Application of OsHAK13 gene in regulating drought tolerance of rice

By knocking out the OsHAK13 gene in rice and using the CRISPR/Cas9 system, the problem of insufficient drought-resistant gene resources in rice was solved, significantly enhancing the drought resistance of rice and providing important breeding materials.

CN122146769APending Publication Date: 2026-06-05SHANGHAI AGROBIOLOGICAL GENE CENT
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610546351.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-23
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

Existing technologies have limited resources of drought-resistant genes in rice, making it difficult to effectively improve the drought resistance of rice.

Method used

By knocking out the OsHAK13 gene using gene editing technology to reduce its expression level or inhibit its protein activity, and using the CRISPR/Cas9 system to knock out the OsHAK13 gene in rice, a loss-of-function mutant was obtained, which enhanced the drought resistance of rice.

Benefits of technology

It significantly improved the drought resistance of rice seedlings, providing important genetic resources and breeding materials for the cultivation of new water-saving and drought-resistant rice varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122146769A_ABST
    Figure CN122146769A_ABST
Patent Text Reader

Abstract

The application discloses OsHAK13 Application of a gene in regulating drought tolerance of rice relates to the technical field of genetic engineering. OsHAK13 The gene encodes an amino acid sequence as shown in SEQ ID NO. 2. OsHAK13 By knocking out the gene through a gene editing technology, a functional loss mutant is obtained, which shows significant enhancement of drought tolerance at a seedling stage. The gene and the mutant can be applied to genetic improvement of crop drought resistance, and provide important gene resources and breeding materials for cultivation of new water-saving and drought-resistant rice varieties, and have important theoretical significance and application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and more specifically to... OsHAK13 Application of genes in regulating drought resistance in rice. Background Technology

[0002] Drought is one of the major abiotic stress factors limiting crop growth, development, and yield formation. Rice ( Oryza sativa Rice (L.) is a staple crop with enormous water requirements, accounting for over 65% of total agricultural water use, and is particularly sensitive to drought stress. Drought stress not only inhibits the vegetative and reproductive growth of rice but also leads to decreased photosynthesis, accumulation of reactive oxygen species, and increased membrane lipid peroxidation, ultimately resulting in sharp yield reductions or even crop failure. Over long-term evolution, plants have developed a complex set of mechanisms to respond to and adapt to drought stress, including changes in morphology (such as root system optimization and stomatal regulation) and physiological and biochemical responses (such as the accumulation of osmotic regulatory substances, activation of antioxidant enzyme systems, and hormone signal transduction). These processes are synergistically regulated by multifunctional and regulatory genes. In recent years, with the development of functional genomics, a large number of drought-related transcription factors (such as AP2 / ERF, NAC, and bZIP family members) and functional protein genes have been cloned and identified, providing important gene resources for the genetic improvement of crop drought resistance. However, the known gene resources are still limited.

[0003] Therefore, identifying and demonstrating key drought-resistant genes in rice, elucidating their mechanisms of action, and creating new drought-resistant germplasm through genetic engineering or molecular breeding are technical problems that urgently need to be solved by those skilled in the art. Summary of the Invention

[0004] This invention provides OsHAK13 Application of genes in regulating drought resistance in rice. Our laboratory has identified a large number of candidate genes for rice drought resistance using phenomics, transcriptomics, and other methods. Among these, candidate genes encoding potassium transporters were analyzed. OsHAK13 Studies have shown that this gene negatively regulates drought resistance in rice.

[0005] To solve the above-mentioned technical problems, this application adopts the following technical solution:

[0006] reduce OsHAK13 Application of gene expression levels in improving drought resistance in rice, wherein the OsHAK13 gene encodes the amino acid sequence shown in SEQ ID NO.2.

[0007] As a preferred technical solution, the OsHAK13 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0008] As a preferred technical solution, the OsHAK13 The amino acid sequence encoded by the gene mutant is shown in SEQ ID NO.4, SEQ ID NO.5, or SEQ ID NO.6; OsHAK13 The nucleotide sequences of the gene mutants are shown in SEQ ID NO.16, SEQ ID NO.17, or SEQ ID NO.18.

[0009] More preferably, the rice variety is Zhonghua 11.

[0010] Another object of the present invention is to provide the application of inhibiting the activity of OsHAK13 protein in improving the drought resistance of rice, wherein the OsHAK13 protein has the amino acid sequence shown in SEQ ID NO.2.

[0011] Another object of the present invention is to provide a reduction OsHAK13 Application of biomaterials with high gene expression levels in improving drought resistance in rice, wherein the biomaterial is any one of the following: A. Expression cassettes that can suppress the OsHAK13 gene; B. A recombinant vector containing the expression cassette described in A; C. Recombinant microorganisms containing the expression cassette described in A or the recombinant vector described in B.

[0012] Another object of the present invention is to provide a method for cultivating drought-resistant rice germplasm, the method being by... OsHAK13 The gene editing target sequence was recombined into the pCRISPR / Cas9 gene editing vector, and the transformed rice cells were then cultured into plants. The target sequence is shown in SEQ ID NO.3; OsHAK13 The amino acid sequence encoded by the gene is shown in SEQ ID NO.2.

[0013] Beneficial effects: This invention discloses OsHAK13 A novel function of a gene in negatively regulating drought tolerance during rice seedling stage. This was achieved by knocking out the gene using gene editing technology. OsHAK13 The gene, whose loss-of-function mutants exhibited significantly enhanced drought resistance during the seedling stage, can be applied to the genetic improvement of crop drought resistance, providing important genetic resources and breeding materials for the development of new water-saving and drought-resistant rice varieties, and has significant theoretical and practical value. Attached Figure Description

[0014] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0015] Picture 1 for OsHAK13 Identification of gene knockout mutants, including ZH11: wild-type rice (Zhonghua 11). hak13- 1 , hak13-2 and hak13-3 They are respectively OsHAK13 Gene knockout rice mutant.

[0016] Picture 2 For the present invention OsHAK13 A comparison of seedling drought tolerance between gene knockout rice mutants and wild-type rice was conducted. Picture 2 A represents soil drought stress. hak13 Phenotypes of mutant rice plants and wild-type seedlings; Picture 2 B represents the survival rate of hak13 mutant rice plants and wild-type plants under soil drought stress; ZH11: wild-type rice (Zhonghua 11). hak13-1 , hak13-2 and hak13-3 : OsHAK13 Gene knockout rice mutant. Detailed Implementation

[0017] To facilitate understanding of the present invention, a more complete description of the invention will be given below with reference to embodiments, of which preferred embodiments are provided. However, the invention can be implemented in many different forms and is not limited to the embodiments described herein. These embodiments are provided to provide a thorough and complete understanding of the disclosure of the invention. It should be understood that experimental methods not specifically described in the following embodiments are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. All commonly used reagents used in the embodiments are commercially available products.

[0018] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0019] Example 1 OsHAK13 Obtaining gene knockout rice mutants 1. OsHAK13 Construction of CRISPR / Cas9 knockout vectors (1) According to OsHAK13 The CDS sequence of the gene (SEQ ID NO.1) (corresponding amino acid sequence is shown in SEQ ID NO.2) was used to select the gene editing target, and the selected gRNA target was determined to be AGGAACCTTGTAAGGAGTCG (SEQ ID NO.3). Based on this target, primers for the OsU6a- target and the gRNA target were designed and synthesized. Using pYLsgRNA-OsU6a / LacZ plasmid (Molecular Plant. 2015 8(8):1274-1284.) as a template, and with primers F (AGGAACCTTGTAAGGAGTCGCGGCAGCCAAGCCAGCA, SEQ ID NO.4) and gR-R (CGGAGGAAAATTCCATCCAC, SEQ ID NO.5), UF (CTCCGTTTTACCTGTGGAATCG, SEQ ID NO.6) and R (CGACTCCTTACAAGGTTCCTGTTTTAGAGCTAGAAAT, SEQ ID NO.7) as primers, the OsU6a-target fragment and gRNA-target fragment were amplified in two reaction systems, as shown in Tables 1 and 2, respectively. PCR reactions were performed using KOD plus polymerase, with 25 cycles: 94 ℃ for 10 s, 58 ℃ for 15 s, and 68 ℃ for 20 s. PCR products were detected by electrophoresis.

[0020] The reaction system used is as follows: Table 1

[0021] Table 2

[0022]

[0023] MDVEGGGGGGGGAPPRGRNSWGWQKGTLLLAYQSFGVVYGDLCISPVYVYKNTFSGKLRLHEEDEEILGVLSLVFWSLTLIPLLKYIILVLGADDNGEGGTFALYSLLCRNSKMGLLNNMRANHGSLSAYNKEEPCKESRNSMLIKAFFEKHYSLRVVLLLFVLMGTSMVIGDGVLTPTMSVLAAVSGLRIKFPELHENYTVLLACVILIGLFALQHYGTRRVGFLFAPILISWLTCIGGIGIYNIIKWNPSVIRALSPYYIYNFFRKAGKDGWSSLGGIVLCLTGAEAMFADLGHFSKLSLRLGFTIVVYPCLVLAYMGEAAYLSKHREDLQSSFYKALPDRVFWPVLFIATLATAVGSQAIISATFSIISQCRALGCFPRIKVVHTSSHVHGQIYIPEVNWVLMSLCLAVTIGFRDTEMIGNAYGLAVILVMCATTCLMFLVITTVWNRWVVWAAAFTVVFGSVELLYLSACLAKVPHGGWLPLLLSLTTLLVMSTWHYGTAMKQQHEVQNKVCLDHFLGLSSGIGLVRVPGVGFVYSSTTNGVPPMFAHFVTNFPAFHRVLIFVSLQTLAVPKVSPEERFLVGRIGSPANRLFRCIVRYGYKEGRWDHFNFENQLLMKVVEFLRHQDGSGGGGGDRMSAAASGEDEAMSVIPATSSSGGSNQHAFDAGTTTSSCEIDATAGGGGRRKVRFDNDGGGGGEEEEEAAEVKELMEEKEAGVSYMIGHTCVFAHESSSAVKKFAVNVVYGFLRRNSRRPAVVLGIPHTSLIEVGMAYRV ,SEQ ID NO.2。

[0024] (2) Take 1 µL of each of the two PCR products from the first round as templates, and perform a second round of PCR using primers U-GAL (ACCGGTAAGGCGCGCCGTAGTGCTCGACTAGTATGGAATCGGCAGCAAAGG, SEQ ID NO.8) and Pgs-GAR (TAGCTCGAGAGGCGCGCCAATGATACCGACGCGTATCCATCCACTCCAAGCTCTTG, SEQ ID NO.9). The PCR reaction uses KODplus polymerase, with 30 cycles: 94 ℃ for 10 s, 58 ℃ for 15 s, and 68 ℃ for 20 s. Detect by gel electrophoresis, cut the gel and recover the product, which is the gRNA expression cassette.

[0025] The reaction system used in the second round of PCR is as follows: Table 3

[0026] (3) Recombinant ligation of gRNA expression cassette with pYLCRISPR / Cas9 Pubi-H: Linearization of the pYLCRISPR / Cas9Pubi-H vector: Digest 2 µg of the pYLCRISPR / Cas9Pubi-H vector with 20 U Bsa I in 50 μl of solution for approximately 30 min. Electrophoresis was performed on 2 µL (80 ng) of the digested vector to confirm the excised ccdB band.

[0027] Prepare the recombination reaction system according to Table 4, and carry out the recombination reaction at 37℃ for 30 min. After the reaction, directly perform transformation, screen positive clones by plating on LB plates containing kanamycin, and pick positive clones the next day for inoculation. Perform PCR detection and sequencing analysis using 1300F / 1300R primers (1300F: GTCGTGCTCCACATGTTGACCG, SEQ ID NO.10; 1300R: CCGACATAGATGCAATAACTTC, SEQ ID NO.11). Select the identified positive clones for plasmid extraction, and use the obtained plant expression vector plasmid DNA for rice genetic transformation.

[0028] Table 4

[0029] 2. Agrobacterium-mediated transformation (1) Preparation of Agrobacterium tumefaciens (EHA105) competent cells: Agrobacterium tumefaciens culture was incubated at 28°C until OD 600When the concentration of the bacterial cell was 0.5, the cells were collected by centrifugation at 4°C, resuspended in 500µL of 0.1mol / L ice-bath CaCl2, centrifuged for 30 min, the supernatant was discarded, and the cells were resuspended in 100µL of 0.1mol / L ice-bath CaCl2 and stored at 4°C.

[0030] (2) Agrobacterium transformation, using the freeze-thaw method: Add 5 µL of the plant expression vector plasmid DNA prepared in step 1 to 100 µL of Agrobacterium competent cells, mix gently, incubate in an ice-water bath for 30 min, and then freeze-shock in liquid nitrogen for 2 min; add 400-800 µL of YEP culture medium (containing kanamycin, Kan); culture at 28℃ with shaking at 200 r / min for 3-5 h; centrifuge at room temperature (5000 r / min, 5 min), retain 100 µL of supernatant to resuspend the cells, spread on LB solid medium (containing Kan), and incubate upside down at 28℃ for 2 days until colonies of suitable size grow. Select single clones for PCR detection to obtain positive strains.

[0031] 3. Callus induction: Rinse the seeds of rice variety Zhonghua 11 with sterile water for 15-20 minutes, then disinfect with 75% ethanol for 1 minute, followed by shaking disinfection with 1.5% sodium hypochlorite solution for 20 minutes. Finally, rinse five times with sterile water. Pat the washed seeds dry with absorbent paper and inoculate them into callus induction medium. Incubate in the dark at 25°C for 2 weeks.

[0032] Callus induction medium: The induction medium in Table 6 was used. 0.3 g proline, 0.6 g hydrolyzed casein, 30 g sucrose and 2.5 mL 2,4-D (concentration 1 mg / mL) were added to prepare a 1 L solution. The pH was adjusted to 5.9, 7 g agar powder was added, and the solution was autoclaved at high temperature.

[0033] 4. Subculture: Cut off the embryogenic callus tissue, inoculate it into the subculture medium, and culture it in the dark at 25°C for 2 weeks.

[0034] Subculture medium: The subculture medium in Table 6 was used. 0.5 g proline, 0.6 g hydrolyzed casein, 30 g sucrose and 2 mL 2,4-D (concentration 1 mg / mL) were added to prepare a 1 L solution. The pH was adjusted to 5.9, 7 g agar powder was added, and the solution was autoclaved.

[0035] 5. Agrobacterium infection and callus co-culture: After transforming Agrobacterium in step 2, pick positive single colonies and incubate them overnight at 28°C in 1 mL of Agrobacterium culture medium (containing kanamycin); take the above culture and add it to 50 mL of Agrobacterium culture medium (containing kanamycin), and incubate at 28°C until OD reaches 0.5. 600=0.6-1.0. Centrifuge the obtained Agrobacterium tumefaciens bacterial culture, add the collected bacterial cells to the suspension culture medium, and incubate with shaking for 30 min until OD reaches 0.6-1.0. 600 =0.6-1.0. Then, the callus tissue was placed in a suspension culture medium containing Agrobacterium tumefaciens and cultured with shaking for about 20 min. After shaking culture, the callus tissue was dried on sterile filter paper and transferred to co-culture medium, and cultured in the dark at 25℃ for 5 days.

[0036] Suspension culture medium: Using the suspension culture medium in Table 6, add 0.08 g hydrolyzed casein, 2 g sucrose, and 0.2 mL 2,4-D (concentration 1 mg / mL) to prepare a 100 mL solution. Adjust the pH to 5.4, divide into two bottles (50 mL each), and autoclave. Before use, add 1 mL 50% glucose and 100 µL AS (100 mM).

[0037] Co-culture medium: Use the co-culture medium shown in Table 6, add 0.8 g hydrolyzed casein, 20 g sucrose and 3.0 mL 2,4-D (concentration 1 mg / mL) to prepare a 1 L solution, adjust the pH to 5.6, add 7 g agar powder, and autoclave. Before use, add 20 mL 50% glucose and 1 mL AS (100 mM).

[0038] 6. Screening culture: After co-culturing for 3 days, select good callus tissues, transfer them to screening culture medium, and incubate in the dark at 25℃ for 2 weeks, and screen twice.

[0039] Screening medium: Using the screening medium in Table 7, add 0.6 g hydrolyzed casein, 30 g sucrose and 2.5 mL 2,4-D (concentration 1 mg / mL) to prepare a 1 L solution, adjust the pH to 6.0, add 7 g agar powder, and autoclave. Before use, add 1 mL Hn and 1 mL Cn (100 ppm).

[0040] 7. Differentiation culture: Select embryogenic callus tissue and inoculate it into differentiation medium. Induce differentiation of shoots by culture at 24℃ for 16 h / 8 h light and dark (4-6 weeks).

[0041] Differentiation medium: The differentiation medium in Table 7 was prepared by adding 2.0 mg / L 6-BA, 2.0 mg / L KT, 0.2 mg / L NAA, 0.2 mg / L IAA, 1.0 g hydrolyzed casein and 30 g sucrose to make a 1 L solution. The pH was adjusted to 6.0, 7 g agar powder was added, and the solution was autoclaved at high temperature.

[0042] 8. Rooting culture: When the bud grows to about 2 cm, cut off the bud and insert it into the rooting culture medium. Induce rooting by culturing at about 25℃ for 16 h / 8 h in light and dark.

[0043] Rooting medium: Use the rooting medium in Table 7, add 30 g of sucrose to make 1 L solution, adjust the pH to 5.8, add 7 g of agar powder, and autoclave.

[0044] 9. Transgenic plant culture: After the root system is well developed, open the test tube, add sterile water to harden the seedlings for 2-3 days, then take out the plants, wash off the attached solid culture medium with sterile water, and transfer them into the soil. Initially, provide shade and shelter from the wind. After the plants are strong, carry out conventional field or greenhouse management and culture to obtain transgenic plants.

[0045] Table 5

[0046] Table 6

[0047] 10. Positive detection of CRISPR / Cas9 knockout vector transgenic rice (1) Genomic DNA extraction (crude extraction method): According to the instructions of the plant genomic DNA rapid extraction kit (Beijing TransGen Biotechnology Co., Ltd.), take leaves, cut them into pieces, add 20µL of extraction solution P1, incubate at 95℃ for 5min, centrifuge briefly, add 20µL of neutralization solution P2, and centrifuge briefly.

[0048] (2) Primers were designed based on the vector screening marker HptII (HptF: CGTTATGTTTATCGGCACTTTG, SEQ ID NO.12; HptR: TTGGCGACCTCGTATTGG, SEQ ID NO.13). PCR was performed using crude DNA as a template to detect whether the transgenic plants were positive. The DNA of most transgenic plants amplified the expected PCR products, indicating that they were positive plants.

[0049] 11. Identification of knockout targets in CRISPR / Cas9 knockout HAK13 transgenic rice Primers hak13F: TAGGAGCAGATGACAATGGAG (SEQ ID NO.14) and hak13R: ACAACACGAAGCGAGTAATGC (SEQ ID NO.15) were designed based on the knockout target. PCR was performed using crude DNA as a template, and the PCR products were sequenced. The determined sequences were then compared with the gene sequences in the wild-type (ZH11) genome. Results are attached. Picture 1 It shows that some strains ( hak13-1 , hak13-2 and hak13-3 Different numbers of bases were deleted from the target site, indicating that... OsHAK13 Knockout mutants.

[0050] mutant hak13-1

[0051] mutant hak13-2

[0052] mutant hak13-3

[0053] Example 3: Seedling drought stress phenotype of transgenic rice Will OsHAK13 Gene knockout mutants ( hak13-1 , hak13-2 and hak13-3 Seeds and wild-type (ZH11) seeds were disinfected (75% alcohol for 1 min, 1.5% NaClO for 20 min, and rinsed 5 times with sterile water), soaked, and germinated. After 2-3 days of germination, well-germinated and uniformly growing seeds were selected and transferred to small cylindrical containers containing soil for planting. The soil used in the experiment was a mixture of soil and coarse sand in a volume ratio of 2:3. Equal amounts of sand (2 kg) and water were added to each container, ensuring consistent soil compaction. The experiment was repeated three times. Watering was stopped for 7-10 days for healthy plants at the 4-leaf stage, followed by a 5-7 day watering period. Plants were photographed before and after the drought treatment, and the survival rate was assessed after rehydration. Results are attached. Picture 2 As shown, the survival rate of ZH11 was 42.9%, while the survival rate of knockout lines ranged from 68.4% to 86.9%. Compared with ZH11, the drought resistance of knockout lines was significantly increased. This indicates that this gene negatively regulates the drought resistance of rice. These results demonstrate that gene editing to knock out this gene can enhance the survival ability of rice under drought conditions.

[0054] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.

[0055] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Reduce OsHAK13 The application of gene expression levels in improving drought resistance in rice is characterized by, The OsHAK13 The gene encodes the amino acid sequence shown in SEQ ID NO.

2.

2. The application according to claim 1, characterized in that, The OsHAK13 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

3. The application according to claim 1, characterized in that, The OsHAK13 The nucleotide sequences of the gene mutants are shown in SEQ ID NO.16, SEQ ID NO.17, or SEQ ID NO.

18.

4. The application of inhibiting OsHAK13 protein activity in improving drought resistance in rice, characterized in that, The OsHAK13 protein has the amino acid sequence shown in SEQ ID NO.

2.

5. Reduce OsHAK13 The application of biomaterials with high gene expression levels in improving drought resistance in rice is characterized by, The biomaterial is any one of the following: A. capable of OsHAK13 Gene repression expression cassette; B. A recombinant vector containing the expression cassette described in A; C. Recombinant microorganisms containing the expression cassette described in A or the recombinant vector described in B.

6. A method for cultivating drought-resistant rice germplasm, characterized in that, The method will... OsHAK13 The gene editing target sequence was recombined into the pCRISPR / Cas9 gene editing vector, and the transformed rice cells were then cultured into plants. The target sequence is shown in SEQ ID NO.3; OsHAK13 The amino acid sequence encoded by the gene is shown in SEQ ID NO.2.