Synthesis of oncolytic lnp replicon rna and uses for cancer immunotherapy

By delivering IL-12 self-amplifying replicon RNA through the synthesis of oncolytic virus lipid nanoparticles, an immune response is triggered in local tumors, solving the problem of achieving systemic anti-cancer immunity in existing technologies. This enables effective inhibition of local and distant tumors and prevention of recurrence.

CN122146794APending Publication Date: 2026-06-05MASSACHUSETTS INST OF TECH +1
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
MASSACHUSETTS INST OF TECH
Filing Date
2020-01-10
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

Existing cancer treatments are unable to effectively trigger local tumor anti-cancer immune responses and achieve systemic immunity, leading to tumor recurrence and spread.

Method used

A synthetic oncolytic virus containing lipid nanoparticles and self-amplifying replicon RNA encoding IL-12 was used to trigger immunogenic cell death and activate local and systemic immune responses via intratumoral injection.

Benefits of technology

It successfully triggers the anti-cancer immune response in local tumors, inhibits in situ tumor cells and kills distant tumor cells, thus preventing tumor recurrence.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122146794A_ABST
    Figure CN122146794A_ABST
Patent Text Reader

Abstract

The present disclosure relates to synthetic oncolytic viruses comprising a lipid nanoparticle comprising one or more types of lipids and a self-amplifying replicon RNA comprising a sequence encoding an immunomodulatory molecule.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This application is a divisional application of Chinese patent application No. 202080034343.3, filed on January 10, 2020, entitled "Synthetic oncolytic LNP replicon RNA and its use in cancer immunotherapy".

[0002] Related applications

[0003] This application claims priority to U.S. Provisional Application Serial No. 62 / 815,611, filed March 8, 2019, pursuant to 35 USC § 119(e), the entire contents of which are incorporated herein by reference. Technical Field

[0004] This disclosure relates to synthetic oncolytic viruses, including lipid nanoparticles comprising one or more types of lipids and self-amplifying replicon RNA comprising sequences encoding immunomodulatory molecules. Summary of the Invention

[0005] This disclosure is based, in part, on the unexpected discovery that, upon injection at the tumor site, the synthetic oncolytic virus successfully triggered an anticancer immune response in the local tumor and achieved systemic immunity against distant tumors.

[0006] Accordingly, one aspect of this disclosure provides a synthetic oncolytic virus comprising lipid nanoparticles containing one or more types of lipids and a self-amplifying replicon RNA comprising a sequence encoding an interleukin (IL)-12 molecule. The lipid nanoparticles are capable of triggering immunogenic cell death. The IL-12 molecule is expressed by the self-amplifying replicon RNA.

[0007] The synthesized oncolytic virus comprises lipid nanoparticles. The lipid nanoparticles comprise one or more types of lipids. In some embodiments, the one or more types of lipids comprise cationic lipids. In some embodiments, the cationic lipid is N1,N3,N5-tris(3-(bis(dodecylamino)propyl)phenyl-1,3,5-tricarboxamide (TT3). In some embodiments, the lipid nanoparticles comprise TT3, 1,2-dioleoyl-sn-glycerol-3-phosphorylethanolamine (DOPE), cholesterol, and C14-PEG2000.

[0008] Furthermore, the synthesized oncolytic virus includes self-amplifying replicon RNA. In some embodiments, the self-amplifying RNA is derived from alphavirus or other group IV viruses (positive single-stranded RNA viruses, such as hepatitis C virus (HCV)). In some embodiments, the alphavirus may be Venezuelan equine encephalitis virus, Semliki Forest virus, or Sindbis virus.

[0009] In some embodiments, the self-amplifying replicon RNA includes a sequence encoding the IL-12 molecule. In some embodiments, the sequence encoding the IL-12 molecule is located in a subgenomic region of the self-amplifying replicon RNA.

[0010] In some embodiments, the self-amplifying replicon RNA comprises at least 90% identical nucleotide sequences to the wild-type (WT) replicon RNA having the sequence of SEQ ID NO:1. In some embodiments, the self-amplifying replicon RNA differs from SEQ ID NO:1 and is capable of expressing IL-12 molecules at higher levels compared to the self-amplifying replicon RNA comprising SEQ ID NO:1. In some embodiments, the ability to express higher levels of IL-12 molecules includes point mutations of G3936C and / or A4758G of SEQ ID NO:1.

[0011] In some embodiments, the self-amplifying replicon RNA further includes a serum albumin-coding sequence. In some embodiments, the self-amplifying replicon RNA further includes a lumen protein-coding sequence.

[0012] In some aspects, the self-amplifying replicon RNA includes a sequence encoding an IL-12 molecule. In some embodiments, the IL-12 molecule is selected from the group consisting of IL-12, IL-12 subunits, or mutant IL-12 molecules that retain immunomodulatory functions. In some further embodiments, the IL-12 molecule includes an IL12α subunit and / or an IL12β subunit.

[0013] In some embodiments, the lipid nanoparticles have a diameter of about 100 nm to 120 nm. In some embodiments, the lipid nanoparticles have a zeta potential of about 3 mV to 6 mV.

[0014] In some implementations, the lipids and self-amplifying replicon RNA have a mass ratio of approximately 1:2 to 2:1.

[0015] This disclosure relates at least in part to a pharmaceutical composition comprising a synthetic oncolytic virus and a pharmaceutically acceptable carrier.

[0016] In some embodiments, the pharmaceutical composition is formulated for intratumoral injection.

[0017] This disclosure relates at least in part to methods of treating cancer in subjects in need, including administering to the subject an effective amount of any synthetic oncolytic virus or a pharmaceutical composition containing a synthetic oncolytic virus.

[0018] In some implementations, the subject is a human patient who has or is suspected of having cancer. Exemplary target cancers include, but are not limited to, melanoma, breast cancer, and colon cancer.

[0019] In some embodiments, the pharmaceutical composition is administered to the subject in a single dose. In some embodiments, the pharmaceutical composition is administered to the subject via intratumoral injection.

[0020] This disclosure further includes the use of any pharmaceutical composition containing synthetic oncolytic viruses described herein for the treatment of any target disease (e.g., cancer) disclosed herein, and the use of pharmaceutical compositions including synthetic oncolytic oligonucleotides for the manufacture of medicaments for the treatment of cancer.

[0021] Details of one or more embodiments of the invention are set forth in the following description. Other features or advantages of the invention will be apparent from the following drawings and detailed descriptions of several embodiments, as well as from the appended claims. Attached Figure Description

[0022] Figures 1A-1H This is a graph showing the effects of using DOTAP, liposomes (Lipo), TT3 nanoparticles (TT3), mutant replicon RNA (RNA), DOTAP, Lipo, and TT3 nanoparticles to encapsulate mutant replicon RNA (DOTAP-mtRep, Lipo-mtRep, and TT3-mtRep), electroporation, and electroporation transfection of B16F10 cells with mutant replicon RNA (Electro-mtRep). Figure 1A This is a chart showing the viability of B16F10 cells 3 days after transfection. Figure 1B This is a graph showing GFP expression in B16F10 cells transfected with lipid nanoparticles encapsulating mutated or dead replicon RNA (deRep). Figure 1C This is a graph showing the percentage of PI+ Annexin V+ B16F10 cells that died after transfection with lipid nanoparticles or lipid nanoparticles encapsulated with replicon RNA. Immunogenic cell death induced by lipid nanoparticles or lipid nanoparticles encapsulated with replicon RNA was observed in calreticulin+ (CRT+) cells. Figure 1D ), extracellular ATP ( Figure 1E ) and HMGB1 release ( Figure 1FThe percentage is displayed. Figure 1G The diameters of lipid nanoparticles and lipid nanoparticles loaded with mutant replicon RNA are shown. Figure 1H The zeta potentials of lipid nanoparticles and lipid nanoparticles loaded with mutant replicon RNA are shown.

[0023] Figures 2A-2J This is a graph showing how mtRep and deRep trigger TLR3 signaling and induce ISGF3 complex-induced necrotic cell death. LNP-replicon RNA triggers TLR3 signaling ( Figure 2B and Figure 2E And it activates the expression of interferon-stimulated genes Stat1, Stat2, IRF9, IRF3, and cGAS. Figure 2F-2J ), but not TLR2 ( Figure 2A ), TLR7 ( Figure 2C ) or TLR9 ( Figure 2D ).

[0024] Figures 3A-3K It is a graph showing how TT3-mtRep recruits immune cells and causes tumor growth to regress. Figure 3A The results showed that mtRep recruited more Ly6clo Ly6G+ granulocytes 3 days after injection. Figure 3B This shows the percentage of mCherry+ cells in CD45+ and CD45- cells in tumors injected with TT3-mtRep 3 days after injection. Figure 3C The expression of the ISGF3 complex (Stat1 / Stat2 / IRF9), as well as IRF3 and cGAS, was shown 1 day after TT3-mtRep injection. Figures 3D-3F The image shows the results on day 1 after TT3-mtRep injection. Figure 3D ) and the 3rd day ( Figure 3E ) and day 1 after sequential injection on day 3 ( Figure 3F Immune cells (granulocytes, M-MDSCs, monocytes, macrophages, CD4T, CD8T, NK, NKT, conventional DC1 (cDC1) and conventional DC2 (cDC2)) infiltrate TT3-mtRep in the tumor. Figure 3G-3H It showed that more cell death was induced on day 1 after three consecutive injections of TT3-mtRep. Figure 3G ), and more immune cell infiltration ( Figure 3H ), reduced tumor weight ( Figure 3I ), tumor area ( Figure 3J ) and increased CCL5 expression ( Figure 3K ).

[0025] Figures 4A-4GThis is a graph showing that TT3-mtRep, which encodes IL12-MSA or IL12-MSA-luminal protein, effectively regulates the tumor microenvironment and immune cell infiltration. Figure 4A and Figure 4B The results showed that tumors were precipitated by ELISA one and three days after TT3-mtRep injection. Figure 4A ) and serum ( Figure 4B Quantization of IFNα2 in ). Figure 4C The results showed that B16F10 cells transfected with mtRep-IL12-MSA and mtRep-IL12-MSA-luminal proteins could produce IL-12. Figure 4D This shows the IL-12 levels in tumors one and three days after a single injection of TT3-mtRep, TT3-mtRep-IL12-MSA, or TT3-mtRep-IL12-MSA-lumican. Figures 4E-4F This indicates one day after a single injection of TT3-mtRep, TT3-mtRep-IL12-MSA, or TT3-mtRep-IL12-MSA-luminal protein. Figure 4E ) and three days ( Figure 4F Immune cell infiltration in tumors. Figure 4G This shows the number of routine DC1 (cDC1) in tumor-draining lymph nodes one and three days after a single injection of TT3-mtRep, TT3-mtRep-IL12-MSA, or TT3-mtRep-IL12-MSA-luminal protein.

[0026] Figures 5A-5E This is a graph showing the synergistic anticancer effect in vivo between immunomodulatory IL12 and TT3-mtRep-induced immunogenic cell death. (Based on body weight...) Figure 5A ), serum IFNr ( Figure 5B ), tumor area ( Figure 5C ) and survival curve ( Figure 5D The changes in ) were used to assess the synergistic anti-cancer effect. Figure 5E The results showed that TT3-mtRep-IL12 treatment could prevent tumor recurrence in cured mice. Detailed Implementation

[0027] This disclosure is based in at least part on the unexpected discovery that, upon injection at a tumor site, a synthetic oncolytic virus comprising lipid nanoparticles containing one or more types of lipids and an amplifying replicon RNA including a sequence encoding an IL-12 molecule successfully triggered an anticancer immune response in the local tumor and achieved systemic immunity against distant tumors.

[0028] I. Synthetic oncolytic viruses

[0029] This disclosure relates at least in part to synthetic oncolytic viruses. As used herein, the term “synthetic” means a non-natural or engineered oncolytic virus as disclosed herein, comprising lipid nanoparticles and self-amplifying replicon RNA comprising a sequence encoding an IL-12 molecule.

[0030] In some aspects, this disclosure relates to the use of lipid nanoparticles (LNPs) capable of self-inducing immunogenic cell death to facilitate the delivery of bioactive agents (e.g., self-amplifying replicon RNA encoding the IL-12 molecule) to tumor cells.

[0031] (i) lipid nanoparticles

[0032] This disclosure relates at least in part to the delivery of bioactive molecules to cells using lipid nanoparticles. Specifically, the present invention relates to a synthetic oncolytic virus comprising an IL-12-expressing self-amplifying replicon RNA encapsulated in lipid nanoparticles, a composition thereof, and a method of treating a subject with cancer or suspected cancer using the synthetic oncolytic virus and the composition thereof.

[0033] As used herein, lipid nanoparticles (LNPs) refer to vesicles having a continuous lipid bilayer, such as spherical vesicles. Lipid nanoparticles can be used in methods for delivering therapeutic drugs to target sites. Non-limiting examples of LNPs include liposomes, biheaded amphiphilic molecules, solid lipid nanoparticles (SLNs), nanostructured lipid carriers (NLCs), and monolayer membrane structures (e.g., archaea and micelles).

[0034] As used herein, lipid nanoparticles comprise one or more types of lipids. As used herein, lipids refer to a group of organic compounds, including but not limited to fatty acid esters, and in some embodiments are characterized by being insoluble in water but soluble in many organic solvents. They are generally classified into at least three categories: (1) “simple lipids,” including fats and oils as well as waxes; (2) “complex lipids,” including phospholipids and glycolipids; and (3) “derived lipids,” such as steroids. Non-limiting examples of lipids include triglycerides (e.g., tristearate), diglycerides (e.g., glycerol docosinate), monoglycerides (e.g., glycerol monostearate), fatty acids (e.g., stearic acid), steroids (e.g., cholesterol), and waxes (e.g., hexadecyl palmitate). In some embodiments, one or more types of lipids in the LNP comprise cationic lipids.

[0035] As used herein, cationic lipids refer to any of a variety of lipid types that carry a net positive charge at a selected pH, such as physiological pH. Such lipids include, but are not limited to, N1,N3,N5-tris(3-(bis(dodecylamino)propyl)phenyl-1,3,5-tricarboxamide (TT3), N-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP); liposomes; 1,2-dilinoleoxy-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinoleenooxy-N,N-dimethylaminopropane (DLenDMA), bis(octadecyldimethylammonium) (DODMA), and distearate dimethyl... Ammonium (DSDMA), N,N-dienyl-N,N-dimethylammonium chloride (DODAC); N-(2,3-dienoxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA); N,N-distearate-N,N-dimethylammonium bromide (DDAB); 3-(N-(N',N'-dimethylaminoethane)-carbamoyl)cholesterol (DC-Chol) and N-(1,2-dimyristoxypropyl-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide (DMRIE).

[0036] In some embodiments, the cationic lipid is TT3. As used herein, TT3 is capable of forming lipid nanoparticles for delivering various bioactive agents into cells. Furthermore, this disclosure demonstrates that unloaded TT3-LNPs can induce immunogenic cell death (ICD) in cancer cells in vivo and in vitro. As described herein, immunogenic cell death refers to a form of cell death that can induce an effective immune response by activating dendritic cells (DCs) and subsequently activating a specific T cell response. In some embodiments, the cells undergoing immunogenic cell death (ICD) are tumor cells. Immunogenic tumor cell death can trigger an effective antitumor immune response. In some embodiments, the synthetic oncolytic virus comprises TT3-LNP encapsulating a self-amplifying replicon RNA (TT3-LNP-replicon RNA) encoding only a reporter gene. The self-amplifying replicon RNA can work synergistically with TT3-LNP to induce higher levels of ICD in tumor cells compared to using TT3-LNP alone. In other embodiments, the synthetic oncolytic virus comprises TT3-LNP encapsulating a self-amplifying replicon RNA encoding an IL-12 molecule. IL-12 is an immunomodulatory cytokine that can trigger an effective immune response against local tumors. In addition, the combination of TT3-LNP, self-amplifying replicon RNA and IL-12 expression can not only effectively and synergistically inhibit in situ tumor cells, but also trigger a systemic anti-tumor immune response, kill distant tumor cells and prevent tumor recurrence.

[0037] In some embodiments, the cationic lipid is DOTAP. As used herein, DOTAP can also form lipid nanoparticles. DOTAP can be used for the efficient transfection of DNA, including yeast artificial chromosomes (YAC), into eukaryotic cells for transient or stable gene expression, and is also suitable for the efficient transfer of other negatively charged molecules, such as RNA, oligonucleotides, nucleotides, ribonucleoprotein (RNP) complexes, and proteins into mammalian cell research samples.

[0038] In other embodiments, the cationic lipid is a liposome. As used herein, liposomes are a common transfection reagent, manufactured and marketed by Invitrogen, for use in molecular and cell biology. They are used to improve the efficiency of transfecting RNA (including mRNA and siRNA) or plasmid DNA into in vitro cell cultures via lipid transfection. Liposomes contain lipid subunits that can form liposomes or lipid nanoparticles in an aqueous environment, thereby capturing transfection payloads, such as self-amplifying replicon RNA. Because neutral colipids mediate the fusion of liposomes with the cell membrane, RNA-containing liposomes (with a positive charge on their surface) can fuse with the negatively charged plasma membrane of living cells, allowing nucleic acid cargo molecules to cross the cell membrane for replication or expression.

[0039] In some embodiments, the LNP is primarily composed of cationic lipids along with other lipid components. These typically include other lipid molecules belonging to, but not limited to, the phosphatidylcholine (PC) class (e.g., 1,2-distearyl-sn-glycerol-3-phosphocholine (DSPC) and 1,2-dioleoyl-sn-glycerol-3-phosphoethanolamine (DOPE), sterols (e.g., cholesterol), and polyethylene glycol (PEG)-lipid conjugates (e.g., 1,2-distearyl-sn-glycerol-3-phosphoethanolamine-N-[folic acid (PEG)-2000 (DSPE-PEG2000) and 1,2-dimyristoyl-sn-glycerol-3-phosphoethanolamine-N-[methoxy (PEG)-2000 (C14-PEG2000)). Table 1 shows the formulations of two LNPs, TT3-LNP, and DOTAP-LNP.

[0040] Table 1:

[0041]

[0042] The particle size of lipid nanoparticles (LNPs) can affect drug release rate, biodistribution, mucosal adhesion, cellular water uptake, buffer exchange within the nanoparticles, and protein diffusion. In some embodiments, the diameter of LNPs ranges from 30 nm to 150 nm. In some embodiments, the diameter of LNPs ranges from 100 nm to 120 nm. In some embodiments, the diameter of LNPs can be 30 nm, 40 nm, 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, 100 nm, 101 nm, 102 nm, 103 nm, 104 nm, 105 nm, 106 nm, 107 nm, 108 nm, 109 nm, 110 nm, 111 nm, 112 nm, 113 nm, 114 nm, 115 nm, 116 nm, 117 nm, 111 nm, 119 nm, or 120 nm.

[0043] The zeta potential is a measure of the effective charge on the surface of lipid nanoparticles. The magnitude of the zeta potential provides information about particle stability. In some embodiments, the zeta potential of LNPs ranges from -10 mV to 25 mV. In some embodiments, the zeta potential of LNPs ranges from 3 mV to 6 mV. In some implementations, the zeta potential of the LNP can be 3mV, 3.1mV, 3.2mV, 3.3mV, 3.4mV, 3.5mV, 3.6mV, 3.7mV, 3.8mV, 3.9mV, 4mV, 4.1mV, 4.2mV, 4.3mV, 4.4mV, 4.5mV, 4.6mV, 4.7mV, 4.8mV, 4.9mV, 5mV, 5.1mV, 5.2mV, 5.3mV, 5.4mV, 5.5mV, 5.6mV, 5.7mV, 5.8mV, 5.9mV, and 6mV.

[0044] This disclosure relates at least in part to encapsulating replicon RNA with lipid nanoparticles. In some embodiments, the mass ratio of LNP to replicon RNA is in the range of 1:2 to 2:1. In some embodiments, the mass ratio of LNP to replicon RNA may be 1:2, 1:1.5, 1:1.2, 1:1, 1.1:1, 1.2:1, 1.3:1, 1.4:1, 1.5:1, 1.6:1, 1.7:1, 1.8:1, 1.9:1, and 2:1. In some embodiments, the mass ratio of LNP to replicon RNA may be 1:1.

[0045] (ii) Self-amplifying replicon RNA

[0046] In this disclosure, self-amplifying replicon RNA encoding the IL-12 molecule under a subgenomic promoter replaces the structural proteins required for viral replication, which is of great significance in cancer immunotherapy. As used herein, the term "self-amplifying replicon RNA" refers to a self-replicating genetic element comprising RNA that replicates from a replication origin. The terms "replicon RNA" and "self-amplifying replicon RNA" are used interchangeably herein. In some embodiments, the self-amplifying replicon RNA is a viral replicon.

[0047] Viruses are small pathogens that can only replicate within living host cells (e.g., prokaryotic and eukaryotic cells). Outside of living cells, viruses exist as independent particles (e.g., viral particles or virion particles) containing genetic material in the form of DNA or RNA, which can be single-stranded or double-stranded. Viruses carrying DNA are called DNA viruses, and those carrying RNA are called RNA viruses. In some cases, viruses include nucleic acid-associated proteins, and the combination of virus and nucleic acid-associated proteins is called nucleoprotein. In addition to genetic material, viruses have a single or double protein coat, also called a capsid, which facilitates viral attachment to receptors on living host cells during infection and protects the viral genetic material from enzymatic degradation. The combination of nucleoprotein and capsid is called a nucleocapsid. In some cases, viruses have a lipid bilayer envelope lined with viral-encoded glycosylated (trans) membrane-associated proteins. Once a virus infects a living host cell, it depends on the living host cell for mechanisms to replicate and multiply. The viral genome encodes a number of structural and non-structural regulatory proteins.

[0048] As used herein, the term "subgenomic" or "subgenomic" refers to a smaller portion of the entire replicon genome. Therefore, as used herein, subgenomic transcription refers to the transcription of one or more genes within the replicon genome, rather than the transcription of all genes that constitute the replicon genome. In one embodiment, subgenomic transcription refers to the transcription of genes of experimental or therapeutic significance, as described elsewhere herein.

[0049] As used in the context of viruses herein, the term "structural protein" refers to proteins that constitute structural components of a maturely assembled viral particle or virion. Non-limiting examples of structural protein-like proteins include nucleocapsid core proteins (e.g., gag proteins), enzymes packaged within viral particles (e.g., pol proteins), and membrane components (e.g., env proteins). Conversely, as used in the context of viruses herein, the term "non-structural protein" refers to proteins expressed within host cells that do not constitute structural components of viral particles or virions. Some functions of non-structural proteins include, but are not limited to, replicon formation, immune regulation, and transactivation of structural protein genes.

[0050] In some implementations, the self-amplifying replicon RNA is derived from alphavirus. Unlike the host mRNA, the alphavirus replicon RNA encodes a group of four non-structural proteins (nsPs 1-4) that are responsible for genome replication and, when programmed to include genes encoding non-viral products (such as IL-12 molecules), provides the means to transcribe these non-viral products at subgenomic promoters. Alphaviruses belong to the group IV phylloviridae family of viruses with a positive-sense single-stranded RNA genome and are characterized by an icosahedral nucleocapsid. Other non-limiting examples of group IV viruses include astroviridae, caliciviridae, coronavirusidae, flaviviridae, microribonucleoviridae, arteriviridae, and phylloviridae. The genus Alphaviruses comprises 26 enveloped viruses that infect eukaryotes. Alphaviruses have a wide host range and can be transmitted by mosquitoes and blood-feeding arthropods. Non-limiting examples of alphaviruses include Venezuelan equine encephalitis virus (VEE), Semliki Forest virus (SF), Sindbis virus (SIN), Eastern equine encephalitis virus (EEE), Western equine encephalitis virus (WEE), Everglades virus (EVE), Mucambo virus (MUC), Pixuna virus (PIX), Semliki Forest virus (SF), Middleburg virus (MID), Chikungunya virus (CHIK), Onyon-Nyon virus (ONN), Ross River virus (RR), Bama Forest virus (BF), Geta virus (GET), Sagiyama virus (SAG), Bebaru virus (BEB), Mayaro virus (MAY), Una virus (UNA), Aura virus (AURA), Babanki virus (BAB), Highlands J virus (HJ), and Morganburg virus (FM).

[0051] In this disclosure, at least a portion of the alphavirus replicon is a VEE alphavirus replicon. VEE virus is a viral pathogen, usually carried by mosquitoes, that primarily causes VEE or encephalomyelitis in equines. However, humans can also be infected with VEE, and those with weakened immune systems are particularly susceptible to severe complications. VEE virions are spherical, possessing a lipid membrane with glycoprotein surface proteins scattered on their outer surface. Typically, the VEE genome is approximately 11.45 kb, excluding the 5'-terminal cap and 3'-terminal poly(A) tail, and includes four non-structural proteins (nsP) and five structural proteins. The non-structural proteins include nsP1, nsP2, nsP3, and nsP4, while the structural regions encode proteins C, E3, E2, 6K, and E1. In some cases, the self-amplifying replicon RNA is the WT replicon RNA derived from VEE. The sequence of the VEE virus WT replicon RNA is listed in SEQ ID NO: 1:

[0052]

[0053] As described herein, the self-amplifying replicon RNA comprises at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more of the same nucleotide sequence as SEQ ID NO: 1. In some embodiments, the self-amplifying replicon RNA is at least 90% identical to SEQ ID NO: 1.

[0054] Self-amplified RNA (replicons) represent a promising new platform for gene therapy, but their application remains limited by short expression duration in certain cell types and low in vivo transgene expression levels. In vitro evolutionary synthesis of replicon RNA offers a potentially powerful strategy for modifying and enhancing replicon expression both in vitro and in vivo. Using in vitro evolutionary methods, mutations promoting subgenomic expression in human cells were identified in the nsP2 and nsP3 replicons of Venezuelan equine encephalitis (VEE).

[0055] In some embodiments, the mutations included in the self-amplifying replicon RNA enable it to express IL-12 molecules at a higher level compared to the replicon RNA comprising SEQ ID NO: 1. In some embodiments, the self-amplifying replicon RNA includes at least one point mutation at positions 3936 and / or 4758 of the WT replicon sequence of SEQ ID NO: 1. In some embodiments, the self-amplifying replicon RNA includes at least one of the following point mutations: guanine to cytosine at position 3936 (G3936C) and adenine to guanine at position 4758 (A4758G) of the WT replicon sequence of SEQ ID NO: 1. The G3936C mutation results in glycine to arginine at amino acid residue 1309 (G1309R). The A4758G mutation results in serine to glycine at amino acid residue 1583 (S1583G). In some implementations, the sequence of the mutated self-amplifying replicon RNA (mtReplicon RNA) is listed in SEQ ID NO: 2, where the mutation is highlighted (bold, underlined text):

[0056] C GGTACGATCGCAAGGCCCGTACGCACAATTCTTACAAGCTTTCATCAACCTTGACCAACATTTATACAGGTTCCAGACTCCACGAAGCCGGATGTGCACCCTCATATCATGTGGTGCGAGGGGATATTGCCACGGCCACCGAAGGAGTGATTATAAATGCTGCTAACAGCAAAGGACAACCTGGCGGAGGGGTGTGCGGAGCGCTGTATAAGAAATTCCCGGAAAGCTTCGATTTACAGCCGATCGAAGTAGGAAAAGCGCGACTGGTCAAAGGTGCAGCTAAACATATCATTCATGCCGTAGGACCAAACTTCAACAAAGTTTCGGAGGTTGAAGGTGACAAACAGTTGGCAGAGGCTTATGAGTCCATCGCTAAGATTGTCAACGATAACAATTACAAGTCAGTAGCGATTCCACTGTTGTCCACCGGCATCTTTTCCGGGAACAAAGATCGACTAACCCAATCATTGAACCATTTGCTGACAGCTTTAGACACCACTGATGCAGATGTAGCCATATACTGCAGGGACAAGAAATGGGAAATGACTCTCAAGGAAGCAGTGGCTAGGAGAGAAGCAGTGGAGGAGATATGCATATCCGACGACTCTTCAGTGACAGAACCTGATGCAGAGCTGGTGAGGGTGCATCCGAAGAGTTCTTTGGCTGGAAGGAAGGGCTACAGCACAAGCGATGGCAAAACTTTCTCATATTTGGAAGGGACCAAGTTTCACCAGGCGGCCAAGGATATAGCAGAAATTAATGCCATGTGGCCCGTTGCAACGGAGGCCAATGAGCAGGTATGCATGTATATCCTCGGAGAA G

[0057] In other embodiments, the self-amplifying replicon RNA is derived from hepatitis C virus (HCV). HCV is part of a family of four Flaviviridae viruses, possessing a positively polar, monomeric, linear, single-stranded RNA genome ranging from 9.6 to 12.3 kilobases in length. Flavivirviruses have a methylated nucleotide cap at their 5' end, unlike other members of the family, which encodes an internal ribosome entry site.

[0058] In other embodiments, the alphavirus is an SF virus. SF virus is a viral pathogen, typically carried by mosquitoes, that causes encephalitis. Semliki Forest Virus is a positive-sense RNA virus with a genome of approximately 13,000 base pairs encoding nine proteins. The 5' two-thirds of the genome encodes four non-structural proteins involved in RNA synthesis, while structural proteins are encoded at the 3' third. Among the structural proteins, the C protein forms an icosahedral capsid, which is surrounded by a lipid bilayer derived from the host cell. The outermost surface of the virus is almost entirely covered by heterodimers of glycoproteins E1 and E2, arranged in interconnected trimers to form the outer shell. The trimers are anchored to the membrane via the E2 cytoplasmic domain associated with the nucleocapsid.

[0059] In other embodiments, the alphavirus is a SIN virus. This virus is transmitted by mosquitoes. SIN virus causes Sindbis fever in humans, and symptoms include joint pain, rash, and malaise. Sindbis virus is an enveloped particle with an icosahedral capsid. Its genome is a single-stranded RNA approximately 11.7 kb long. It has a 5' cap and a 3' polyadenylated tail, thus directly acting as messenger RNA (mRNA) in the host cell. The genome encodes four non-structural proteins at the 5' end and the capsid and two envelope proteins at the 3' end. This is characteristic of all enveloped viruses. Replication is cytoplasmic and rapid. The genomic RNA is partially translated at the 5' end to produce non-structural proteins, which then participate in genome replication and the production of new genomic RNA and shorter subgenomic RNA chains. The subgenomic chain is translated into structural proteins. The virus assembles on the surface of the host cell and acquires an envelope through budding. Non-coding RNA elements have been found to be crucial for Sindbis virus genome replication.

[0060] Viral replicon RNA can stimulate immune responses via Toll-like receptors (TLRs). A subset of TLRs, TLR3, TLR7 / 8, and TLR9 participate in antiviral responses by triggering the production of antiviral cytokines such as type I interferon (IFN). TLR3 responds to double-stranded RNA, which is a replication mediator in many viruses. TLR7 / 8 recognize viral single-stranded RNA, while TLR9 recognizes unmethylated CpG motifs in viral DNA. TLRs involved in viral recognition are expressed on the endosomal membrane and can be distinguished based on their requirement for the adaptor protein MyD88: TLR3 activity is MyD88-independent, while TLRs7 / 8 / 9 are MyD88-dependent. Activation of TLR3 leads to the production of type I interferon (IFN). Type I interferon signaling via the ISGF3 (STAT1 / STAT2 / IRF9) complex is essential for sustained Rip3 activation and necrotizing apoptosis.

[0061] In some embodiments, LNP-replicon RNA can stimulate TLR3 signaling in tumor cells, leading to necrotic cell death. In some embodiments, LNP-replicon RNA can enhance LNP-induced immunogenic cell death (ICD). In some embodiments, TT3-LNP-replicon RNA can exert tumor-suppressive effects and trigger anti-tumor immune responses (e.g., recruiting immune cells such as granulocytes, monocytes, macrophages, myeloid-derived suppressor cells, dendritic cells, T cells, and NK cells) by synergistically inducing ICD in tumor cells. In some embodiments, the synthetic oncolytic virus comprises TT3-LNP-mtReplicon RNA.

[0062] In some embodiments, the replicon RNA includes the coding sequence of a detectable molecule in a subgenomic region. In some embodiments, the detectable molecule is a nucleic acid or a polypeptide. In some embodiments, the polypeptide is a fluorescent protein. Fluorescent proteins are known in the art and are a subclass of fluorophores, which are fluorescent compounds capable of re-emitting light upon excitation. A fluorophore absorbs excitation energy at a first specific wavelength and then re-emits light energy at a second, longer specific wavelength. Each type of fluorophore responds and emits light at different wavelengths, depending on its chemical structure and the nature of its environment. In some embodiments, fluorescent proteins include, but are not limited to, wt-GFP, green fluorescent proteins (e.g., EGFP, Emerald, Superfolder GFP, Azami Green, mWasabi, TagGFP, TurboGFP, AcGFP, ZsGreen, T-Sapphire, etc.), blue fluorescent proteins (e.g., EBFP, EBFP2, Azurite, mTagBFP, etc.), cyan fluorescent proteins (e.g., ECFP, mECFP, Cerulean, mTurquoise, CyPet, AmCyan1, Midori-Ishi Cyan, TagCFP, mTFP1(Teal), etc.), yellow fluorescent proteins (e.g., EYFP, Topaz, Venus, mCitrine, YPet, TagYFP, PhiYFP, ZsYellow1, mBanana, etc.), and orange fluorescent proteins (e.g., Kusabira Orange, Kusabira...). Orange2, mOrange, mOrange2, dTomato, dTomato-Tandem, TagRFP, TagRFP-T, DsRed, DsRed2, DsRed-Express(T1), DsRed-Monomer, mTangerine, etc.), or red fluorescent proteins (e.g., mRuby, mApple, mStrawberry, AsRed2, mRFP1, JRed, mCherry, HcRed1, mRaspberry, dKeima-Tandem, HcRed-Tandem, mPlum, AQ143, etc.).

[0063] In some respects, as described herein, the self-amplifying replicon RNA includes a coding sequence for expressing IL-12 in a subgenomic region. An exemplary coding sequence for IL-12 is listed in SEQ ID NO: 3:

[0064]

[0065] Structurally, IL-12 belongs to the type I cytokine class and possesses a four-alpha-helix bundle structure. IL-12 functions as a heterodimer protein (IL-12-p70; IL-12-p30 / p40), composed of two covalently linked p30 and p40 subunits. In contrast to the heterodimer form, the IL-12-p40 / p40 homodimer primarily acts as a competitive inhibitor of IL-12-p70. IL-12 is a pleiotropic cytokine that establishes a link between innate and adaptive immunity. IL-12 was initially described as a factor secreted by B cell lines transformed from EBV induced by PMA. Based on its function, IL-12 was initially named "cytotoxic lymphocyte maturation factor" and "natural killer cell stimulator." Due to its ability to bridge innate and adaptive immunity and effectively stimulate the production of IFN-γ (a cytokine that coordinates natural mechanisms of anti-cancer defense), IL-12 appears to be an ideal candidate for human tumor immunotherapy. However, the serious side effects associated with systemic administration of IL-12 in clinical studies and the very narrow therapeutic index of this cytokine have significantly reduced enthusiasm for its use in cancer patients.

[0066] Following the discovery of IL-12, three more members (IL-23, IL-27, and IL-35) were added to the IL-12 family, demonstrating their crucial roles in Th1 cell function. IL-12 is a ligand for its receptor, composed of two amino acid chains, IL-12R-β1 and IL-12R-β2. The IL-12 receptor is expressed constitutively (e.g., IL-12R-β1 in B cells) or inducibly (IL-12R-β2) in various immune cells, including NK cells, T lymphocytes, and B lymphocytes. Ligand-bound IL-12R-β2 is phosphorylated at a tyrosine residue, providing a stopping site for two kinases, JAK2 and TYK2. Within the STAT transcription factor family, STAT4 is considered the most specific mediator of IL-12-induced cellular responses. The main components of IL-12's action are as follows: increasing IFN-γ production in NK and T cells, with IFN-γ being the most effective mediator of IL-12 action; stimulating the growth and cytotoxicity of activated NK cells, CD8+, and CD4+ T cells, and differentiating CD4+ Th0 cells into a Th1 phenotype; enhancing antibody-dependent cytotoxicity (ADCC) against tumor cells; and inducing IgG and inhibiting IgE production from B cells. The primary source of IL-12 in the human body is activated antigen-presenting cells, such as dendritic cells, especially those with a CD1c+ phenotype, and hematopoietic phagocytes (monocytes, macrophages, and neutrophils), but IL-12 can also be produced by other cell types. Although IL-12 acts on a variety of immune cells, its overall physiological role appears to be coordinating Th1-type immune responses against certain pathogens.

[0067] In some aspects, this disclosure describes the local delivery of IL-12 via LNP-encapsulated viral replicon RNA, which encodes the IL-12 molecule in its subgenomic region. In addition to synergistic tumor cell immunogenic cell death (ICD) induced by LNP-replicon RNA, in some embodiments, expression of IL-12 in the tumor microenvironment can lead to further immune stimulation and enhancement of the antitumor immune response. In some embodiments, the combination of LNP-replicon RNA-IL-12 in the tumor microenvironment can induce a systemic antitumor immune response. In other embodiments, the combination of LNP-replicon RNA-IL-12 in the tumor microenvironment can eradicate tumor cells and prevent tumor recurrence. In some embodiments, the synthetic oncolytic virus comprises TT3-LNP-mtReplicon RNA-IL12.

[0068] In some embodiments, the replicon RNA-IL12 further includes a coding sequence for serum albumin. The half-life of peptides and proteins (e.g., cytokines) in biological environments (e.g., serum, tumor microenvironment) is influenced by a variety of factors, including size, charge, proteolytic sensitivity, their biological properties, the turnover rate of the proteins they bind to, and others. In some cases, the half-life of proteins in biological environments is roughly correlated with their size. Peptides and proteins smaller than about 70 kDa (e.g., cytokines) can be eliminated by renal filtration and therefore typically have very short half-lives. However, larger proteins can persist for several days. Three types of proteins, IgG, serum albumin, and transferrin, persist for much longer than predicted solely by their size. In some embodiments, serum albumin is human serum albumin. In some embodiments, serum albumin is mouse serum albumin (MSA). An exemplary coding sequence for replicon RNA-IL12-MSA is listed in SEQ ID NO: 4:

[0069]

[0070] In some embodiments, the replicon RNA-IL-12 is fused to the serum albumin coding sequence. In some embodiments, the IL-12-albumin fusion molecule has a longer half-life in the tumor microenvironment. In some embodiments, the IL-12-albumin fusion protein can persist in the tumor microenvironment for at least 1, 2, 3, 4, 5, 6, 7, 8 days or longer.

[0071] In some embodiments, the synthetic oncolytic virus comprises LNP-replicon RNA-IL-12-serum albumin. In other embodiments, the synthetic oncolytic virus comprises TT3-LNP-replicon RNA-IL-12-serum albumin. In still other embodiments, the synthetic oncolytic virus comprises TT3-LNP-mtReplicon RNA-IL-12-serum albumin. The persistent presence of IL-12 in the tumor microenvironment may prolong the antitumor immune response exerted by the synthetic oncolytic virus.

[0072] In some embodiments, the replicon RNA-IL12-serum albumin further includes the coding sequence for a lumen protein. Lumen proteins are among the major extracellular proteins in the extracellular matrix (ECM) of the skin, corneal stroma, sclera, aorta, muscle, lung, kidney, bone, cartilage, and intervertebral discs. They are members of the small, leucine-rich proteoglycan (SLRP) family, with a core protein of 30-50 kDa comprising a signal peptide, a negatively charged N-terminal domain, a highly conserved leucine-rich internal domain, and a C-terminal domain. The protein core and glycan chains of lumen proteins can interact with various cellular effectors, including cytokines, growth factors, and cell surface receptors, to regulate cell adhesion, proliferation, and migration. As described herein, the presence of lumen proteins in the tumor microenvironment, as endogenous collagen-binding proteins, will promote local retention of IL-12 to enhance the efficacy and safety of tumor immunotherapy. In some embodiments, the replicon RNA-IL-12-MSA includes the coding sequence for a lumen protein. In other embodiments, mtReplicon RNA-IL-12-MSA (mtRep-IL12-MSA) includes the coding sequence of a lumican protein. An exemplary coding sequence of mtReplicon RNA-IL-12-MSA-Lumican (mtRep-IL12-MSA-Lumican) is listed in SEQ ID NO: 5:

[0073]

[0074] In some embodiments, the synthetic oncolytic virus comprises LNP-replicon RNA-IL-12-serum albumin-luminal protein. In other embodiments, the synthetic oncolytic virus comprises TT3-LNP-replicon RNA-IL-12-serum albumin-luminal protein. In still other embodiments, the synthetic oncolytic virus comprises TT3-LNP-mtReplicon RNA-IL-12-serum albumin-luminal protein. Retention of IL-12 in the tumor microenvironment can improve the efficacy and safety of the synthetic oncolytic virus.

[0075] In some cases, the replicon RNA may include one or more genes of experimental or therapeutic significance. In some embodiments, the gene of experimental or therapeutic significance encodes a cytokine, chemokine, or growth factor other than IL-12. Cytokines are known in the art, and the term itself refers to a broad group of small proteins secreted by certain cells within the immune system and effective against other cells. Cytokines are known to enhance cellular immune responses and, as used herein, may include, but are not limited to, TNFα, IFN-γ, IFN-α, TGF-β, IL-1, IL-2, IL-4, IL-10, IL-13, IL-17, IL-18, and chemokines. Chemokines can be used to study applications in infection responses, immune responses, inflammation, trauma, sepsis, cancer, and reproduction. Chemokines are known in the art and are a class of cytokines that induce chemotaxis in nearby responding cells, typically leukocytes, towards the site of infection. Non-limiting examples of chemokines include CCL14, CCL19, CCL20, CCL21, CCL25, CCL27, CXCL12, CXCL13, CXCL-8, CCL2, CCL3, CCL4, CCL5, CCL11, and CXCL10. Growth factors are known in the art, and the term is sometimes used interchangeably with the term cytokine. As used herein, the term "growth factor" refers to naturally occurring substances capable of transmitting signals between cells and stimulating cell growth. While cytokines may be growth factors, certain types of cytokines can also have inhibitory effects on cell growth, thus the two terms are distinguished. Non-limiting examples of growth factors include adrenaline medullaris (AM), angiopoietin (Ang), autocrine motor factor, bone morphogenetic protein (BMP), ciliary neurotrophic factor (CNTF), leukemia suppressor factor (LIF), interleukin-6 (IL-6), macrophage colony-stimulating factor (m-CSF), granulocyte colony-stimulating factor (G-CSF), granulocyte-macrophage colony-stimulating factor (GM-CSF), epidermal growth factor (EGF), liver glycosides A1, A2, A3, A4, A5, B1, B2, B3, B3, Erythropoietin (EPO), fibroblast growth factor 1 (FGF1), FGF2, FGF3, FGF4, FGF5, FGF6, and FGF7. Fibroblast growth factor 7 (FGF7), Fibroblast growth factor 8 (FGF8), Fibroblast growth factor 9 (FGF9), Fibroblast growth factor 10 (FGF10), Fibroblast growth factor 11 (FGF11), Fibroblast growth factor 12(FGF12), Fibroblast Growth Factor 13 (FGF13), Fibroblast Growth Factor 14 (FGF14), Fibroblast Growth Factor 15 (FGF15), Fibroblast Growth Factor 16 (FGF16), Fibroblast Growth Factor 17 (FGF17), Fibroblast Growth Factor 18 (FGF18), Fibroblast Growth Factor 19 (FGF19), Fibroblast Growth Factor 20 (FGF20), Fibroblast Growth Factor 21 (FGF21), Fibroblast Growth Factor 22 (FGF22), Fibroblast Growth Factor 23 (FGF23), Fetal Bovine Growth Hormone (FBS), Glial Cell Line Derivative Neurotrophic Factor (GDNF), Neurorankin, Persephin, Artemin, Growth Differentiation Factor-9 (GDF9), Hepatocyte Growth Factor (HGF), Hepatocellular Carcinoma Derivative Growth Factor (HDGF), Insulin, Insulin-like Growth Factor-1 (IGF-1), Insulin-like Growth Factor-2 (IGF-2), Interleukin-1 IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, keratinocyte growth factor (KGF), migration-stimulating factor (MSF), macrophage-stimulating protein (MSP), myostatin (GDF-8), neurotrophic protein 1 (NRG1), neurotrophic protein 2 (NRG2), neurotrophic protein 3 (NRG3), neurotrophic protein 4 (NRG4), brain-derived neurotrophic factor (BDNF), nerve growth factor (NGF), neurotrophic protein-3 (NT-3), neurotrophic protein-4 (NT-4), placental growth factor (PGF), platelet-derived growth factor (PDGF), renal enzyme (RNLS), T-cell growth factor (TCGF), thrombopoietin (TPO), transforming growth factor α (TGF-α), transforming growth factor β (TGF-β), tumor necrosis factor-α (TNF-α), and vascular endothelial growth factor (VEGF).

[0076] II. Pharmaceutical Composition

[0077] In some aspects, this disclosure relates at least in part to pharmaceutical compositions comprising synthetic oncolytic viruses as described herein. The pharmaceutical compositions described herein may further comprise pharmaceutically acceptable carriers (excipients) to form a pharmaceutical composition for treating a target disease. "Acceptable" means that the carrier must be compatible with (and preferably, capable of stabilizing) the active ingredient of the composition and harmless to the subject to be treated. Pharmaceutically acceptable excipients (carriers) include buffers well known in the art. See, for example, Remington: The Science and Practice of Pharmacy 20th Ed. (2000) Lippincott Williams and Wilkins, Ed. KE Hoover.

[0078] Pharmaceutical compositions intended for internal administration must be sterile. This can be easily achieved, for example, by filtration through a sterile filter membrane. Compositions containing synthetic oncolytic viruses can be placed in containers with sterile inlets, such as intravenous solution bags or vials with stoppers that can be punctured by a hypodermic needle.

[0079] In some embodiments, the pharmaceutical compositions used herein can be formulated for intratumoral injection. As used herein, intratumoral injection refers to the direct injection of an antitumor composition (e.g., an immunostimulated synthetic oncolytic virus) into the tumor. High concentrations of the composition can be obtained in situ, using only small amounts of the drug. Local application of immunotherapy allows for multiple combination therapies while preventing significant systemic exposure and off-target toxicity.

[0080] In other embodiments, the pharmaceutical composition may be formulated for intramuscular, intravenous, or subcutaneous injection.

[0081] Pharmaceutical compositions used in this method may include pharmaceutically acceptable carriers, buffers, excipients, salts, or stabilizers in the form of lyophilized formulations or aqueous solutions. See, for example, Remington: The Science and Practice of Pharmacy 20th Ed. (2000) Lippincott Williams and Wilkins, Ed. KE Hoover). Acceptable carriers, excipients, or stabilizers are non-toxic to the recipient at the doses and concentrations used and may include buffers such as phosphates, citrates, and other organic acids; antioxidants, including ascorbic acid and methionine; preservatives (e.g., octadecyl dimethyl benzyl ammonium chloride; hexamethyl ammonium chloride; benzalkonium chloride, benzyl chloride; phenol, butanol, or benzyl alcohol; parabens such as methylparaben or propylparaben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) peptides; proteins, Examples include serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextran; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose, or sorbitol; counterions that form salts, such as sodium; metal complexes (e.g., zinc-protein complexes); and / or nonionic surfactants such as TWEEN™, PLURONICS™, or polyethylene glycol (PEG).

[0082] In some examples, the pharmaceutical compositions described herein comprise lipid nanoparticles that can be prepared by methods known in the art, such as those described in Epstein, et al., Proc. Natl. Acad. Sci. USA 82:3688 (1985); Hwang, et al., Proc. Natl. Acad. Sci. USA 77:4030 (1980); and U.S. Patent Nos. 4,485,045 and 4,544,545. Liposomes with extended cycle times are disclosed in U.S. Patent No. 5,013,556. Particularly useful liposomes can be produced by a reverse-phase evaporation method using a lipid composition comprising phosphatidylcholine, cholesterol, and PEG-derived phosphatidylethanolamine (PEG-PE). The liposomes are extruded through a filter with defined pore sizes to produce liposomes with desired diameters.

[0083] In other examples, the pharmaceutical compositions described herein may be formulated in a sustained-release form. Suitable examples of sustained-release formulations include a semi-permeable matrix containing a solid hydrophobic polymer of a synthetic oncolytic virus, in the form of a molded article, such as a film or microcapsule. Examples of sustained-release matrices include polyesters, hydrogels (e.g., poly(2-hydroxyethyl methacrylate) or poly(vinyl alcohol)), polylactide (US Patent No. 3,773,919), L-glutamic acid and 7-ethyl-L-glutamic acid, non-degradable ethylene-vinyl acetate, degradable lactic acid-glycolic acid copolymers such as LUPRON DEPOT™ (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate), sucrose isobutyrate acetate, and poly(-)-3-hydroxybutyrate.

[0084] Suitable surfactants particularly include nonionic agents such as polyoxyethylene sorbitol (e.g., TWEEN™ 20, 40, 60, 80, or 85) and other sorbitols (e.g., SPAN™ 20, 40, 60, 80, or 85). Compositions containing surfactants will conveniently include between 0.05% and 5% of the surfactant, and may be between 0.1% and 2.5%. It should be understood that other components, such as mannitol or other pharmaceutically acceptable carriers, may be added if desired.

[0085] The pharmaceutical compositions described herein may be in unit dosage forms, such as tablets, pills, capsules, powders, granules, solutions, or suspensions, or suppositories, for oral, parenteral, or rectal administration, or for administration by inhalation or blowing.

[0086] To prepare solid compositions such as tablets, the main active ingredient can be mixed with a pharmaceutical carrier, such as conventional tableting ingredients like corn starch, lactose, sucrose, sorbitol, talc, stearic acid, magnesium stearate, dicalcium phosphate, or gum, and other pharmaceutical diluents, such as water, to form a solid preformation composition containing a homogeneous mixture of the compound of the present invention or a non-toxic, pharmaceutically acceptable salt thereof. When these preformation compositions are referred to as homogeneous, it means that the active ingredient is uniformly dispersed throughout the composition, such that the composition can be easily subdivided into equally effective unit dosage forms, such as tablets, pills, and capsules. The solid preformation composition is then subdivided into unit dosage forms of the type described above, containing 0.1 to about 500 mg of the active ingredient of the present invention. Tablets or pills of the new composition can be coated or otherwise mixed to provide dosage forms with the advantage of prolonged action. For example, tablets or pills may include an internal dose component and an external dose component, the latter being a coating on top of the former. These two components can be separated by an enteric coating layer, which resists disintegration in the stomach and allows the internal component to enter the duodenum intact or delay release. A variety of materials can be used for this enteric coating or coating, including a variety of polymeric acids and mixtures of polymeric acids with materials such as shellac, hexadecyl alcohol and cellulose acetate.

[0087] Suitable emulsions can be prepared using commercially available fat emulsions, such as INTRALIPID™, LIPOSYN™, INFONUTROL™, LIPOFUNDIN™, and LIPIPHYSAN™. The active ingredient can be dissolved in a pre-mixed emulsion composition, or it can be dissolved in an oil (e.g., soybean oil, safflower oil, cottonseed oil, sesame oil, corn oil, or almond oil) and mixed with water to form an emulsion containing phospholipids (e.g., egg phospholipids, soybean phospholipids, or soybean lecithin). It should be understood that other ingredients, such as glycerol or glucose, can be added to adjust the emulsion's tension. Suitable emulsions typically contain up to 20% oil, for example, between 5% and 20%. Fat emulsions can comprise fat droplets of suitable size and can have a pH in the range of 5.5 to 8.0.

[0088] Pharmaceutical compositions for inhalation or inhalation include solutions or suspensions of pharmaceutically acceptable aqueous or organic solvents or mixtures thereof, as well as powders. Liquid or solid compositions may contain suitable pharmaceutically acceptable excipients as described above. In some embodiments, the composition is administered via the oral or nasal route to achieve local or systemic effects.

[0089] Compositions in preferably sterile, pharmaceutically acceptable solvents can be nebulized using a gas. The nebulized solution can be inhaled directly from the nebulizer, or the nebulizer can be connected to a mask, tent, or intermittent positive pressure ventilator. Solution, suspension, or powder compositions can be administered from a device that delivers the formulation in a suitable manner, preferably orally or nasally.

[0090] III. Therapeutic applications

[0091] The pharmaceutical compositions disclosed herein, including synthetic oncolytic viruses, can be used to treat cancer, such as cancer immunotherapy.

[0092] To practice the methods disclosed herein, any effective amount of the pharmaceutical composition described herein can be administered to a subject requiring treatment (e.g., a human) via a suitable route, such as intratumoral administration or intravenous administration. It can be administered as a bolus or by continuous infusion over a period of time via intramuscular, intraperitoneal, intraspinal, subcutaneous, intra-articular, intrasynovial, intrathecal, oral, inhalation, or local routes. Commercially available nebulizers for liquid formulations, including jet nebulizers and ultrasonic nebulizers, can be used for administration. Liquid formulations can be directly nebulized, and lyophilized powders can be reconstituted and then nebulized. Alternatively, pharmaceutical compositions containing synthetic oncolytic viruses can be atomized using fluorocarbon formulations and metered-dose inhalers, or inhaled as lyophilized and ground powders. In some examples, the pharmaceutical compositions described herein are formulated for intratumoral injection. In certain examples, the pharmaceutical compositions can be administered to a subject (e.g., a human patient) via a local route, such as injection at a local site, such as a tumor site or infection site.

[0093] As used herein, "effective amount" refers to the amount of each active agent, alone or in combination with one or more other active agents, required to impart a therapeutic effect to a subject. In some embodiments, the therapeutic effect is a reduction in tumor burden, a reduction in cancer cells, or an increase in immune activity. Determining whether a given amount of synthetic oncolytic virus achieves a therapeutic effect is apparent to those skilled in the art. As will be recognized by those skilled in the art, the effective amount is determined based on the specific condition being treated, the severity of the condition, individual patient parameters (including age, physical condition, body size, sex, and weight), the duration of treatment, the nature of concurrent treatments (if any), the specific route of administration, and similar factors within the knowledge and expertise of a healthcare professional. These factors are well known to those skilled in the art and can be resolved through routine experimental procedures. Generally, the maximum dose of a single component or combination thereof is preferred, i.e., the highest safe dose based on reasonable medical judgment.

[0094] Empirical considerations, such as half-life, often aid in determining the dosage. The frequency of administration can be determined and adjusted during treatment, and is usually, but not necessarily, based on the treatment and / or inhibition and / or improvement and / or delay of the target disease / symptom. Optionally, a synthetic oncolytic virus formulation for sustained continuous release may be appropriate. Various formulations and devices for achieving sustained release are known in the art.

[0095] In some embodiments, treatment is a single injection of a pharmaceutical composition containing a synthetic oncolytic virus. In some embodiments, a single injection is administered intratumorally to a subject in need.

[0096] In some examples, the dosage of the synthetic oncolytic virus described herein can be determined empirically in individuals who have already received one or more doses of the synthetic oncolytic drug. The synthetic oncolytic composition is then used to increase the dosage in the individual. To assess the efficacy of the synthetic oncolytic virus, indicators of the disease / symptom can be followed. For repeated administration over several days or longer, depending on the condition, treatment continues until the desired symptom suppression is achieved or until an adequate therapeutic level is reached to alleviate the target disease or condition or its symptoms.

[0097] In some implementations, the frequency of administration is once a week, once every two weeks, once every four weeks, once every five weeks, once every six weeks, once every seven weeks, once every eight weeks, once every nine weeks, or once every ten weeks; or once a month, once every two months, once every three months, or for longer periods. Progression of this treatment can be easily monitored using routine techniques and testing. The administration regimen of the synthetic oncolytic virus used may vary over time.

[0098] In some embodiments, the methods described herein include administering one or more doses of a pharmaceutical composition containing a synthetic oncolytic virus to a subject requiring treatment (e.g., a human patient).

[0099] For the purposes of this disclosure, the appropriate dose of synthetic oncolytic virus as described herein will depend on the specific synthetic oncolytic virus, the type and severity of the disease / symptom, the purpose of the synthetic oncolytic virus for prophylactic or therapeutic purposes, prior treatment, the patient's clinical history and response to the synthetic oncolytic virus, and the judgment of the attending physician. Clinicians may administer synthetic oncolytic viruses up to a dose that achieves the desired outcome. In some embodiments, the desired outcome is a reduction in tumor burden, a reduction in cancer cells, or an increase in immune activity. Methods for determining whether a dose produces the desired outcome will be apparent to those skilled in the art. Administration of one or more synthetic oncolytic viruses may be continuous or intermittent, depending on factors such as the recipient's physiological condition, whether the administration is therapeutic or prophylactic, and other factors known to a skilled practitioner. Administration of synthetic oncolytic viruses may be substantially continuous over a preselected time period or may be a series of interval doses, for example, before, during, or after the development of the target disease or symptom.

[0100] As used herein, the term “treatment” means the application or administration of a composition comprising one or more active agents to a subject suffering from a target disease or condition, symptoms of the disease / condition, or a predisposition to the disease / condition, with the aim of curing, healing, alleviating, reducing, altering, remedying, improving, enhancing, or influencing the condition, symptoms of the disease, or predisposition to the disease or condition.

[0101] Relieving a target disease / symptom involves delaying the development or progression of the disease, or reducing its severity. Disease relief does not necessarily require a treatment outcome. As used herein, “delaying” the development of a target disease or symptom means postponing, hindering, slowing, delaying, stabilizing, and / or postponing the progression of the disease. This delay can be of varying lengths, depending on the history of the disease and / or the individual being treated. Methods of “delaying” or alleviating disease development or delaying the onset of the disease involve reducing the likelihood of the occurrence of one or more symptoms of the disease and / or lessening the severity of symptoms within a given timeframe compared to not using that method. Such comparisons are typically based on clinical studies using a number of subjects sufficient to yield statistically significant results.

[0102] The term "development" or "progression" of a disease refers to the initial manifestations and / or subsequent progression of the disease. The development of a disease can be detected and assessed using standard clinical techniques well known in the art. However, development also refers to progression that may be undetectable. For the purposes of this disclosure, development or progression refers to the biological process of a symptom. "Development" includes occurrence, relapse, and onset. As used herein, an "onset" or "occurrence" of a target disease or condition includes an initial onset and / or relapse.

[0103] In some embodiments, the pharmaceutical composition containing a synthetic oncolytic virus, as described herein, is administered in an amount sufficient to reduce the tumor burden or cancer cell growth in vivo by at least 5% (e.g., 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or higher). In other embodiments, the pharmaceutical composition containing a synthetic oncolytic virus, as described herein, may be administered in an amount that effectively increases immune activity by at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or higher.

[0104] Subjects to be treated by the methods described herein may be mammals, such as humans, farm animals, sporting animals, pets, primates, horses, dogs, cats, mice, and rats. In one embodiment, the subject is a human. The compositions containing synthetic oncolytic viruses as described herein can be used to enhance the immune activity, such as T-cell activity, of subjects requiring treatment.

[0105] In some embodiments, the subject may be a human patient who has, is suspected of having, or is at risk of developing cancer. Non-limiting examples of cancer include melanoma, squamous cell carcinoma, small cell lung cancer, non-small cell lung cancer, lung adenocarcinoma, lung squamous cell carcinoma, peritoneal cancer, hepatocellular carcinoma, gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, breast cancer, colon cancer, colorectal cancer, endometrial cancer or uterine cancer, salivary gland cancer, kidney cancer, prostate cancer, vulvar cancer, thyroid cancer, liver cancer, stomach cancer, and various types of head and neck cancers, including squamous cell head and neck cancer. In some embodiments, the cancer may be melanoma, lung cancer, colorectal cancer, renal cell carcinoma, urothelial carcinoma, or Hodgkin's lymphoma.

[0106] Subjects with a target disease or condition (e.g., cancer) can be identified through routine medical examinations such as laboratory tests, organ function tests, CT scans, or ultrasound. Subjects suspected of having any such target disease / condition may exhibit one or more symptoms of that disease / condition. Subjects at risk of a disease / condition may be those with one or more risk factors associated with that disease / condition. Such subjects can also be identified through routine medical practice.

[0107] In some embodiments, the pharmaceutical composition containing a synthetic oncolytic virus may be combined with another suitable therapeutic agent (e.g., an anticancer agent, antiviral agent, or antibacterial agent) and / or used to enhance and / or supplement the immunostimulatory effect of the synthetic oncolytic virus. In such combination therapy, the composition containing the synthetic oncolytic virus and the additional therapeutic agent (e.g., an anticancer therapeutic agent or other therapeutic agents described herein) may be administered sequentially to the subject requiring treatment, i.e., each therapeutic agent is administered at different times. Optionally, these therapeutic agents or at least two agents may be administered to the subject substantially simultaneously.

[0108] Combination therapy may also include further administration of the agents described herein (e.g., pharmaceutical compositions containing synthetic oncolytic viruses and anticancer agents) in combination with other bioactive ingredients (e.g., different anticancer agents) and non-pharmacological treatments (e.g., surgery).

[0109] It should be understood that any combination of a composition containing a synthetic oncolytic virus and another anticancer agent (e.g., a chemotherapeutic agent) can be used to treat cancer in any order. The combinations described herein can be selected based on a variety of factors, including but not limited to reducing tumor formation or growth, reducing cancer cells, increasing immune activity and / or alleviating at least one cancer-related symptom, or mitigating the side effects of another combination of drugs. For example, the combination therapy described herein can reduce any side effects associated with each individual member of the combination, such as side effects associated with the anticancer agent.

[0110] In some implementations, another anticancer treatment agent is chemotherapy, radiation therapy, surgery, and / or immunotherapy. Examples of chemotherapy agents include, but are not limited to, carboplatin or cisplatin, docetaxel, gemcitabine, Nab-paclitaxel, paclitaxel, pemetrexed, and vinorelbine. Examples of radiation therapy include, but are not limited to, ionizing radiation, gamma radiation, neutron beam radiation therapy, electron beam radiation therapy, proton therapy, brachytherapy, whole-body radioisotopes, and radiosensitizers. Examples of surgical treatment include, but are not limited to, therapeutic surgery (e.g., tumor resection surgery), prophylactic surgery, laparoscopic surgery, and laser surgery. Examples of immunotherapy include, but are not limited to, adoptive cell transfer and therapeutic cancer vaccines.

[0111] Other examples of chemotherapy include, but are not limited to, platinum-based agents such as carboplatin, oxaliplatin, cisplatin, nedaplatin, saxaplatin, lobaplatin, troplatin, tetranitrate, pyrplatin, prolylplatin, aroplatin, and other derivatives; topoisomerase I inhibitors such as camptothecin, topotecan, irinotecan / SN38, rubicin, belotecone, and other derivatives; topoisomerase II inhibitors such as etoposide (VP-16), daunorubicin, doxorubicin reagents (e.g., doxorubicin, doxorubicin HCl, doxorubicin analogs or liposomes in which doxorubicin and its salts or analogs), mitoxantrone, arubicin, epirubicin, idarubicin, amrubicin, acridine, pirarubicin, pentorubicin, zorubicin, teniposide, and other derivatives; and antimetabolites such as the folic acid family (methotrexate, pemetrexed, raltein). Trisephine, aztreon, and related drugs); purine antagonists (thioguanine, fludarabine, cladribine, 6-mercaptopurine, pentostatin, clofarabine, and related drugs) and pyrimidine antagonists (cytarabine, fluorouracil, azacitidine, tegafur, carmivoxil, capecitabine, gemcitabine, hydroxyurea, 5-fluorouracil (5FU), and related drugs); alkylating agents, such as nitrogen mustard (e.g., cyclophosphamide, levonorgestrel, chlorambucil, dichloroisocyanuric acid). Methyldiethylamine, ifosfamide, trolophosphamide, prednimustine, bendamustine, uramustine, estmustine, and related drugs); nitrosoureas (e.g., carmustine, lomustine, semustine, fortimustine, nimustine, ranimustine, streptozotocin, and related drugs); triazene (e.g., dacarbazine, ketamine, temozolomide, and related drugs); alkyl sulfonates (e.g., busulfan, mannosulfan, succinylsulfonate, and related drugs). (Related drugs) Methylbenzylhydrazine; dibromomannitol and aziridine (e.g., carboquinone, triamine, ThiotEPA, triethylenediamine and related drugs); antibiotics, such as hydroxyurea, anthracycline antibiotics (e.g., doxorubicin, daunorubicin, epirubicin and other derivatives); anthraquinones (e.g., mitoxantrone and related drugs); Streptomyces (e.g., bleomycin, mitomycin C, actinomycin, procainamide); and ultraviolet light.

[0112] III. Reagent kits for treatment

[0113] This disclosure also provides kits for immunotherapies targeting and / or treating cancer or reducing the risk of cancer (e.g., melanoma, lung cancer, colorectal cancer, or renal cell carcinoma). Such kits may include one or more containers comprising a pharmaceutical composition containing a synthetic oncolytic virus, such as any of the compositions described herein.

[0114] In some embodiments, the kit may include instructions for use according to any of the methods described herein. For example, the included instructions may include administration of a composition containing a synthetic oncolytic virus to treat, delay the onset of, or alleviate target diseases as described herein. The kit may further include a description of selecting suitable individuals for treatment based on whether the individual has a target disease. In other embodiments, the instructions include a description of administering a composition containing a synthetic oncolytic virus to an individual at risk of a target disease.

[0115] Instructions for use with compositions containing synthetic oncolytic viruses typically include information on dosage, administration regimen, and route of administration for the intended treatment. Containers may be unit dose, bulk packaging (e.g., multi-dose packaging), or subunit dose. Instructions provided in the kits of this invention are typically written instructions on a label or packaging insert (e.g., paper pages included in the kit), but machine-readable instructions (e.g., instructions carried on a disk or optical disc) are also acceptable.

[0116] The label or packaging insert indicates that the composition is intended for the treatment, delay of onset, and / or relief of cancer-related diseases or conditions, such as those described herein. Instructions for practicing any of the methods described herein may be provided.

[0117] The kits described herein are packaged in appropriate packaging. Appropriate packaging includes, but is not limited to, vials, bottles, wide-mouth bottles, flexible packaging (e.g., sealed polyester film or plastic bags), etc. Packaging for use with specific devices such as inhalers, nasal delivery devices (e.g., nebulizers), or infusion devices such as micropumps is also considered. The kit may have a sterile inlet (e.g., the container may be an intravenous solution bag or a vial with a stopper that can be punctured by a hypodermic needle). Containers may also have a sterile inlet (e.g., the container may be an intravenous solution bag or a vial with a stopper that can be punctured by a hypodermic needle). At least one active agent in the composition is a composition containing synthetic oncolytic viruses, such as those described herein.

[0118] The kit may optionally include additional components, such as buffer solutions and explanatory information. Typically, the kit includes a container and a label or packaging insert on or associated with the container. In some embodiments, the invention provides an article of manufacture comprising the contents of the kit described above.

[0119] IV. Commonly Used Techniques

[0120] Unless otherwise stated, the practice of this invention will employ conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, and immunology, which are within the scope of the art. MolecularCloning: A Laboratory Manual, second edition (Sambrook, et al., 1989) Cold Spring Harbor Press; Oligonucleotide Synthesis (MJ Gait, ed., 1984); Methods in Molecular Biology, Humana Press; Cell Biology: A Laboratory Notebook (JECellis, ed., 1998) Academic Press; Animal Cell Culture (RI Freshney, ed., 1987); Introduction to Cell and Tissue Culture (JP Mather and PERoberts, 1998) Plenum Press; Cell and Tissue Culture: Laboratory Procedures (A. Doyle, JB Griffiths, and DG Newell, eds., 1993-8) J. Wiley andSons; Methods in Enzymology (Academic Press, Inc.); Handbook of ExperimentalImmunology (DM Weir and CC Blackwell, eds.); Gene Transfer Vectors for Mammalian Cells (JM Miller and MP Calos, eds., 1987); Current Protocols in Molecular Biology (FM Ausubel, et al., eds., 1987); PCR: The Polymerase ChainReaction, (Mullis, et al., eds., 1994); Current Protocols in Immunology (JEColigan et al., eds., 1994);, 1991); Short Protocols in Molecular Biology (Wiley and Sons, 1999); Immunobiology (CA Janeway and P. Travers, 1997); Antibodies (P.Finch, 1997); Antibodies: a practical approach (D. Catty., ed., IRL Press, 1988-1989); Monoclonal antibodies: a practical approach (P. Shepherd and C.Dean, eds., Oxford University Press, 2000); Using antibodies: a laboratory manual (E. Harlow and D. Lane (Cold Spring Harbor Laboratory Press, 1999)); TheAntibodies (M. Zanetti and JD Capra, eds., Harwood Academic (Publishers, 1995). Further details will not be elaborated upon, and it is believed that those skilled in the art can fully utilize the invention based on the above description. Therefore, the following detailed description should be interpreted as illustrative only and not as limiting the remainder of this disclosure in any way. All publications cited herein are incorporated by reference for the purposes or subject matter of this citation.

[0121] Further details are omitted, and it is believed that those skilled in the art can make the most of the invention based on the above description. Therefore, the specific embodiments described below should be interpreted as illustrative only and not as limiting the remainder of this disclosure in any way. All publications cited herein for the purposes or subject matter of this citation are incorporated herein by reference.

[0122] Example

[0123] Materials and methods

[0124] Cell lines and animals

[0125] Cultivate according to the supplier's instructions (37) oC, 5% CO2) cell lines B16F10 (ATCC® CRL-6475™), HEK-blue-TLR2 (Invivogen), HEK-blue-TLR3 (Invivogen), HEK-blue-TLR7 (Invivogen), HEK-blue-TLR9 (Invivogen), and Raw-Lucia ISG (Invivogen). Female C57BL / 6J (JAX Stock No. 000664) mice aged 6–8 weeks were purchased and housed in the MIT animal facility. All animal studies and procedures were conducted in accordance with federal, state, and local guidelines and by the MIT Animal Care Committee in accordance with IACUC-approved animal protocols.

[0126] Antibody, staining and FACS analysis

[0127] Antibodies against mouse Ly6c (HK1.4), CD11b (M1 / 70), CD11c (N418), F4 / 80 (BM8), MHC-II (M5 / 114.15.2), CD45 (30-F11), CD3 (17A2), CD4 (GK1.5), CD8 (53-6.7), NK1.1 (PK136), CD45.2 (104), CD24 (30-F1), XCR1 (ZET), and CD64 (X54-5 / 7.1) were obtained from Biolegend. Antibodies against mouse Ly6G (1A8), CD16 / 32 (2.4G2), and CD103 (M290) were obtained from Biolegend. Antibodies against mouse Ly6G (1A8), CD16 / 32 (2.4G2), and CD103 (M290) were obtained from BD Biosciences. The antibody against mouse calreticulin (ab2907) was derived from Abcam. The live / dead dye (L34966) was derived from ThermoFisher.

[0128] Mice carrying B16F10 melanoma were euthanized and autopsied in accordance with federal, state, and local guidelines under animal protocols approved by the MIT Animal Care Committee and IACUC. The lymph nodes draining the tumor were then ground up, and the tumor sections were sectioned and digested with collagenase IV (1 mg / ml) for 1 hour to obtain a single-cell suspension. The single-cell suspension was filtered through a 70 μm nylon restrictor and stained as described. 10 .

[0129] The stained samples were analyzed using an FACS analyzer (LSR-II or LSR-II-Fortessa) from BD Biosciences. Analysis was performed on a BD-LSRII Fortessa analyzer. All flow cytometry data were analyzed using FlowJo (Flowjo LLC) and plotted using GraphPad Prism.

[0130] Construct, in vitro transcription, capping / methylation of replicon RNA and Neon transfection

[0131] The backbone of the mutant replicon construct was derived from in vitro evolution in a previous study (under revision). IL12-MSA and IL12-MSA-luminal proteins were amplified from plasmids in Professor Dane Wittrup's laboratory and engineered in subgenomic regions of the mutant replicon.

[0132] Following the manufacturer's instructions, in vitro transcription (IVT) of replicon RNA was performed from the template of the linearized VEE construct described above using the MEGAscript™ T7 Transcription Kit (ThermoFisher). The resulting replicon RNA was capped and methylated using the ScriptCap™ m7G Capping System and the ScriptCap™ 2'-O-methyltransferase Kit (Cellscript), following the manufacturer's instructions. RNA purity was assessed by gel electrophoresis.

[0133] In vitro transfection was performed using 5 μg RNA per 500,000 cells in 100 μl R buffer of the NEON Electroporation Kit (ThermoFisher) at 1200 voltage, 20 ms and 1 pulse.

[0134] Encapsulation of lipid nanoparticle formulations and replicon RNA

[0135] To encapsulate 10 μg of replicon RNA into DOTAP nanoparticles, a lipid mixture consisting of 16.9375 μl DOTAP (Avanti, Cat#890890, 10 mg / ml), 15.965 μl DSPC (Avanti, Cat#850365, 3 mg / ml), 18.7675 μl cholesterol (Sigma-Aldrich, Cat#C8667, 6 mg / ml), and 13.6 μl DSPE-PEG2000 (Avanti Cat#880128, 2.5 mg / ml) in ethanol at a molar ratio of 40:10:48:2 was prepared and evaporated under N2 until one-third of the total initial volume remained. Then, using a pipette, add 10 μg of replicon RNA (1 mg / ml) to 11.8 μl of 0.1 M citrate buffer (pH 6.0), followed by another 22 μl of 0.1 M citrate buffer (pH 6.0). Shake the mixture for one hour, and then dialyze it against PBS for one hour at 25°C in a 3,500 MWCO dialysis chamber.

[0136] Encapsulate the replicon RNA into liposome nanoparticles according to the instructions of the Lipofectamine™ MessengerMAX™ transfection reagent (thermofisher.com / order / catalog / product / LMRNA008).

[0137] To encapsulate 10 μg of replicon RNA into TT3 nanoparticles, a molar ratio of 20:30:40:0.75 of 10 μl TT3 (10 mg / ml) was prepared in 10.437 μl ethanol. 11 A lipid mixture consisting of 8.04 μl DOPE (Avanti, Cat#850725, 10 mg / ml), 5.572 μl cholesterol (Sigma-Aldrich, Cat#C8667, 10 mg / ml), and 3.452 μl C14-PEG2000 (Avanti, Cat#880150, 2 mg / ml) was prepared. 4.167 μl citrate buffer (pH 3.0, 10 mM) was added to the mixture. Then, 10 μg of replicon RNA (1 mg / ml) in 31.667 μl citrate buffer (pH 3.0, 10 mM) was added via pipette. The mixture was dialyzed against PBS for 80 min at 25°C in a 3,500 MWCO dialysis chamber.

[0138] The obtained lipid nanoparticles carrying replicons were aliquoted at appropriate doses for intratumoral injection (10 μg / mouse) and in vitro transfection (5 μg / 500,000 cells in 500 μl of culture medium).

[0139] Annexin V / PI staining, ATP assay and ELISA

[0140] Annexin V / PI staining was performed according to the instructions of the Biolegend kit (Cat#640932). Extracellular ATP was analyzed using the ENLITEN® ATP Assay System (Promega). HMGB1, CCL5, IFNα2, IL12, and IFNγ were measured using ELISA kits from Chondrex (Cat#6010, HMGB1), R&D System (Cat#DY478, CCL5), Abcam (Cat#ab215409, IFNα2), and Biolegend (Cat#88-7121-88, IL12, Cat#88-7314-88, IFNγ) according to their respective manuals.

[0141] RNA extraction and quantitative PCR analysis

[0142] To quantify RNA transcriptome levels, total RNA was extracted from cells or tumors transfected with LNP replicon RNA as instructed and reverse transcribed using the TaqMan™ Reverse Transcription Kit (ABI catalog number N8080234). The RNA was then amplified using Sybr GreenMaster Mix (Roche) and specific primers for Stat1 (Cat#MP215434), Stat2 (Cat#MP215434), IRF9 (Cat#MP206708), IRF3 (Cat#MP206702), and cGAS (Cat#MP214711), and detected by the Roche LightCycler. Ct values ​​were normalized to housekeeping mouse actin B for comparison.

[0143] Example 1: Synthetic All-in-One LNP Replicon RNA for Cancer Immunotherapy

[0144] Synthetic multifunctional lipid nanoparticles (LNPs) encapsulating replicon RNA can simplify the therapeutic process and enhance therapeutic efficacy. The lipid and RNA components each play multiple roles: a lipid formulation that promotes cellular uptake / cytosol delivery of RNA and directly triggers immunogenic cell death. Simultaneously, the LNP provides self-amplified replicon RNA that encodes immunomodulatory therapeutic proteins and directly provides immune stimulation, amplifying the subsequent immune response. Functionally, the synthetic LNP replicon RNA should induce local immunogenic cell death in tumors and appropriately express immunomodulation in transfected cells. Immunogenic cell death can enhance the invasion of immune cells into tumors and provide a reservoir of tumor-specific antigens that can be cross-presented to elicit novel T-cell responses. LNP formulations containing the cationic lipid TT3 were identified as particularly relevant to these goals: three cationic lipid nanoparticles were compared, each containing a key cationic lipid—DOTAP, liposomes (Lipo), or TT3. As RNA cargo, an alphavirus replicon derived from Venezuelan equine encephalitis virus was used, in which its structural proteins were replaced by cargo genes of interest inserted under a subgenomic promoter. When formulated with this self-amplifying replicon RNA (LNP-mtRep), DOTAP, lipid, and TT3 lipid formulations formed nanoparticles with average diameters of 97 nm, 46 nm, and 105 nm, respectively, and zeta potentials of +22.9 mV, -6.7 mV, and +4.3 mV, respectively. Figure 1G-Figure 1H The toxicity of “empty” and RNA-loaded (mtRep) LNPs was evaluated in vitro by incubating each formulation with B16F10 melanoma tumor cells. This assay showed that cell viability was significantly reduced by treatment with TT3 LNPs, and that mtRep synergistically promoted further tumor cell killing 3 days post-transfection with TT3. Figure 1A TT3 LNPs were more effective than DOTAP or Lipo in promoting tumor cell death. Notably, direct electroporation of the replicon into tumor cells was relatively non-toxic, suggesting that LNP delivery promoted cell killing. To determine whether TT3 LNP-delivered replicons could drive cargo gene expression prior to cell death, we evaluated the expression of the reporter gene GFP after LNP (mtRep) treatment. TT3-mtRep treatment resulted in ~35.4% of B16F10 cells expressing GFP at 12 hours post-transfection, lower than electroporation (~90%), but significantly better than DOTAP-mtRep (~0.05%) or Lipo-mtRep (~7.6%) treatment. Figure 1B ).and Figure 1A Consistently, cells transfected with TT3 nanoparticles showed a large number of annexin V+ / PI+ dead cells, and mtRep again synergized with this cell death. Figure 1C ).

[0145] To determine whether TT3 (mtRep)-triggered cell death is an immunogenic cell death (ICD), calreticulin (CRT), which normally resides on the endoplasmic reticulum (ER) and is transported to the cell surface as an eat-me signal during ICD1, was measured. TT3 and mtRep synergistically promote CRT transport to the cell surface. Figure 1D During ICD, extracellular ATP activates NLRP3 inflammasome 2, and extracellular HMGB1 mediates inflammation. 3 TT3, TT3-mtRep, and TT3-deRep effectively induce the release of ATP and HMGB1. Figure 1E and 1F In summary, TT3-mtRep RNA is a promising oncolytic agent that can induce immunogenic cell death while also leading to transient expression of cargo genes encoded by replicons.

[0146] Example 2: Replicon RNA triggers TLR3 signaling and induces ISGF3 reactivation associated with necrotic cell death. Compounds

[0147] To determine the mechanism of synergistic cell death between the replicon and TT3 LNP, DOTAP, Lipo, or TT3 nanoparticles encapsulating mtRep (with or without a reporter gene encoding a mutant "dead" replicon lacking functional gene expression) were transfected into reporter cells HEK-TLR2, HEK-TLR3, HEK-TLR7, or HEK-TLR9 (invivogen.com). Lipo and TT3 LNPs carrying mtRep or deRep activated TLR3 signaling, but TLRs in other assays were not stimulated. Figures 2A-2D When tested on Raw-Lucia-ISG reporter cells (invivogen.com), these same LNP formulations significantly induced interferon-stimulated genes (…). Figure 2E These data indicate that TLR3 recognizes replicon RNA and induces an interferon response in response to LNP-mediated delivery.

[0148] Because the replicon RNA activates TLR3 signaling via TRIF to produce type I interferon. 4 This leads to the activation of the ISGF3 (Stat1 / Stat2 / IRF9) complex, resulting in necrotic cell death. 5Therefore, we used qPCR to detect the mRNA transcription levels of ISGF3 complex components Stat1, Stat2, and IRF9, as well as STING pathway genes IRF3 and cGAS. TT3 nanoparticles encapsulating mtRep or deRep increased Stat1, Stat2, and IRF9 levels by ~6, ~16, and ~3 times, respectively, compared to the untreated control. Figures 2F-2H Conversely, it has no effect on the transcription of IRF3 or cGAS. Figures 2I-2J The failure of DOTAP and Lipo formulations to induce the ISGF3 complex may be due to the low transfection efficiency of these nanoparticles for replicon RNA. Figure 1B These data suggest that mtRep and deRep may activate TLR3 signaling and induce the ISGF3 complex to promote necrotic cell death, an immunogenic form of cell death.

[0149] Example 3: TT3-mtRep recruits immune cells and induces regression of established tumors.

[0150] Whether TT3-mtRep affects immunogenic cell death and the expression of cargo genes in vivo is of interest. Ly6c lo Ly6G + The absolute number of granulocytes and their response to necrotic cell death 6 Relatedly, measurements were taken in the tumor 3 days after intratumoral injection of TT3 nanoparticles encapsulating wild-type replicon RNA (wtRep), another mutant replicon RNA (mt2Rep), and the mutant replicon RNA (mtRep) used above. Unexpectedly, mtRep showed significantly greater (~2-fold) recruitment of this granulocyte population to the tumor. Figure 3A ), and better expression of the reporter gene mCherry encoded by the subgenomic promoter ( Figure 3B Therefore, TT3-mtRep induces immunogenic cell death through appropriate cargo gene expression. In vivo studies using TT3-mtRep were subsequently conducted.

[0151] The in vivo expression levels of Stat1 / Stat2 / IRF9, as well as the STING signaling genes IRF3 and cGAS, were measured after intratumoral LNP delivery of the replicon. (Compared with in vitro...) Figure 2F - Consistent with J, tumors injected with TT3-mtRep showed significantly higher expression of Stat1 / Stat2 / IRF9 (ISGF3 complex), but the levels of IRF3 and cGAS were comparable. Figure 3C This indicates that the administration of TT3-mtRep also induces necrotic cell death in vivo.

[0152] To better understand the impact of TT3-mtRep on tumor immune composition, immune cells such as granulocytes (CD45) + CD11b + Ly6c lo Ly6G + M-MDSC (CD45) + CD11b + Ly6c hi Ly6G + ), mononuclear cells (D45) + CD11b + Ly6c lo Ly6G - ), macrophages (CD45) + CD11b + Ly6c - Ly6G - F4 / 80 + CD4 T (CD45) + CD3ε + CD4 + CD8 T (CD45) + CD3ε + CD8 + NK (CD45) + CD3ε - NK1.1 + ), NKT (CD45) + CD3ε + NK1.1 + ), conventional DC1 (cDC1, CD45) + CD11c + MHC-II + CD24 + CD64 - CD103 + CD11b - XCR1 hi ), and the conventional DC2 (cDC2, CD45) + CD11c + MHC-II + CD24 + CD64 - CD103 + CD11b + XCR1 lo ), on day 1 after one injection ( Figure 3D ) and the 3rd day ( Figure 3EOn day 1 following three consecutive injections of LNP-replicon RNA, the location and quantification of immune cells in the tumor were performed. In the dynamic analysis of tumor immune composition, granulocytes and cDC1 rapidly recruited and decreased on day 1 after replicon RNA injection, respectively. Figure 3C This suggests that granulocytes may be an early event, and cDC1 may initiate transport to tumor draining lymph nodes (TDLNs) in response to LNP replicon RNA. Three days after replicon RNA injection, CD4 T, CD8 T, NK, and NKT cells were also recruited. Figure 3D When LNP replicon RNA was injected three times consecutively, monocytes increased and macrophages decreased, but changes were less pronounced in lymphocytes (such as CD4 T, NK, and NKT cells). Figure 3E Due to the effects of these ~3 consecutive injections, cell death increased by ~10% (). Figure 3F The number of tumor-infiltrating immune cells increased by approximately 4 times. Figure 3G The tumor weight in the TT3-mtRep group samples was reduced by 2-fold. Figure 3H This leads to significant regression in tumor growth. Figure 3I Consistent with NK cells, NKT cells appeared upon treatment with TT3-mtRep, and CCL5 expression was significantly induced. Figure 3I ), mainly composed of NK 7 And activated CD8 T cell secretion (rstats.immgen.org / Skyline / skyline.html). These data indicate that TT3-mtRep induces immunogenic cell death in tumors and expresses cargo genes observed in vitro as shown in Figures 1 and 2. Most importantly, TT3-mtRep significantly modulates the tumor microenvironment and leads to tumor recruitment of CD8 T cells and NK cells.

[0153] Example 4: Effective regulation of tumor microenvironment using TT3-mtRep encoded by IL12-MSA or IL12-MSA-luminal protein. Environmental and immune components

[0154] While intratumoral injection of TT3(mtRep), which encodes a reporter gene alone, leads to delayed tumor growth, encoding an immunomodulatory protein in the replicon may result in further immune stimulation and enhanced antitumor immunity. An attractive candidate is IL-12, which can polarize CD4 T helper cells to Th1 and enhance the cytotoxicity of NK and CD8 T cells. 8 A subunit of IL-12, also known as IL-12b or IL-12p40, is primarily secreted by antigen-presenting cells (CD8). + DCs (rstats.immgen.org / Skyline / skyline.html) can be detected by type I interferon. 9Functional activation. However, interferon α2 (IFNα2) is the predominant form of type I interferon, and serum levels were significantly lower on days 1 and 3 after TT3-mtRep injection. Figure 4A ) or tumor ( Figure 4B The low levels of IL-12 in DCs suggest that IL-12 secreted by dendritic cells (DCs) may remain low in the tumor microenvironment (TME). Therefore, we designed IL-12-MSA or IL-12-MSA-luminal protein conjugates by fusing IL-12α (P30) and IL-12β (P40) with mouse serum albumin (MSA) or MSA with luminal protein. Luminal protein is an endogenous collagen-binding protein, which we hypothesized would promote the retention of expressed IL-12 in the TME, thereby improving the efficacy and safety of replicon therapy. The replicon construct was transfected into B16F10 cells in vitro via NEON transfection, and we validated IL-12 secretion in these transfected cells using ELISA. Figure 4C ).

[0155] Consistently, tumors injected with TT3-mtRep encoding IL12-MSA (TT3-mtRep-IL12-MSA) or IL12-MSA-luminal protein (TT3-mtRep-IL12-MSA-Lumican) expressed high levels of IL12 in vivo, reaching 40 ng / mg within the tumor. Figure 4D The immune composition of tumors on day 1 post-injection was compared with that obtained using the reporter gene mCherry (). Figure 4E In contrast to the group treated with TT3-mtRep encoding IL12-MSA, granulocytes increased 1.5–3 times in tumors treated with TT3-mtRep expressing IL12-MSA and IL12-MSA-luminal protein. On day 3, compared to the replicon encoding an unrelated reporter gene, the IL12-MSA and IL12-MSA-luminal protein group recruited approximately 2–3 times more granulocytes, CD8 T cells, and cDC2 cells to the tumor. Figure 4F Interestingly, compared to the untreated group, tumors treated with TT3-mtRep encoding the reporter gene, IL12-MSA, or IL12-MSA-luminal protein all showed a reduction in cDC1 cells. Figures 4E-4F To determine whether cDC1 was transported to the TDLN, we counted the cDC1 cells within it and showed that regardless of what cargo gene was encoded ( Figure 4G The number of cDC1 cells in lymph nodes increased significantly after TT3-mtRep treatment. The number of cDC1 cells continued to increase in the IL12-MSA group. Figure 4G ).

[0156] Example 5: TT3-mtRep-induced immunomodulatory IL12 and ICD effectively eradicate B16F10 tumors

[0157] Because administration of IL12 protein has shown serious side effects in clinical studies, we measured the change in body weight in tumor-bearing mice treated with replicon-encoded IL-12. The mtRep-IL12-MSA group experienced approximately 5% body weight loss over one week. In contrast, the mtRep and mtRep-IL12-MSA-luminal protein groups showed only about 2% body weight loss, which recovered within a few days. Figure 5A Consistently, we were unable to measure serum IL-6 or TNFα on day 1 or day 3 following injection of mtRep-IL12-MSA or mtRep-IL12-MSA-luminal protein (data not shown). However, we did observe a significant increase in serum IFN-γ in the mtRep-IL12-MSA group. Figure 5B ),and Figure 5A The body loss was consistent. Interestingly, replicons expressing IL12-MSA or IL12-MSA-luminal protein showed significant tumor regression, even for tumors as small as 50 mm at the time of treatment. 2 Large established tumors ( Figure 5C Tumor-bearing mice treated with TT3-mtRep, encoding IL12-MSA and IL12-MSA-luminal proteins, showed 60% and 80% tumor-free rates, respectively, 75 days after B16F10 injection. To determine whether these cured mice elicited a systemic immune response that could prevent B16F10 tumor recurrence, these mice were challenged contralaterally with 100,000 B16F10 cells. As expected, all cured mice rejected B16F10 tumors compared to naive mice that rapidly developed B16F10 tumors. These data suggest that the synergistic effect of immunomodulatory IL12 and ICD (immunogenic cell death) can effectively eradicate B16F10 tumors and induce a systemic immune response to prevent B16F10 tumor recurrence.

[0158] References:

[0159]

[0160] Other implementation methods

[0161] All features disclosed in this specification can be combined in any combination. Each feature disclosed in this specification can be used to replace alternative features for the same, equivalent, or similar purposes. Therefore, unless otherwise expressly stated, each disclosed feature is merely an example of a general series of equivalent or similar features.

[0162] From the above description, those skilled in the art can readily determine the essential features of the present invention, and various changes and modifications can be made to the present invention to adapt to various uses and conditions without departing from the spirit and scope of the invention. Therefore, other embodiments are also within the scope of the claims.

[0163] Equivalent solution

[0164] While several inventive embodiments have been described and illustrated herein, those skilled in the art will readily conceive of various other means and / or structures for implementing the functionality and / or obtaining the results and / or one or more advantages described herein, and each of such variations and / or modifications is considered to be within the scope of the inventive embodiments described herein. More generally, those skilled in the art will readily understand that all parameters, dimensions, materials, and configurations described herein are intended to be exemplary and that actual parameters, dimensions, materials, and / or configurations will depend on the specific application using the teachings of the invention. Those skilled in the art will recognize or be able to determine many equivalents of the particular inventive embodiments described herein using only conventional experimentation. Therefore, it should be understood that the foregoing embodiments are presented by way of example only, and that embodiments of the invention may be practiced in ways different from those specifically described and claimed within the scope of the appended claims and their equivalents. The inventive embodiments of this disclosure relate to each individual feature, system, article, material, kit, and / or method described herein. Furthermore, any combination of two or more such features, systems, articles, materials, kits, and / or methods, provided that such features, systems, articles, materials, kits, and / or methods do not contradict each other, is included within the scope of the invention disclosed herein.

[0165] All definitions defined and used herein should be understood as control dictionary definitions, definitions incorporated by reference in other documents, and / or the general meaning of the defined terms.

[0166] All references, patents, and patent applications disclosed herein are incorporated by way of citation into each cited subject, and in some cases may include the entire document.

[0167] The indefinite articles “a” and “an” used in the specification and claims shall be understood as “at least one” unless explicitly stated otherwise.

[0168] The phrase “and / or” as used in the specification and claims should be understood to mean “one or two” of the elements so combined, i.e., elements that appear together in some cases and separately in others. Multiple elements listed with “and / or” should be interpreted in the same way, i.e., “one or more” of the elements connected in this way. In addition to the elements specifically identified by the “and / or” clause, other elements may optionally be present, whether related to or not related to those specifically identified. Thus, as a non-limiting example, when used in conjunction with open-ended language such as “comprising,” a reference to “A and / or B” may refer only to A in one embodiment (optionally including elements other than B); in another embodiment, only to B (optionally including elements other than A); in yet another embodiment, to both A and B (optionally including other elements); and so on.

[0169] As used herein in the specification and claims, “or” should be understood to have the same meaning as “and / or” as defined above. For example, when separating items in a list, “or” or “and / or” should be interpreted as inclusive, i.e., including at least one, but also multiple elements or multiple elements in the list, as well as (optionally) other items not listed. Only terms that explicitly indicate the opposite, such as “only… elements.” In general, the term “or” as used herein should only be interpreted as indicating an exclusive alternative (i.e., “one or the other but not both”), preceded by an exclusive term such as “either,” “one of,” “only one of,” or “exactly one of.” When used in the claims, “consisting mainly of…” should have the ordinary meaning in the field of patent law.

[0170] As used herein in the specification and claims, the phrase “at least one” in relation to a list of one or more elements should be understood to mean at least one element selected from any one or more elements in the following list of elements. However, it does not necessarily include at least one of each element specifically listed in the list of elements, and does not exclude any combination of elements in the list of elements. This definition also allows for the optional presence of elements other than those specifically identified in the list of elements referred to by the phrase “at least one,” whether related to or unrelated to those specifically identified elements. Thus, as a non-limiting example, “at least one of A and B” (or equivalently, “at least one of A or B”, or equivalently, “at least one of A and / or B”) could mean, in one embodiment, at least one, optionally including more than one A, with no B (and optionally including elements other than B); in another embodiment, at least one, optionally including more than one B, with no A (and optionally including elements other than A); in yet another embodiment, at least one, optionally including more than one A, and at least one, optionally including more than one B (and optionally including other elements); and so on.

[0171] It should also be understood that, unless explicitly stated otherwise, in any method claimed herein, which includes more than one step or action, the order of the steps or actions of the method is not necessarily limited to the order in which the steps or actions of the method are described.

Claims

1. A composition comprising: (i) Lipid nanoparticles comprising N1,N3,N5-tris(3-(bis(dodecylamino)propyl)phenyl-1,3,5-tricarboxamide (TT3); and (ii) An alphavirus replicon RNA comprising: (a) sequences encoding the alphavirus nonstructural proteins (nsP) nsP1, nsP2, nsP3, and nsP4, and (b) a sequence encoding the interleukin (IL)-12 molecule. The alphavirus replicon RNA is encapsulated by the lipid nanoparticles.

2. The composition according to claim 1, wherein the alphavirus replicon RNA is derived from Venezuelan equine encephalitis virus (VEE), chikungunya virus (CHIK), Semliki forest virus (SF), or Sindbis virus (SIN).

3. The composition according to claim 1 or 2, wherein the sequence encoding the IL-12 molecule is located in a subgenomic region of the alphavirus replicon RNA.

4. The composition according to any one of claims 1-3, wherein the alphavirus replicon RNA comprises at least 90% identical nucleotide sequence to SEQ ID NO:

1.

5. The composition according to any one of claims 1-4, wherein the lipid nanoparticles further comprise (i) phosphatidylcholine; (ii) cholesterol; (iii) polyethylene glycol (PEG) lipid conjugate; or a combination of two or more of (i)-(iii).

6. The composition according to any one of claims 1-5, wherein the lipid nanoparticles further comprise (i) 1,2-dioleoyl-sn-glycerol-3-phosphoethanolamine (DOPE); (ii) cholesterol; (iii) 1,2-dimyristoyl-sn-glycerol-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000 (C14-PEG2000); or a combination of two or more of (i)-(iii).

7. The composition according to any one of claims 1-6, wherein the lipid nanoparticles further comprise 1,2-dioleoyl-sn-glycerol-3-phosphoethanolamine (DOPE) and cholesterol.

8. A pharmaceutical composition comprising the composition according to any one of claims 1-7 and a pharmaceutically acceptable carrier.

9. The pharmaceutical composition according to claim 8, further comprising 1,2-dimyristoyl-sn-glycerol-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000 (C14-PEG2000).

10. The pharmaceutical composition according to any one of claims 8-10, wherein the pharmaceutical composition is formulated for intratumoral injection, intramuscular injection, subcutaneous injection or intravenous injection.

11. The pharmaceutical composition according to any one of claims 8-10, wherein the pharmaceutical composition is formulated for intratumoral injection.

12. A kit comprising the composition according to any one of claims 1-7 and instructions for administering the composition to a subject in need.

13. A method for preparing a composition according to any one of claims 1-7, the method comprising loading alphavirus replicon RNA into lipid nanoparticles.

14. The composition according to any one of claims 1-7 or the pharmaceutical composition according to any one of claims 8-11, for use in treating a subject in need.

15. The composition of claim 14, wherein the cancer includes melanoma, breast cancer, colon cancer, squamous cell carcinoma, small cell lung cancer, non-small cell lung cancer, lung adenocarcinoma, lung squamous cell carcinoma, peritoneal cancer, hepatocellular carcinoma, gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, colorectal cancer, endometrial cancer or uterine cancer, salivary gland cancer, kidney cancer, prostate cancer, vulvar cancer, thyroid cancer, liver cancer, stomach cancer, squamous cell head and neck cancer, renal cell carcinoma, urothelial carcinoma or Hodgkin's lymphoma.

16. A method of treating cancer in a subject in need, the method comprising administering to the subject a composition comprising: (i) Lipid nanoparticles comprising N1,N3,N5-tris(3-(bis(dodecylamino)propyl)phenyl-1,3,5-tricarboxamide (TT3); and (ii) An alphavirus replicon RNA comprising: (a) sequences encoding the alphavirus nonstructural proteins (nsP) nsP1, nsP2, nsP3, and nsP4, and (b) a sequence encoding the interleukin (IL)-12 molecule. The alphavirus replicon RNA is encapsulated by the lipid nanoparticles.

17. The method of claim 16, wherein the alphavirus replicon RNA is derived from Venezuelan equine encephalitis virus (VEE), chikungunya virus (CHIK), Semliki forest virus (SF), or Sindbis virus (SIN).

18. The method of claim 16, wherein the sequence encoding the IL-12 molecule is located in a subgenomic region of the alphavirus replicon RNA.

19. The method of claim 16, wherein the lipid nanoparticles further comprise (i) 1,2-dioleoyl-sn-glycerol-3-phosphoethanolamine (DOPE); (ii) cholesterol; (iii) 1,2-dimyristoyl-sn-glycerol-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000 (C14-PEG2000); or a combination of two or more of (i)-(iii).

20. The method of claim 16, wherein the composition further comprises 1,2-dimyristoyl-sn-glycerol-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000 (C14-PEG2000).

21. The method of claim 16, wherein the composition is administered to the subject via intratumoral injection, intramuscular injection, subcutaneous injection, or intravenous injection.

22. The method of claim 16, wherein the composition is administered intratumorally to the subject.

23. The method according to any one of claims 16-22, wherein the cancer includes melanoma, breast cancer, colon cancer, squamous cell carcinoma, small cell lung cancer, non-small cell lung cancer, lung adenocarcinoma, lung squamous cell carcinoma, peritoneal cancer, hepatocellular carcinoma, gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, colorectal cancer, endometrial cancer or uterine cancer, salivary gland cancer, kidney cancer, prostate cancer, vulvar cancer, thyroid cancer, liver cancer, stomach cancer, squamous cell head and neck cancer, renal cell carcinoma, urothelial carcinoma or Hodgkin's lymphoma.

Citation Information

Patent Citations

  • Polylactide-drug mixtures

    US3773919A

  • Synthetic phosphatidyl cholines useful in forming liposomes

    US4485045A

  • Liposomes containing modified cholesterol for organ targeting

    US4544545A

  • Liposomes with enhanced circulation time

    US5013556A