A method for constructing a single-cell multi-modal sequencing library

By constructing multimodal sequencing libraries containing ATAC-seq, CUT&Tag-seq, and RNA-seq at the single-cell level, the problems of limited information acquisition and high cost in existing technologies are solved, and efficient and convenient multi-dimensional analysis and high-throughput sequencing are achieved.

CN122146852APending Publication Date: 2026-06-05PEKING UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
PEKING UNIV
Filing Date
2026-04-02
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

Existing single-cell sequencing technologies cannot fully obtain chromatin state and transcriptome information within the same cell. The wide variety of histone modifications requires multiple library constructions, resulting in high sample consumption and costs. Furthermore, the low throughput and reliance on customized sequencing processes lead to poor universality.

Method used

A single-cell multimodal sequencing library construction method was adopted. The cell nucleus was in situ labeled by Tn5 transposons and proteinA-Tn5 transposons. Combined with three rounds of single-cell index labeling and high-throughput sequencing, a library containing ATAC-seq, CUT&Tag-seq and RNA-seq information was constructed.

Benefits of technology

It enables efficient acquisition of multimodal information within the same cell, reduces costs and time, minimizes batch effects, simplifies operation, is suitable for general laboratories, and supports high-throughput cell analysis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122146852A_ABST
    Figure CN122146852A_ABST
Patent Text Reader

Abstract

The application belongs to the field of single cell sequencing, and discloses a construction method of a single cell multi-modal sequencing library, comprising the following steps: S1: preparing a cell nucleus suspension; S2: mixing each sample cell nucleus with a Tn5 transposome complex, and obtaining a cell nucleus containing sample barcode and ATAC-seq library fragment in situ labeling after transposition reaction; S3: mixing all sample cell nuclei, and then incubating them with different first antibodies and second antibodies in turn; adding a protein A-Tn5 transposome complex mixture, and obtaining a cell nucleus containing target barcode and CUT&Tag library fragment in situ labeling after transposition reaction; S4: mixing all cell nuclei, and performing reverse transcription reaction, and collecting RNA-seq library in situ reverse transcription cell nuclei; S5: after three rounds of single cell index labeling, the cell nuclei are divided into several sub-libraries; S6: sub-library cell lysis separates DNA and RNA, and constructs a DNA sequencing library and an RNA sequencing library containing ATAC-seq and CUT&Tag-seq information respectively. The single cell multi-modal sequencing library can obtain complete multi-omics data through high-throughput sequencing.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of single-cell sequencing technology and relates to a method for constructing a single-cell multimodal sequencing library, specifically a method for constructing a library that simultaneously detects chromatin accessibility, histone modifications, and gene expression profiles at the single-cell level. Background Technology

[0002] Currently, the mapping of human cell biomolecules through multiple omics, exemplified by the Human Cell Atlas project, is gradually becoming a new engine for biomedical scientific discovery. Acquiring novel, high-quality single-cell data is a crucial foundation and pathway for generating new concepts and knowledge, and improving healthcare capabilities. Among various omics approaches, the epigenome and transcriptome respectively carry gene regulatory and expression information. Chromatin accessibility information, represented by transposase-accessible chromatin (ATAC) sequencing, and histone modification information, represented by cut-and-tag (CUT&T) sequencing, are two core modalities defining the epigenome. Together with gene expression information, represented by RNA sequencing, they constitute a complete epigenetic regulation and gene expression chain. Completely capturing information from these three modalities is a vital pathway for systematically elucidating the mechanisms of gene expression regulation and cell identity determination under normal physiological and pathological conditions. However, current single-cell sequencing technologies still have the following shortcomings:

[0003] 1. Limited detection modalities: Many protocols can only detect one or two omics information (such as ATAC+RNA, CUT&Tag+RNA or ATAC+ CUT&Tag), and cannot comprehensively obtain chromatin status (chromatin accessibility, histone modification) and transcriptome information in the same cell.

[0004] 2. Histone modifications are diverse. To obtain data on multiple histone modifications, multiple samples need to be processed, and multiple cuts and taggings are required for library construction. This results in: 1) wasting samples, especially valuable samples; 2) wasting manpower, as multiple library constructions are labor-intensive; 3) incurring costs; and 4) introducing batch effects.

[0005] 3. Many solutions require specialized microfluidic equipment, resulting in low throughput and high cost;

[0006] 4. Low universality: Most protocols rely on customized sequencing workflows, while the amount of data required for a single sequencing run (6-100G) is far below the sequencer's throughput limit (>3000G).

[0007] Therefore, there is an urgent need for a method that can construct trimodal sequencing libraries of chromatin accessibility, multiple targeted histone modifications, and transcriptome information from multiple samples simultaneously within a single cell through simple operations. Summary of the Invention

[0008] This invention provides a method for constructing a single-cell multimodal sequencing library, aiming to solve the problem in the prior art that it is impossible to efficiently, easily and cost-effectively obtain chromatin accessibility, multiple specific histone modifications and transcriptome information at the single-cell level.

[0009] To achieve the above objectives, the technical solution of the present invention is as follows:

[0010] In a first aspect, the present invention provides a method for constructing a single-cell multimodal sequencing library, comprising the following steps:

[0011] Step S1: Preparation of cell nucleus suspension

[0012] Single cells of the sample to be tested were fixed and washed, then lysed, centrifuged, washed, and resuspended in buffer to obtain a cell nucleus suspension.

[0013] Step S2: In-situ labeling of ATAC-seq library fragments

[0014] The cell nuclei of each sample obtained in step S1 were mixed with the Tn5 transposon complex, and after the first transposon reaction, they were centrifuged and washed to obtain cell nuclei labeled with sequencing adapters and sample-specific barcodes.

[0015] Step S3: In-situ labeling of CUT & Tag library fragments

[0016] After processing all cell nuclei in step S2, the samples were mixed and divided into several portions. Each portion was incubated with a different primary antibody and then incubated with a secondary antibody. The protein A-Tn5 transposon complex was then added and mixed to perform a second transposon reaction. After centrifugation and washing, cell nuclei labeled with sequencing adapters and target-specific bars were obtained.

[0017] Step S4: In situ reverse transcription of RNA-seq library

[0018] The cell nuclei processed in step S3 were mixed, reverse transcribed, centrifuged and washed, and the cell nuclei were collected.

[0019] Step S5: Three rounds of single-cell index labeling

[0020] The cell nuclear suspension after step S4 was mixed with T4 ligase mixture and aliquoted into multi-well plates containing index adapters. After reaction, blocker primers were added to terminate unreacted index adapters. After centrifugation and washing, index labeling was repeated twice. All cells were collected and aliquoted into several sub-libraries.

[0021] Step S6: Sequencing Library Construction

[0022] Multiple sub-library cells were selected according to the expected goals. DNA and RNA were separated. DNA sequencing libraries containing ATAC-seq and CUT&Tag-seq information were constructed using the DNA-containing fractions, and RNA sequencing libraries were constructed using the RNA-containing fractions.

[0023] Preferably, the Tn5 transposon complex is a protein-DNA complex of the Tn5 sample adapter; the Tn5 sample adapter is prepared by annealing the Sample linker1 adapter with sample-specific barcode as shown in SEQ ID NO: 1, the TruRead1 sequencing adapter as shown in SEQ ID NO: 2, and the MEcomp adapter as shown in SEQ ID NO: 3.

[0024] Preferably, the system used for the first transposition reaction is a 1×ATAC-seq reaction buffer prepared from 33mM Tris-HAc (pH 7.2), 66mM KAc, 10mM MgCl2, 16% DMF, 0.1% NP-40, 1×PIC, and 0.4U / mL ERI.

[0025] Preferably, the proteinA-Tn5 transposon complex is a protein-DNA complex loaded with proteinA-Tn5 target adapter by proteinA-Tn5 transposase; the proteinA-Tn5 target adapter is prepared by annealing a Target linker1 adapter with a target-specific barcode as shown in SEQ ID NO: 4, a Read1 sequencing adapter as shown in SEQ ID NO: 5, and a MEcomp adapter as shown in SEQ ID NO: 3.

[0026] Preferably, the system used for the second transposition reaction is a tagmentation buffer prepared from 20 mM Tris-HCl (pH 7.5), 300 mM NaCl, 0.1% NP-40, 1×PIC, 0.04 U / mL ERI, 0.02 U / mL SRI, and 10 mM MgCl2.

[0027] Preferably, the sequence of the reverse transcription primer is shown in SEQ ID NO: 6.

[0028] Preferably, the premixed solution system for reverse transcription reaction comprises 60 μL 5× RT buffer, 15 μL 10 mM dNTPs, 12 μL 100 μM RT primers, 3 μL ERI, 3 μL SRI, 15 μL Maxima RTase, 96 μL PEG-6000 and 36 μL H2O.

[0029] Preferably, the procedure for the reverse transcription reaction includes: 50°C for 10 min; 8°C for 12 s, 15°C for 45 s, 20°C for 45 s, 30°C for 45 s, 42°C for 2 min, 50°C for 5 min, repeated 3 times; 50°C for 10 min; 12°C, remove the sample.

[0030] Preferably, the multi-well plate of the first round index is a 96-well plate, and the first round index connector is made by annealing the 96 Round 1 index primers with the sequence shown in SEQ ID NO: 7 with the linker1comp primer with the sequence shown in SEQ ID NO: 8; the blocker primer added in the first round has the sequence shown in SEQ ID NO: 9.

[0031] Preferably, the index connector in the second round is prepared by annealing the 96 Round2index primers with the linker2comp primer with the sequence shown in SEQ ID NO: 11; the blocker primer added in the second round has the sequence shown in SEQ ID NO: 12.

[0032] Preferably, the third round of index connectors is prepared by annealing the 96 Round3index primers (as shown in SEQ ID NO: 13) with the linker3comp primer (as shown in SEQ ID NO: 14) to form the blocker primer sequence (as shown in SEQ ID NO: 15) added in the third round.

[0033] Preferably, in the three-round index marking, each well of the 96-well plate is assigned a barcode.

[0034] Preferably, each sub-library contains 20,000 cells.

[0035] Preferably, the T4 ligase mixture is prepared from 550 μL of 10× T4 DNA ligase buffer, 55 μL of 10% NP-40, 2520 μL of H2O, 27.5 μL of T4 DNA ligase, and 27.5 μL of T7 DNA ligase.

[0036] Preferably, the separation of DNA and RNA includes first resuspending the cell nuclei in the sub-library with a termination buffer, performing cell nucleus lysis and decrosslinking, and then using MyOne C1 streptavidin magnetic beads to separate DNA and RNA from each sub-library; the termination buffer is prepared with 50mM Tris-HCl (pH 8), 50mM NaCl, 0.1% SDS, 0.2U / μL SRI, and 1mg / mL proteinase K.

[0037] Preferably, the DNA library is constructed by recovering the DNA from the DNA-containing portion and performing DNA PCR amplification using primers with sublibrary indexes, such as P5-i5-TruRead1 (SEQ ID NO: 16), P5-i5-Read1 (SEQ ID NO: 17), and P7 (SEQ ID NO: 18).

[0038] Preferably, the DNA PCR amplification reaction system includes 25 μL 2× NEB Next Master Mix, 22 μL DNA, 1 μL 25 μM P5-i5-TruRead1 primer, 1 μL 25 μM P5-i5-Read1 primer and 1 μL 25 μM P7 primer.

[0039] Preferably, the DNA PCR amplification program is as follows: 72℃ extension for 5 min, 98℃ denaturation for 30 s; 98℃ annealing for 10 s, 60℃ extension for 30 s, 72℃ extension for 1 min, 8-10 cycles; final extension at 72℃ for 5 min.

[0040] Preferably, the construction of the RNA library is achieved by using an RNA-containing oligonucleotide containing template replacement as shown in SEQ ID NO: 19 for template replacement reaction, followed by cDNA amplification and purification using P7 primers as shown in SEQ ID NO: 18 and RNA PCR primers as shown in SEQ ID NO: 20; then, cDNA from each sub-library is subjected to cDNA tagging and fragmentation reaction, and after purification of the reaction product, RNA PCR amplification is performed using P7 primers and P5-i5-Read1 primers containing the sub-library index.

[0041] Preferably, the template replacement reaction system comprises: 10 μL 5 × RT buffer, 5 μL 10 mM dNTPs, 1.25 μL TSO, 10 μL Ficoll PM-400, 5 μL SRI, 16 μL PEG-6000, and 2.5 μL Maxima RTase.

[0042] Preferably, the cDNA amplification reaction system comprises: 25 μL 2 × KAPA HiFi HotStartReadyMix, 1 μL 25 μM RNA-PCR primers, 1 μL 25 μM P7 primers, and 21 μL H2O.

[0043] Preferably, the cDNA amplification program is as follows: 95℃ pre-denaturation for 30s; 98℃ denaturation for 10s, 65℃ annealing for 45s, 72℃ extension for 3min, 8-10 cycles; 72℃ final extension for 5min.

[0044] Preferably, the cDNA tagging and fragmentation reaction system comprises: 50 ng cDNA, 33 mM Tris-HAc (pH 7.2), 66 mM KAc, 10 mM MgCl2, and 16% DMF.

[0045] Preferably, the RNA PCR amplification system comprises: 25 μL 2× NEB Next Master Mix, 23 μL cDNA eluted from the previous step, 1 μL 25 μM P5-i5-Read1 primer and 1 μL 25 μM P7 primer.

[0046] Preferably, the RNA PCR amplification program is as follows: 72℃ extension for 5 min, 98℃ denaturation for 30 s; 98℃ annealing for 10 s, 60℃ extension for 30 s, 72℃ extension for 1 min, 5 cycles; 72℃ final extension for 5 min.

[0047] Secondly, the present invention provides a non-diagnostic method for high-throughput sequencing of single-cell multimodal sequencing libraries, comprising: performing high-throughput sequencing on single-cell multimodal sequencing libraries constructed by the above method to obtain chromatin accessibility information, histone modification information and gene expression information to form complete multi-omics data.

[0048] Thirdly, the present invention provides a single-cell multi-omics analysis method for non-diagnostic purposes, comprising: the present invention provides a non-diagnostic method for performing the above-mentioned high-throughput sequencing; and performing bioinformatics analysis on the obtained chromatin accessibility information, histone modification information and gene expression information to form complete multi-omics data.

[0049] Compared with existing technologies, the beneficial effects of this solution are:

[0050] 1. Single-cell multidimensional analysis: It can obtain information on three modalities from the same cell: chromatin accessibility, specific histone modifications, and gene expression. Moreover, the sequencing quality (sequencing fragment count and signal-to-noise ratio) of each modality reaches the quality of single-cell single-omics, providing unprecedented depth for analyzing gene regulatory networks.

[0051] 2. While achieving breakthroughs in multi-dimensional analysis, it also enables high-throughput cell sequencing (theoretically tens of millions of cell tags), multi-sample sequencing, and multi-CUT & Tag type sequencing simultaneously. This allows multiple experiments required in a project to be completed in one experiment, greatly saving time and manpower, reducing costs, and also reducing batch effects caused by multiple experiments, which can bring about a change in research paradigm.

[0052] 3. Easy to operate: No special instruments are required, the experimental cycle is relatively short, and it is easy to promote and use in ordinary molecular biology laboratories. Attached Figure Description

[0053] Figure 1 This is a flowchart of a method for constructing a single-cell multimodal sequencing library according to the present invention;

[0054] Figure 2 This is a schematic diagram of the structure of the single-cell multimodal sequencing library constructed in this invention;

[0055] Figure 3 The images show the results of single-cell isolation from a mixed human and mouse cell line sample in Example 1 (A shows the separation effect of RNA carrying tags, B shows the separation effect of ATAC fragment carrying tags, and C shows a comparison of the separation effects of RNA and ATAC).

[0056] Figure 4 The following is a statistical analysis of the sequencing fragment counts and statistics of cell sample origin, RNA, ATAC, and CUT&Tag after tag splitting in Example 1 (A shows the sequencing fragment counts of RNA, ATAC, and CUT&Tag that can be detected by each single-cell tag; red values ​​indicate CUT&Tag types (the tag type of this cell) that are significantly higher than other types; B shows the proportion of all valid single cells in the two different cell types, the proportion in the four replicate samples, and the proportion of CUT&Tag types from left to right; C shows a violin plot of the number of molecules detected for each cell tag in different categories, and the counts that fall within genes or DNA peaks, with the median marked at the top).

[0057] Figure 5 The image shows a comparison of the ATAC / CUT&Tag signals in polymerized cells with those in conventional population cells in Example 1. Detailed Implementation

[0058] To facilitate understanding of the present invention by those skilled in the art, the technical solution of the present invention will be further described in detail below with reference to embodiments and accompanying drawings. Obviously, the described embodiments are merely some, not all, of the embodiments of the present invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort should fall within the scope of protection of the present invention.

[0059] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0060] like Figure 1 As shown, the present invention provides a method for constructing a single-cell multimodal sequencing library, comprising the following steps:

[0061] Step S1: Sample pretreatment and preparation of cell nucleus suspension

[0062] Obtain a single cell or nucleus suspension of the sample to be tested, fix and wash it with a cross-linking agent, and then resuspend it in a nuclear buffer for later use to ensure the homogeneity of the starting sample.

[0063] Step S2: In-situ labeling of fragments from the first ATAC-seq library

[0064] The cell nuclei obtained in step S1 were mixed with the Tn5 transposon complex to perform the first transposon reaction. After the reaction, unreacted transposons were removed by centrifugation and washing to obtain cell nuclei labeled with sequencing adapters and sample barcodes.

[0065] The Tn5 transposon complex is a protein-DNA complex loaded with Tn5 sample adapters via Tn5 transposase. The Tn5 sample adapters are prepared by annealing Sample linker1 adapters (SEQ ID NO: 1), TruRead1 sequencing adapters (SEQ ID NO: 2), and MEcomp adapters (SEQ ID NO: 3) containing sample-specific barcodes at concentrations of 25 / 25 / 50 μM, and then mixing them with an equal volume of 100% (v / v) glycerol. The Tn5 transposon complex cleaves open chromatin regions while simultaneously attaching the TruRead1 sequencing adapter and sample barcodes to both ends of the DNA fragment, thus providing the first layer of labeling for DNA in chromatin-accessible regions (accessibility information and sample origin information).

[0066] Step S3: In-situ labeling of the second group of learning (CUT&Tag) library fragments

[0067] After processing in step S2, all cell nuclei were mixed and divided into several portions, each incubated with a different primary antibody (such as H3K4me1, H3K4me3, H3K27ac, H3K27me3 antibody, etc.). The primary antibody binds to the target histone modification site. A secondary antibody is added to bind with the primary antibody, which amplifies the signal. A protein A-Tn5 transposon complex loaded with the sequencing adapter sequence is added to perform a second transposon reaction. After the reaction, unreacted transposons are removed by centrifugation and washing to obtain cell nuclei labeled with the sequencing adapter and target-specific barcode.

[0068] The proteinA-Tn5 transposon complex is a protein-DNA complex loaded with the proteinA-Tn5 transposase and containing a proteinA-Tn5 target adapter. The proteinA-Tn5 target adapter is prepared by annealing a Target linker1 adapter (SEQ ID NO: 4), a Read1 sequencing adapter (SEQ ID NO: 5), and a MEcomp adapter (SEQ ID NO: 3) containing a target-specific barcode at a concentration of 25 / 25 / 50 μM, and then mixing them with an equal volume of 100% (v / v) glycerol. The proteinA-Tn5 transposon complex simultaneously cleaves the target region and attaches the Read1 sequencing adapter and target barcode to both ends of the DNA fragment, thereby providing a second labeling of the DNA in specific histone-modified regions.

[0069] Step S4: In situ reverse transcription of the third-omics (RNA-seq) library

[0070] The cell nuclei processed in step S3 were mixed and subjected to reverse transcription to capture RNA information. After the reaction, the cell nuclei were collected by centrifugation and washing.

[0071] The reverse transcription primer (SEQ ID NO: 6) contains biotin modification, UMI, polydT, and linker1 sequences. Reverse transcription converts intracellular transcriptome information into cDNA with specific sequence ends, preparing it for subsequent amplification.

[0072] Step S5: Three rounds of single-cell index labeling

[0073] First round of index labeling: 96 Round1 index primers (SEQ ID NO: 7) were annealed with linker1comp primers (SEQ ID NO: 8) at 10 / 9 μM, 10 μL per well to form first round index adapters; the cell nuclear suspension treated in step S4 was mixed evenly with T4 ligase mixture to prepare ligation reaction working solution, which was then split into 96-well plates containing first round index adapters. After reacting for 30 minutes, blocker1 primers (SEQ ID NO: 9) were added to terminate any unreacted first round index adapters.

[0074] Second round index labeling: 96 Round2 index primers (SEQ ID NO: 10) were annealed with linker2comp primer (SEQ ID NO: 11) at 10 / 9 μM, 10 μL per well to form second round index adapters; cells labeled in the first round were collected together (pool), washed, and mixed evenly with T4 ligase mixture to prepare ligation reaction working solution, which was then allocated to 96-well plates containing second round index adapters. After reacting for 30 minutes, blocker2 primer (SEQ ID NO: 12) was added to terminate any unreacted second round index adapters;

[0075] Third round index labeling: 96 Round3 index primers (SEQ ID NO: 13) were annealed with linker3comp primer (SEQ ID NO: 14) at 10 / 9 μM, 10 μL per well to form third round index adapters; cells labeled in the second round were collected together (pool), washed, and mixed evenly with T4 ligase mixture to prepare ligation reaction working solution, which was then allocated to 96-well plates containing third round index adapters. After reacting for 30 minutes, blocker3 primer (SEQ ID NO: 15) was added to terminate the reaction of unreacted third round index adapters;

[0076] Single-cell labeling: Collect all cells, filter through a 40μm cell sieve to remove cell clusters, count cells, and then aliquot the cells into sub-libraries of 20,000 cells / tube and store at -80℃.

[0077] Through three rounds of combined labeling, all nucleic acid fragments (from ATAC, CUT&Tag and RNA) within each single cell are assigned a cell identity tag with a total of 96×96×96 combinations of the three rounds of indexes, where all ATAC, CUT&Tag and RNA from the same cell share the same cell identity tag.

[0078] Step S6: Sequencing library construction and high-throughput sequencing

[0079] A certain number of sub-library cells were selected according to the expected goals, lysed and decross-linked, and RNA / cDNA and DNA (from ATAC and CUT&Tag) were separated and constructed into libraries using MyOne C1 streptavidin magnetic beads.

[0080] DNA library construction: DNA was recovered from the supernatant and PCR amplification was performed using P5-i5-TruRead1 primers (SEQ ID NO: 16, amplifying the ATAC fragment), P5-i5-Read1 primers (SEQ ID NO: 17, amplifying the CUT&Tag fragment), and P7 primers (SEQ ID NO: 18) with sub-library indexes to construct a DNA sequencing library containing ATAC-seq and CUT&Tag-seq information.

[0081] RNA library construction: The RNA / cDNA captured on the magnetic beads was washed, and a template replacement reaction reaction was performed in template replacement reaction buffer containing template replacement oligonucleotides (SEQ ID NO: 19) to synthesize complete cDNA strands. After the reaction, the cDNA was amplified using P7 primers and RNA PCR primers (SEQ ID NO: 20), and the cDNA was purified using SPRI magnetic beads. 50 ng of cDNA from each sub-library was subjected to a transposition reaction to fragment the DNA, and Read1 sequencing sequences were added. Finally, PCR amplification was performed using P7 primers and P5-i5-Read1 primers containing the sub-library index to construct the RNA sequencing library.

[0082] The obtained DNA sequencing libraries contain ATAC and CUT&Tag fragments that can be completely distinguished: the P5 end of the ATAC library is a TruRead1 adapter, and the P7 end is a specific sample barcode, which can simultaneously identify that the fragment comes from ATAC and a specific sample; the P5 end of the CUT&Tag library is a Read1 adapter, and the P7 end is a specific target barcode, which can identify that the fragment comes from a certain modification but cannot identify the sample origin; all samples are reverse transcribed under the same conditions, so the batch effect is low, but the RNA library does not contain sample information; the sample origin information of the CUT&Tag library and the RNA library is determined by mapping the cell identity information composed of their three rounds of indexes to the cell identity information of ATAC.

[0083] DNA and RNA / cDNA were separated, libraries were constructed, and sequencing was performed to obtain complete multi-omics data.

[0084] The core of the above method is as follows: for multiple samples, each sample is first barcode-marked using the ATAC experiment; then all samples are mixed, divided into several portions, and barcode-marked with different histone modifications using CUT&Tag; finally, all samples are mixed and reverse transcribed, and single-cell indexing is performed through three rounds of split-pooling; thus, high-throughput multi-omics identification is achieved with a relatively simple operation process.

[0085] The single-cell multimodal sequencing library constructed using the method of this invention can obtain three omics information from a single cell. For the first time, it achieves the co-detection of three different omics information—ATAC, CUT&Tag, and RNA—within the same cell nucleus. Utilizing orthogonal labeling combined with a combined tagging strategy for single-cell multimodal labeling, it enables simultaneous detection of multiple samples and multiple modifications. Instead of separately labeling each sample with different modifications using CUT&Tag, it first uses ATAC-seq for sample labeling, then mixes the samples and performs separate CUT&Tag detection for each sample, and finally performs an RNA reverse transcription reaction. This allows for the acquisition of ATAC-seq, multiple CUT&Tag, and RNA-seq information for each sample. This method is flexible and universal, requiring no expensive microfluidic equipment and can be operated using common multiwell plates and centrifuge tubes, making it easy to promote. It also has compatibility; the library structure is compatible with the popular PE150 sequencing mode, eliminating the need for separate sequencing program settings. The micro-libraries can be sent to commercial sequencing service providers for pooled sequencing, facilitating testing.

[0086] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments. It should be understood that the specific examples described herein are merely illustrative and not intended to limit the invention.

[0087] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0088] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0089] Example: Tri-omics library construction of mixed human and mouse cell lines

[0090] This embodiment details the entire process of constructing libraries using the method provided by the present invention, starting from sample preparation (a total of 4 human K562-mouse NIH3T3 cell mixed samples), including single-cell ATAC-seq, CUT&Tag (H3K4me1, H3K4me3, H3K9me3, H3K27ac, H3K27me3 and CTCF) and RNA sequencing.

[0091] To demonstrate that the method provided by this invention can measure multiple samples at once, this embodiment prepared 4 samples. To demonstrate that the method provided by this invention can effectively achieve single-cell level measurement, this embodiment prepared a mixed sample of humans and mice. To demonstrate that the method provided by this invention can measure multiple histone-modified CUTs and Tags at once, this embodiment also prepared 6 CUT and Tag types (5 histone modifications and 1 transcription factor). The specific library construction process is as follows:

[0092] 1. Buffer preparation and sample preparation

[0093] 1.1 Buffer preparation: The following buffer solutions need to be prepared for the experiment.

[0094] Neutral wash (NIB-wash) buffer: 10 mM Tris buffer (Tris-HCl, pH 7.5), 10 mM NaCl, 3 mM MgCl2, 0.1% (v / v) NP-40, 1× protease inhibitor mixture (PIC), 0.04 U / mL ERI (enzymatic RNase inhibitor), 0.02 U / mL SRI (superase RNase inhibitor).

[0095] 150-wash buffer: 20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 0.1% (v / v) NP-40, 1×PIC, 0.04 U / mL ERI, 0.02 U / mL SRI;

[0096] 300-wash buffer: 20 mM Tris-HCl (pH 7.5), 300 mM NaCl, 0.1% (v / v) NP-40, 1×PIC, 0.04 U / mL ERI, 0.02 U / mL SRI;

[0097] PBSI buffer: PBS buffer, 0.04 U / mL ERI, 0.02 U / mL SRI;

[0098] T4 ligase mixture (approximately 3300 μL): 550 μL 10× T4 DNA ligase buffer, 55 μL 10% (v / v) NP-40, 2520 μL H2O, 27.5 μL T4 DNA ligase, 27.5 μL T7 DNA ligase;

[0099] 1×ATAC-seq reaction buffer: 33mM Tris-HAc (pH 7.2), 66mM KAc, 10mM MgCl2, 16% (v / v) N,N-dimethylformamide (DMF), 0.1% (v / v) NP-40, 1×PIC, 0.4U / mL ERI;

[0100] Tagging buffer: 300-wash buffer, 10mM MgCl2;

[0101] Termination buffer: 50 mM Tris-HCl (pH 8), 50 mM NaCl, 0.1% (w / v) sodium dodecyl sulfate (SDS), 0.2 U / μL SRI, 1 mg / mL proteinase K;

[0102] 1× BWT buffer: 5mM Tris-HCl (pH 8), 1M NaCl, 0.5mM EDTA, 0.05% Tween-20;

[0103] 1× BWTRI buffer: 1× BWT buffer, 0.2 U / μL SRI;

[0104] 2 × BWRI buffer: 10 mM Tris-HCl (pH 8), 2 M NaCl, 1 mM EDTA, 0.4 U / μL SRI;

[0105] 1× STERI buffer: 10mM Tris-HCl (pH 8), 50mM NaCl, 1mM EDTA, 0.2U / μL SRI;

[0106] 1× cDNA tagmentation reaction buffer: 50 ng cDNA, 33 mM Tris-HAc (pH 7.2), 66 mM KAc, 10 mM MgCl2, 16% DMF;

[0107] Eluent: 10 mM Tris-HCl (pH 8.0);

[0108] "1×, 2×, 5× and 10×" represent 2, 5 and 10 times the standard working concentration (diluted to the manufacturer's recommended standard working concentration), the standard working concentration (1×) and the concentrate, respectively.

[0109] 1.2 Cell fixation and nuclear extraction: Fresh K562 and NIH-3T3 cells were resuspended and washed once with PBS buffer and counted. Cells were resuspended in PBSI buffer to 1 million cells / 1 mL of PBSI buffer, and formaldehyde was added to a final concentration of 0.1% (w / v). The cells were incubated at room temperature for 5 min, and the reaction was terminated by adding 0.1 M glycine. The cells were washed three times with PBSI buffer. Cells were lysed by adding pre-chilled NIB-wash buffer and placing them on ice for 10 min. The cells were centrifuged at 500 ×g for 5 min at 4 °C, the supernatant was discarded, and the cells were washed once with NIB-wash buffer. After counting, the cells were placed on ice for later use.

[0110] 2. ATAC-seq reaction

[0111] 2.1 Transposon Preparation: Prepare the corresponding Tn5 transposons according to the number of samples to be labeled. The transposon mixing system for each sample (based on 150,000 cells) is as follows: Tn5 transposase and the corresponding sample adapters (Sample1-Sample4) are mixed at a ratio of 1 μL: 0.4 μL and incubated at room temperature for later use; the Tn5 sample adapters involve the following sequences:

[0112] Samplelinker1 connector (SEQ ID NO: 1):

[0113] pCGAAACATCGGC[Sample]AGATGTGTATAAGAGACAG (p is a phosphate group, [Sample] is an 8bp barcode sequence);

[0114] TruRead1 sequencing adapter (SEQ ID NO: 2):

[0115] ACACTCTTTCCCTACACGACGCTCTTCCGATCTAGATGTGTATAAGAGACAG;

[0116] MEcomp linker (SEQ ID NO: 3): pCTGTCTCTTATACAddC (ddC is cytosine dideoxyribonucleotide).

[0117] 2.2 Take 300,000 K562 cell nuclei and 300,000 NIH-3T3 cell nuclei, mix them, divide them into 4 equal parts, and place them in the prepared 1×ATAC-seq reaction buffer. Incubate at 37°C and 300 rpm for 30 minutes.

[0118] 2.3 After the reaction is complete, immediately place the sample at 4°C and centrifuge at 300 ×g for 3 minutes. Carefully discard the supernatant and wash twice with NIB-wash buffer. Mix the cells from the four samples.

[0119] 3. CUT & Tag reaction

[0120] 3.1 Primary antibody incubation: Centrifuge the above-mixed sample (600,000 cells in total), resuspend the cells in 600 μL of 150-wash buffer, divide it into 6 equal portions for the detection of 6 modifications, each portion containing 100,000 cells, add 1 μg of primary antibody (H3K4me1, H3K4me3, H3K9me3, H3K27ac and H3K27me3, CTCF), and incubate at room temperature for 1 h or at 4°C overnight;

[0121] 3.2 Secondary antibody incubation: After incubation with the primary antibody, centrifuge the samples and discard the supernatant. Wash once with 100 μL of 150-wash buffer, resuspend in 100 μL of 150-wash buffer, add 2 μg of secondary antibody to each sample, and incubate at room temperature for 1 h.

[0122] 3.3 Preparation of protein A-Tn5 transposons: During secondary antibody incubation, protein A-Tn5 transposons for CUT&Tag were prepared. For samples of 100,000 cells, the transposon mixing system for each sample was as follows: protein A-Tn5 and the corresponding target adapter (e.g., Target01-Target06) were mixed at a ratio of 0.5 μL: 0.3 μL, gently pipetted to mix, and incubated at room temperature for 1 hour, then placed on ice for later use. The Tn5 sample adapters involve the following sequences:

[0123] Target linker1 connector (SEQ ID NO: 4):

[0124] pCGAAACATCGGC[Target]AGATGTGTATAAGAGACAG ([Target] is an 8bp barcode sequence);

[0125] Read1 sequencing adapter (SEQ ID NO: 5): TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG;

[0126] The MEcomp connector sequence is shown in SEQ ID NO: 3.

[0127] 3.4 Protein A-Tn5 transposon incubation: After secondary antibody incubation, centrifuge at 300 ×g for 3 minutes at room temperature and discard the supernatant. Wash once with 150-wash buffer, resuspend the cells in 100 μL of 300-wash buffer, add the protein A-Tn5 transposon incubated in step 3.3, and incubate at 25°C and 300 rpm for 1 hour.

[0128] 3.4 Tagmentation reaction: After transposon incubation, centrifuge at 300 ×g for 3 minutes at room temperature and discard the supernatant. Wash three times with 100 μL 300-wash buffer; resuspend the cell nuclei of each group with 100 μL Tagmentation buffer, place in a 37℃ thermal resuspending apparatus, and incubate at 300 rpm for 1 hour, gently pipetting once every 30 minutes during this period.

[0129] 4. Reverse transcription (RT) reaction

[0130] 4.1 Cell nucleus collection: After tagging, centrifuge at 300 ×g for 3 minutes at room temperature and discard the supernatant. Add 100 μL of NIB-wash buffer to each CUT&Tag reaction sample, wash twice, and discard the supernatant. Combine all sample cells into one tube with 100 μL of NIB-wash buffer, wash once with NIB-wash buffer, resuspend the cells in 60 μL of NIB-wash buffer, and place on ice for later use.

[0131] 4.2 Reverse transcription reaction: Prepare RT premix (based on 600,000 cells) in a total of 240 μL, including: 60 μL 5× RT buffer, 15 μL 10 mM dNTPs, 12 μL 100 μM RT primers, 3 μL ERI, 3 μL SRI, 15 μL Maxima RTase, 96 μL PEG-6000 and 36 μL H2O.

[0132] RT primer (SEQ ID NO: 6):

[0133] pCGAAACATCGGCCACNNNNNNNNNN / iBiodT / TTTTTTTTTTTTTTVN (iBiodT is biotin-modified thymine, N represents base A, T, C or G, and V represents base C, G or A)

[0134] Mix the above RT premix with the 60 μL cell nuclear suspension prepared in step 4.1, divide into 6 equal tubes (50 μL each), and place in a PCR instrument for reverse transcription reaction (50°C for 10 min; 8°C for 12 s, 15°C for 45 s, 20°C for 45 s, 30°C for 45 s, 42°C for 2 min, 50°C for 5 min, 3 cycles; 50°C for 10 min; 12°C, remove the sample).

[0135] 5. Three-round index marking

[0136] 5.1 First round of index marking (Round 1):

[0137] After RT, the cell nuclei in all tubes were merged, washed twice with NIB-wash buffer, and finally resuspended in 1100 μL NIB-wash buffer.

[0138] Mix the above-mentioned cell nuclear suspension with the prepared T4 ligase mixture evenly, transfer it to the sample well, use a pipette to draw 40 μL of the mixture and add it to the annealed first-round index adapter 96-well plate, carefully pipette to mix, and incubate at 300 rpm at room temperature for 30 minutes.

[0139] Add 10 μL of blocker1 primer to each well of the 96-well plate after the above reaction, mix well by pipetting, and incubate at room temperature for 30 minutes at 300 rpm.

[0140] After incubation, aspirate the solution from all wells using a multi-channel pipette and combine them into a sample tray placed on ice. Then transfer the mixture to 15 mL centrifuge tubes. Centrifuge at 500 ×g for 10 minutes at 4°C and discard the supernatant. Wash twice with NIB-wash buffer, then resuspend the cell nuclei in 1100 μL of NIB-wash buffer and place on ice for later use.

[0141] Round1index primer (SEQ ID NO: 7):

[0142] pCTCAAGCACGTGGAT[i1]AGTCGTACGCCGATG ([i1] is an 8bp barcode, with a total of 96 possible values).

[0143] linker1comp primers (SEQ ID NO: 8): GCCGATGTTTCGCATCGGCGTACGACT;

[0144] blocker1 primer (SEQ ID NO: 9): AGTCGTACGCCGATGCGAAACATCGGC.

[0145] 5.2 Index marking for the second and third rounds:

[0146] Repeat step 5.1, using annealed second-round (Round 2) and third-round (Round 3) index adapters and blockers for ligation and blocking, respectively. After the third round of incubation, filter the combined solution through a 40 μm cell sieve, centrifuge at 500 ×g for 10 minutes at 4°C, and discard the supernatant. Wash twice with 100 μL NIB-wash buffer, count the cells, and divide the nuclei into several sub-libraries (each sub-library containing 20,000 cells) into PCR tubes. Centrifuge at 300 ×g for 3 minutes at 4°C, discard the supernatant, and freeze the nuclei pellet at -80°C for later use.

[0147] Round2index primer (SEQ ID NO: 10):

[0148] pTGTGCTCTTCCGATCT[i2]CAAGTATGCAGCGCG ([i2] is the same as [i1]);

[0149] linker2comp primers (SEQ ID NO: 11): ATCCACGTGCTTGAGCGCGCTGCATACTTG;

[0150] blocker2 primers (SEQ ID NO: 12): CAAGTATGCAGCGCGCTCAAGCACGTGGAT;

[0151] Round3index primer (SEQ ID NO: 13):

[0152] CAAGCAGAAGACGGCATACGAGAT[i3]GTGACTGGAGTTCAGACG ([i3] is the same as [i1]);

[0153] Linker3comp primers (SEQ ID NO: 14):

[0154] AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC;

[0155] blocker3 primer (SEQ ID NO: 15): GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT.

[0156] 6. Construction of single-cell multi-omics sequencing libraries

[0157] 6.1 Nuclear lysis and decrosslinking:

[0158] Remove the frozen sub-library from -80℃, prepare a termination buffer, resuspend the cell nuclei in 50 μL of termination buffer, and incubate at 55℃ and 300 rpm for 1 hour; after incubation, add 2.5 μL of 100mM benzyl sulfonyl fluoride (PMSF), mix by pipetting, and incubate at room temperature for 10 minutes to terminate proteinase K activity.

[0159] 6.2 Separation of DNA and RNA:

[0160] Take 10 μL of MyOne C1 streptavidin magnetic beads for each sub-library, wash twice with 100 μL 1× BWT buffer, wash once with 100 μL 1× BWTRI buffer, and resuspend the magnetic beads in 50 μL 2× BWRI buffer.

[0161] Add the resuspended magnetic beads to the sub-library PCR tube from step 6.1, gently pipette to mix, and incubate at room temperature for 1 hour at 100 rpm to allow the biotin-labeled cDNA to bind to the magnetic beads.

[0162] After incubation, centrifuge briefly, place the PCR tube on a magnetic rack, and after the solution clarifies, carefully aspirate the supernatant and transfer it to a new PCR tube. This supernatant contains genomic DNA and will be used for subsequent ATAC-seq and CUT&Tag library construction. The original PCR tube containing the magnetic beads contains the RNA portion and will be temporarily reserved for RNA library construction.

[0163] RNA part: Wash the magnetic beads three times with 100 μL of 1× BWTRI buffer. After the last wash, discard the supernatant and keep the PCR tube on the magnetic rack. Add 100 μL of 1× STERI buffer. Discard the supernatant before the template replacement reaction.

[0164] DNA portion: DNA in the supernatant was purified and recovered using the Zymo DNA Recovery Kit, and finally eluted with 22 μL of elution buffer.

[0165] 7. Library Construction

[0166] 7.1 DNA Library (ATAC-seq and CUT&Tag) Construction: Prepare the DNA PCR reaction system: 25 μL 2× NEBNext Master Mix, 22 μL DNA eluted in step 6.2, 1 μL 25 μM P5-i5-TruRead1 primer (for amplifying the ATAC fragment), 1 μL 25 μM P5-i5-Read1 primer (for amplifying the CUT&Tag fragment), and 1 μL 25 μM P7 primer. Perform PCR amplification according to the following program: 72℃ for 5 min, 98℃ for 30 s; 98℃ for 10 s, 60℃ for 30 s, 72℃ for 1 min, 8-10 cycles; 72℃ for 5 min, 4℃, remove.

[0167] P5-i5-TruRead1 primer (SEQ ID NO: 16):

[0168] AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTACACGACGCCTTCCGATCT ([i5] is 8bp barcode);

[0169] P5-i5-Read1 primer (SEQ ID NO: 17):

[0170] AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTCAGATGTGTAT ([i5] is an 8bp barcode, which is different from the [i5] sequence in the P5-i5-TruRead1 primer).

[0171] P7 primer (SEQ ID NO: 18): CAAGCAGAAGACGGCATACGAGAT;

[0172] 7.2 cDNA library (RNA) amplification:

[0173] Template replacement reaction: Prepare template replacement reaction working solution (50 μL / sample): 10 μL 5 × RT buffer, 5 μL 10 mM dNTPs, 1.25 μL template replacement oligonucleotide (TSO), 10 μL Ficoll PM-400, 5 μL SRI, 16 μL PEG-6000, 2.5 μL Maxima RTase.

[0174] Template-substituted oligonucleotide (SEQ ID NO: 19):

[0175] AAGCAGTGGTATCAACGCAGAGTGAATrGrG+G (rG is guanine ribonucleotide, +G is guanine modified with locked nucleic acid).

[0176] The RNA fraction from step 6.2 was added to 50 μL of template replacement reaction working solution to resuspend the magnetic beads. The mixture was incubated at room temperature and 100 rpm for 30 minutes, then transferred to a 42°C thermal resuspending apparatus for 90 minutes, with the beads being pipetted every 30 minutes during incubation.

[0177] After incubation, add 100 μL of H2O to the PCR tube to dilute, mix well by pipetting, place on a magnetic rack, and discard the supernatant. Wash once with 200 μL of STE buffer (without resuspending).

[0178] cDNA amplification: Prepare the cDNA PCR reaction system: 25 μL 2 × KAPA HiFi HotStart ReadyMix, 1 μL 25 μM RNA-PCR primers, 1 μL 25 μM P7 primers, 21 μL H2O. Discard the supernatant from the PCR tubes on the magnetic rack from the previous step, add the cDNA PCR reaction mixture to resuspend the magnetic beads, and perform PCR amplification according to the following program: 95℃ for 30s; 98℃ for 10s, 65℃ for 45s, 72℃ for 3min, 8-10 cycles; 72℃ for 5min, 4℃, remove.

[0179] RNA-PCR primer (SEQ ID NO: 20): AAGCAGTGGTATCAACGCAGAGT.

[0180] 7.3 RNA library construction:

[0181] Prepare 1× cDNA tagmentation reaction buffer, place it on a PCR instrument, incubate precisely at 55°C for 5 min, immediately transfer to ice, purify the reaction product using the Zymo DNA recovery kit, and elute with 23 μL of elution buffer.

[0182] Prepare the RNA PCR reaction system: 25 μL 2× NEB Next Master Mix, 23 μL cDNA eluted in the previous step, 1 μL 25 μM P5-i5-Read1 primer and 1 μL 25 μM P7 primer. Perform PCR amplification according to the following program: 72℃ for 5 min, 98℃ for 30 s; 98℃ for 10 s, 60℃ for 30 s, 72℃ for 1 min, 5 cycles; 72℃ for 5 min, 4℃, then remove. The constructed library structure is shown below. Figure 2 As shown.

[0183] 7.4 Library purification and quality control:

[0184] Samples of the DNA library product from step 7.1 and the RNA library product from step 7.3 were taken and subjected to agarose gel electrophoresis to observe the band distribution and preliminarily estimate the concentration.

[0185] DNA libraries were sorted and recovered using 0.5× + 0.7× SPRI magnetic beads, and eluted with 15 μL of elution buffer.

[0186] RNA libraries were recovered using 0.7× SPRI magnetic beads and eluted with 15 μL of elution buffer.

[0187] Take 1 μL of the purified library and determine its concentration using the Qubit method;

[0188] 8. Library quality control and sequencing

[0189] Clearly label the purified DNA and RNA libraries from step 7.4, fill out the sequencing information form, and send them to the sequencing company for sequencing.

[0190] 9. Data Analysis and Quality Control

[0191] The raw sequencing data was processed using the analysis workflow, and common bioinformatics tools (such as sequence alignment tool STAR / Bowtie2, peak calling tool MACS2, etc.) were integrated to complete the following steps: (1) Single cell tags were split (including sample tags, histone modification tags, cell identity tags and RNA molecule UMI tags); (2) After sequence alignment, peak calling and other processes, a single cell-feature matrix was constructed, including chromatin accessibility matrix, histone modification matrix and gene expression matrix.

[0192] 10. Results Analysis

[0193] The RNA fragments obtained from sequencing were aligned with the ATAC fragments to the human (reference genome: hg38) and mouse (reference genome: mm10) genomes, respectively. The results showed (see...). Figure 3 The vast majority of cells (i.e., a collection of fragments with the same cell barcode) have RNA or ATAC sequences that can be uniquely matched to one of the genomes, with only 2.5% of cells showing mixed origins (a metric comparable to other current single-cell sequencing technologies).

[0194] After quality control, a total of 109,189 effective cells were obtained from the four pooled samples, averaging 27,000 effective cells per sample. Of these, 48% were K562 cells and 52% were NIH3T3 cells. At least 97% of the cells effectively captured all three modalities (RNA + ATAC + 1 CUT & Tag type), and the cell distribution of the six different CUT & Tag types was relatively even. Figure 4 (A and B in the original text). Regarding data quality: median RNA UMI count per cell exceeded 10,000; median ATAC fragment count exceeded 5,000; median CUT & Tag fragment count reached 2,000–10,000 (…). Figure 4 (C in the text). These fragment counting metrics are comparable to those of current single-cell, single-omics sequencing technologies, but the advantage of this method is that it can detect three modalities / omics within the same cell.

[0195] After pooling single-cell ATAC and histone modification signals, the results were compared with the ATAC-seq / CUT&Tag signals of the corresponding population of cells. The results showed a high degree of consistency between the two (see...). Figure 5This demonstrates the reliability of the ATAC / CUT&Tag signal obtained by this method.

[0196] The above results demonstrate that the method provided by this invention can achieve simultaneous detection of multiple samples and multiple histone modifications in a single experiment, and achieve simultaneous detection of three modalities (RNA + ATAC + CUT & Tag) in one cell, with an effective cell count of over 100,000. It is an efficient and comprehensive single-cell epigenetic multimodal sequencing method.

[0197] The above specific embodiments are merely explanations of the present invention and are not intended to limit the present invention. After reading this specification, those skilled in the art can make modifications to these embodiments without contributing any inventive step, but as long as they are within the scope of the claims of the present invention, they are protected by patent law.

Claims

1. A method for constructing a single-cell multimodal sequencing library, characterized in that, Includes the following steps: Step S1: Sample pretreatment and preparation of cell nucleus suspension Single cells of the sample to be tested were fixed, lysed, centrifuged, washed, and resuspended in buffer to obtain a cell nucleus suspension. Step S2: In-situ labeling of ATAC-seq library fragments The cell nuclei of each sample obtained in step S1 were mixed with the Tn5 transposon complex, and after the first transposon reaction, they were centrifuged and washed to obtain cell nuclei labeled with sequencing adapters and sample-specific barcodes. Step S3: In-situ labeling of CUT & Tag library fragments After processing all cell nuclei in step S2, the samples were mixed and divided into several portions. Each portion was incubated with a different primary antibody and then incubated with a secondary antibody. The protein A-Tn5 transposon complex was then added and mixed to perform a second transposon reaction. After centrifugation and washing, cell nuclei labeled with sequencing adapters and target-specific bars were obtained. Step S4: In situ reverse transcription of RNA-seq library The cell nuclei processed in step S3 were mixed, reverse transcribed, centrifuged and washed, and the cell nuclei were collected. Step S5: Three rounds of single-cell index labeling The cell nuclear suspension after step S4 was mixed with T4 ligase mixture and aliquoted into multi-well plates containing index adapters. After reaction, blocker primers were added to terminate unreacted index adapters. After centrifugation and washing, index labeling was repeated twice. All cells were collected and aliquoted into several sub-libraries. Step S6: Sequencing Library Construction Multiple sub-library cells were selected according to the expected goals. DNA and RNA were separated. DNA sequencing libraries containing ATAC-seq and CUT&Tag-seq information were constructed using the DNA-containing fractions, and RNA sequencing libraries were constructed using the RNA-containing fractions.

2. The method for constructing a single-cell multimodal sequencing library according to claim 1, characterized in that, The Tn5 transposon complex is a protein-DNA complex containing a Tn5 sample adapter loaded with Tn5 transposase; the Tn5 sample adapter is prepared by annealing a Sample linker1 adapter with a sample-specific barcode as shown in SEQ ID NO: 1, a TruRead1 sequencing adapter as shown in SEQ ID NO: 2, and a MEcomp adapter as shown in SEQ ID NO:

3.

3. The method for constructing a single-cell multimodal sequencing library according to claim 1, characterized in that, The proteinA-Tn5 transposon complex is a protein-DNA complex loaded with proteinA-Tn5 target adapters by proteinA-Tn5 transposase; the proteinA-Tn5 target adapters are prepared by annealing Target linker1 adapter with target-specific barcode as shown in SEQ ID NO:4, Read1 sequencing adapter as shown in SEQ ID NO:5, and MEcomp adapter as shown in SEQ ID NO:

3.

4. The method for constructing a single-cell multimodal sequencing library according to claim 1, characterized in that, The sequence of the reverse transcription primer is shown in SEQ ID NO:

6.

5. The method for constructing a single-cell multimodal sequencing library according to claim 1, characterized in that, The multi-well plate is a 96-well plate. The first round of index connectors are prepared by annealing the 96 Round 1 index primers (as shown in SEQ ID NO: 7) with the linker1comp primer (as shown in SEQ ID NO: 8); the second round of index connectors are prepared by annealing the 96 Round 2 index primers (as shown in SEQ ID NO: 10) with the linker2comp primer (as shown in SEQ ID NO: 11); and the third round of index connectors are prepared by annealing the 96 Round 3 index primers (as shown in SEQ ID NO: 13) with the linker3comp primer (as shown in SEQ ID NO: 14).

6. The method for constructing a single-cell multimodal sequencing library according to claim 5, characterized in that, The blocker primer sequence added in the first round is shown in SEQ ID NO: 9, the blocker primer sequence added in the second round is shown in SEQ ID NO: 12, and the blocker primer sequence added in the third round is shown in SEQ ID NO: 15; the multi-well plate is a 96-well plate, and in the three rounds of index labeling, each well of the multi-well plate is assigned a barcode; each sub-library contains 20,000 cells.

7. The method for constructing a single-cell multimodal sequencing library according to claim 1, characterized in that, The separation of DNA and RNA involves first cleaving and decrosslinking the cell nuclei in the sub-libraries, and then using MyOne C1 streptavidin magnetic beads to separate the DNA and RNA. The DNA library is constructed by recovering the DNA-containing portion and performing DNA PCR amplification using primers with sub-library index sequences as shown in SEQ ID NO: 16 (P5-i5-TruRead1), SEQ ID NO: 17 (P5-i5-Read1), and SEQ ID NO: 18 (P7). The RNA library is constructed by using the RNA-containing portion to perform a template replacement reaction with template-replacement oligonucleotides as shown in SEQ ID NO: 19, and then using primers with P7 and SEQ ID NO: 20 to amplify and purify cDNA. For each sub-library, cDNA is taken for cDNA tagging and fragmentation. After purification of the reaction product, RNA PCR amplification is performed using primers with P7 and primers with sub-library indexes as P5-i5-Read1.

8. The method for constructing a single-cell multimodal sequencing library according to claim 1, characterized in that, The DNA PCR amplification reaction system includes 25 μL 2× NEB Next Master Mix, 22 μL DNA, 1 μL 25 μM P5-i5-TruRead1 primer, 1 μL 25 μM P5-i5-Read1 primer, and 1 μL 25 μM P7 primer; the DNA PCR amplification program is: 72℃ extension for 5 min, 98℃ denaturation for 30 s; 98℃ annealing for 10 s, 60℃ extension for 30 s, 72℃ extension for 1 min, 8-10 cycles; final extension at 72℃ for 5 min. The RNA PCR amplification system includes: 25 μL 2× NEB Next Master Mix, 23 μL cDNA, 1 μL 25 μM P5-i5-Read1 primer, and 1 μL 25 μM P7 primer; the RNA PCR amplification program is: 72℃ extension for 5 min, 98℃ denaturation for 30 s, 98℃ annealing for 10 s, 60℃ extension for 30 s, 72℃ extension for 1 min, 8-10 cycles. Denaturation for 30 seconds; annealing at 98°C for 10 seconds, extension at 60°C for 30 seconds, extension at 72°C for 1 minute, 5 cycles; final extension at 72°C for 5 minutes.

9. A non-diagnostic method for high-throughput sequencing of single-cell multimodal sequencing libraries, characterized in that, include: High-throughput sequencing is performed on the single-cell multimodal sequencing library constructed by the method described in any one of claims 1-8 to obtain chromatin accessibility information, histone modification information and gene expression information, which constitute complete multi-omics data.

10. A single-cell multi-omics analysis method for non-diagnostic purposes, characterized in that, include: The method of claim 9 is implemented; and the obtained chromatin accessibility information, histone modification information and gene expression information are used to perform bioinformatics analysis on complete multi-omics data.