 2 days, and the tumor volume was calculated as V = 0.5 × a × b. 2 Where V = tumor volume, a = longitudinal diameter, and b = transverse diameter. When the tumor volume reaches approximately 50 mm... 3 Mice were randomly divided into different groups to receive the drug. PD-1 was administered to each group. L NK-EXO (5mg / ml, PBS), PD-1 H NK-EXO (5 mg / ml, PBS), DOX (5 mg / kg, PBS), and PBS were administered intravenously at 100 μL each to BALB / c nude mice every 2 days for a total of 6 cycles. Body weight and survival rate were monitored in each group during treatment. The tumor volume in the PBS group reached approximately 1000 mm². 3 At that time, all mice were euthanized.
[0046] (6) Safety and toxicology testing: After euthanizing the mice in step (5), their heart, liver, spleen, lung, kidney, and tumor tissues were collected. All tissue sections were fixed in 10% formalin buffer for histological analysis. Serial sections (4µm thick) embedded in paraffin were stained with hematoxylin and eosin (H&E) to observe pathological changes. In addition, blood was collected from the eyeballs 24 h after administration in step (5) to analyze PD-1. L NK-EXO (5mg / ml), PD-1 H Effects of NK-EXO (5 mg / ml) and DOX on AST, ALT, ALP, BUN and LDH levels in mouse liver.
[0047] (7) Targeted detection: PD-1 L NK-EXO, PD-1 H NK-EXO was fluorescently labeled according to the DIR dye instructions (Dalian Meilun Biotechnology). After labeling, the product was thoroughly washed with an exosome purification column to remove unbound free DIR dye, yielding pure DIR-labeled PD-1. L NK-EXO and PD-1 H NK-EXO. Nude mice with an established A549 subcutaneous xenograft model were injected via tail vein. Each mouse received 100 μL of DIR-labeled PD-1 via tail vein injection. L NK-EXO and PD-1 H The distribution of exosomes was observed using an IVIS® instrument 24 hours after NK-EXO suspension (PBS system) injection.
[0048] Experimental results are as follows Figures 3-6 As shown, cell proliferation experiments indicate that PD-1 L NK-EXO vs PD-1H NK-EXO exhibits better in vitro inhibitory activity against A549 cells and induces apoptosis. Figure 3 ).
[0049] Laser confocal scanning microscopy revealed that PD-1 knockout exosomes can enhance the uptake of exosomes by tumor cells. Figure 4 A) Green fluorescence was observed in the cytoplasm near the nucleus and on the cell membrane of cells labeled with DAPI (blue), indicating PD-1. L NK-EXO group vs. PD-1 H The significantly increased green fluorescence area in the NK-EXO group indicates that PD-1 knockout facilitates the uptake of NK-EXO by A549 cells. Therefore, PD-1 knockout promotes NK cell exosome targeting of tumors. In vivo imaging in small animals further confirms this. Figure 4 B) PD-1 L NK-EXO can rapidly accumulate in the tumor tissue area after injection and maintain this effect for more than 24 hours, while PD-1... H The fluorescence intensity of NK-EXO was significantly lower than that of PD-1. L NK-EXO fluorescence signal disappeared after 24 hours. Imaging of major organs of mice in each group was performed 24 hours later. Figure 4 C), the results showed PD-1 L NK-EXO was enriched in the spleen and tumor sites of mice, and its fluorescence intensity was significantly higher than that of PD-1. H NK-EXO analyzes the cumulative image data of the acquired tumor sites and calculates the distribution of average radiance values. Figure 4 D), the results showed that PD-1 was 8 hours after injection. L NK-EXO exhibited the highest fluorescence intensity, which gradually decreased thereafter. In summary, these results indicate that PD-1… L NK-EXO vs PD-1 H NK-EXO has better targeting of tumors.
[0050] PD-1 L NK-EXO and PD-1 H The therapeutic effects of NK-EXO on tumors are shown in [reference needed]. Figure 5 Compared with the PBS control group and the DOX group, PD-1 L NK-EXO and PD-1 H NK-EXO treatment significantly prolonged survival and reduced tumor size in mice, with little impact on body weight. Of particular note is PD-1... L NK-EXO's effect is better than PD-1 H The NK-EXO group significantly improved ( Figure 5 B~D).
[0051] Finally, the pathological results showed PD-1 L NK-EXO treatment did not cause significant physiological changes in the heart, liver, spleen, lungs, and kidneys, and caused minimal liver and kidney damage in mice. Figure 6 A). There were no significant differences in AST, ALT, ALP, BUN, and LDH levels compared to the control group. Figure 6 B) is also lower than the value of the DOX group.
[0052] In summary, this invention has discovered PD-1 knockout NK cell exosomes (PD-1 L NK-EXO is crucial for the targeting and killing of tumors.
[0053] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made within the scope of the claims of the present invention should be included in the scope of the present invention.
Claims
1. A method for preparing NK cell exosomes capable of targeted killing of lung cancer, characterized in that: Includes the following steps: (1) Fresh umbilical cord blood was collected and CBMCs and upper plasma were separated. (2) Construct a lentivirus-loaded CRISPR-Cas9-PD-1 knockout recombinant plasmid, and co-transfect 293T cells with the packaging plasmid psPAX2, the envelope plasmid pMD2.G and the recombinant plasmid. Collect the viral supernatant 48-72 hours after transfection, filter it through a 0.45μm filter membrane, and concentrate it by ultracentrifugation to obtain the viral solution. Infect CBMCs with the obtained viral solution, and then perform puromycin drug screening to obtain transfected CBMCs. (3) Differentiation culture: The CBMCs obtained in step (2) were mixed with serum-free NK cell induction medium containing IL-21, upper plasma and pretreated feeder cells and cultured at 37°C and 5% CO2. (4) Centrifuge and change the medium on day 3 of culture. On days 4-6, supplement with NK cell culture medium containing 5% upper plasma according to the cell status. On day 7, the cell concentration is 0.8-1.0×10⁻⁶. 6 Cells / ml, add 1% supernatant plasma and continue culturing; maintain cell concentration at 1.0-2.0 × 10⁶ cells / ml on days 8-12. 6 NK cells / ml were collected on days 13-15 during the logarithmic growth phase, and CD3+ cells were collected by flow cytometry. - CD56 + cell; (5) Take the CD3 purified by flow cytometry as described above. - CD56 + Centrifuge the NK cell supernatant, and concentrate the supernatant through a tangential flow filtration system with a molecular weight cutoff of 100 kDa. Collect the concentrate. (6) Centrifuge the concentrate obtained in step (5), collect the precipitate, purify the exosomes by size exclusion method, and collect the elution fraction to finally obtain the purified NK cell exosomes.
2. The preparation method according to claim 1, characterized in that: The method for constructing the CRISPR-Cas9-PD-1 knockout recombinant plasmid in step (2) is as follows: PD-1-targeting sgRNA oligonucleotide pairs are cloned into the lenti-CRISPR v2 vector digested with BsmBI, then transformed into Stbl3 competent cells, the plasmid is extracted, and sequenced for verification. The sequence of the sgRNA oligonucleotide pair is 5'-TGGGATGACGTTACCTCGTGGTTTTAGAGCTAGAAATAGCAA GTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAGTGGCACCGAGTCGGTGC-3'.
3. The preparation method according to claim 1, characterized in that: In step (3), the concentration of IL-21 is 10~30 ng / mL.
4. The preparation method according to claim 1, characterized in that: In step (5), the centrifugation parameters are 4℃, 300×g for 15 minutes, and the resulting supernatant is then centrifuged at 4℃, 2000×g for 20 minutes.
5. The preparation method according to claim 1, characterized in that: In step (6), the centrifugation parameters are 4℃, 100000×g, and centrifugation for 90 minutes.
6. An NK cell exosome prepared by the preparation method according to any one of claims 1 to 5.
7. The NK cell exosomes according to claim 6, characterized in that: The NK cell exosomes were PD-1 knocked out and contained granzyme B, perforin, and FasL.
8. The use of NK cell exosomes as described in claim 6 in the preparation of anti-lung cancer drugs.
9. The application according to claim 8, characterized in that: The lung cancer in question is non-small cell lung cancer.