A method for the high purity preparation of high molecular weight polynucleotides
By designing recombinant plasmids and using rolling circle amplification technology, combined with specific enzyme digestion and purification steps, the problems of unstable raw materials, protein residues, and low production efficiency in the preparation of polynucleotides have been solved, enabling large-scale production with high purity and low cost.
Patent Information
- Application Number
- CN202610052526.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-15
- Publication Date
- 2026-06-05
AI Technical Summary
In existing technologies, the preparation process of polynucleotides (PN) suffers from problems such as unstable raw material sources, protein residues, low production efficiency, high costs, and uneven molecular weight distribution, making it difficult to achieve large-scale production and high-purity preparation.
By employing recombinant plasmid design and utilizing rolling circle amplification technology and specific enzyme digestion, a seamlessly fused single continuous fragment is formed by embedding the corresponding end of the PN sequence into the plasmid. Combined with restriction enzyme digestion and purification steps, 100% theoretical recovery and high-purity preparation of the PN fragment are achieved.
This technology enables the efficient, safe, convenient, and high-purity preparation of high molecular weight polynucleotides, suitable for large-scale production, ensuring product molecular weight uniformity and batch-to-batch stability, and meeting drug registration requirements.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention relates to the field of synthetic biology, specifically to a low-cost, high-purity, and high-yield industrial preparation method for high molecular weight polynucleotides (PN). Background Technology
[0002] Polydeoxyribonucleotides (PDRNs) are a class of naturally derived, low-molecular-weight DNA derivatives with a base composition that shares up to 98% homology with human genomic DNA. With a variety of pharmacological activities, including tissue repair, anti-inflammation, wound healing promotion, angiogenesis stimulation, and resistance to ischemic injury, PDRNs have been widely used in the development of novel treatment strategies, biomedical technology innovation, and the construction of artificial biological replacement systems, demonstrating significant clinical translational value. As the potential of PDRNs in the biomedical field continues to be realized, the development of upgraded products is accelerating significantly.
[0003] Polynucleotides (PNs) are structures further optimized from PDRN, exhibiting higher degrees of polymerization and more stable long-chain molecular conformations. Essentially, they are secondary refinements and functionally enhanced products of PDRN, belonging to the category of typical macromolecular bioactive substances. Research data shows that high-molecular-weight PN fragments, due to their stronger hydrophilicity and longer retention time in skin tissue, exhibit significantly superior moisturizing efficacy compared to PDRN. Furthermore, PNs can be used to prepare high-viscosity hydrogels or fillers, achieving precise tissue volume repair upon injection into the deep layers of the skin. The deoxyribonucleotide monomers released during their degradation in vivo can continuously stimulate skin cells, providing a more lasting biostimulatory effect and resulting in significant clinical benefits.
[0004] However, current PN preparation processes mainly rely on extraction from fish testes or semen. This traditional extraction method has many inherent technical bottlenecks: First, the biological differences in raw material sources and interference from environmental factors lead to insufficient product quality stability and batch-to-batch uniformity is difficult to guarantee; second, protein residues may remain in the product during extraction, which not only affects product purity but may also trigger potential safety risks such as immunogenic reactions; third, traditional extraction methods have lengthy processes, low production efficiency, and high costs, making it difficult to meet the needs of large-scale industrial production; more importantly, this method mostly relies on physical shearing or enzymatic hydrolysis, resulting in high randomness of product sequences and uneven molecular weight distribution, making it impossible to achieve precise control over the target product's molecular weight and nucleotide sequence, severely limiting the clinical translation and commercial application of PN. Summary of the Invention
[0005] To address the shortcomings of existing technologies, this invention provides a safe, efficient, convenient, high-purity, and scalable method for preparing high molecular weight polynucleotides. This method uses a plasmid containing the PN base sequence as a template, employs rolling circle amplification (Rolling Circle Amplification) technology to generate long-chain DNA, and then achieves efficient separation of the PN fragment through restriction enzyme digestion. The template plasmid is designed so that both the replication start site and the restriction enzyme site are embedded at the corresponding ends of the PN sequence, forming a single continuous fragment seamlessly fused with the PN sequence. This achieves 100% theoretical recovery of the PN fragment and significantly simplifies subsequent purification procedures.
[0006] This invention provides a recombinant plasmid that achieves a 100% theoretical recovery rate of the target polynucleotide fragment through an innovative modular design.
[0007] Another aspect of the present invention provides a method for constructing the above-mentioned plasmid, which utilizes a site-specific recombination system to achieve seamless integration of functional elements.
[0008] In another aspect, this invention provides a method for preparing high molecular weight polynucleotides based on this plasmid, which efficiently obtains long-fragment target products through rolling circle replication combined with specific enzyme digestion.
[0009] To achieve the above objectives, the present invention adopts the following technical solution:
[0010] 1. Core architecture of recombinant plasmids
[0011] The recombinant plasmid provided by this invention is a circular double-stranded DNA molecule containing sequentially linked functional units arranged as follows: replication origin site → first restriction enzyme site → PN sequence, with a second restriction enzyme site located between the PN sequences. These four units constitute a single functional unit, where the replication origin site and the restriction enzyme site are directly linked to the 5' and 3' ends of the PN sequence, respectively, forming a continuous nucleotide fragment without gaps. After digestion with a specific restriction endonuclease, this unit can be completely linearized and release the PN fragment.
[0012] 2. Optimal configuration of functional components
[0013] Replication origin site: The ColE2 type minimal replication region is used, preferably from ColE2-P9 Ori, ColE2-CA42 Ori, ColE3-CA38 Ori, or ColE5-O99 Ori. These Ori sequences are short, suitable for constructing compact plasmids, and maintain a stable low to medium copy number in E. coli, which facilitates plasmid amplification regulation.
[0014] Restriction enzyme sites: The first / second restriction enzyme sites are selected from HhaI (GCG↓C), PvuII (CAG↓CTG) or StuI (AGG↓CCT). These three enzymes have high cleavage efficiency and facilitate the acquisition of PN sequences.
[0015] PN sequence: The percentage contents of A, T, G, and C in the PN sequence are 30.3±10%, 30.3±10%, 19.5±10%, and 19.9±10%, respectively. This composition pattern is highly similar to that of natural PN (such as that derived from the Atlantic salmon genome), which is beneficial for preserving its biological activity; the PN sequence is preferably derived from the Atlantic salmon genome. The sequence length is >500 bp, preferably >1500 bp, to meet the molecular weight requirements of polynucleotide drugs, and the PN sequence is multi-copy. It should be particularly noted that the PN sequence can be customized according to actual production requirements, including but not limited to adjusting the base composition, sequence length, and copy number, and is not limited to SEQ ID NO:2 or SEQ ID NO:3 exemplarily listed in this application.
[0016] In the preferred embodiment, the recombinant plasmid can be selected from the following:
[0017] ColE2-P9-PN plasmid: The nucleotide sequence of ColE2-P9 Ori in the plasmid is shown in SEQ ID NO:1; the PN sequence is shown in SEQ ID NO:2 and SEQ ID NO:3, and its 5' end fusion recombination site sequence, preferably a loxP series sequence, is shown in SEQ ID NO:4. The 3' end is fused with the sequence shown in SEQ ID NO:1 to form the modified PN sequence shown in SEQ ID NO:5 and SEQ ID NO:6; the first / second restriction enzyme cleavage site is the HhaI recognition site GCG↓C.
[0018] ColE2-CA42-PvuII-PN plasmid: A PvuII site is introduced into the ColE2-CA42 Ori region of the plasmid to obtain the mutant sequence SEQ ID NO:7; the PN sequence is shown in SEQ ID NO:2 and SEQ ID NO:3, and its 5' end is fused with the recombination site sequence, preferably the FRT sequence, which is shown in SEQ ID NO:8, and the 3' end is fused with the sequence shown in SEQ ID NO:7.
[0019] ColE3-CA38-StuI-PN: The ColE3-CA38 Ori in the plasmid is modified to introduce the Stui site, and the mutant sequence is shown in SEQ ID NO:9; the PN sequence is shown in SEQ ID NO:2 and SEQ ID NO:3, and its 5' end is fused with the recombination site sequence, preferably the attR sequence, which is shown in SEQ ID NO:10, and the 3' end is fused with the sequence shown in SEQ ID NO:9 above.
[0020] ColE5-O99-PvuII-PN plasmid: A PvuII site is introduced into the 3' end of ColE5-O99 Ori in the plasmid, resulting in sequence SEQ ID NO:11; the PN sequence is shown in SEQ ID NO:2 and SEQ ID NO:3; its 5' end fusion recombination site sequence, preferably a loxP series sequence, is shown in SEQ ID NO:4, and the 3' end is fused with the sequence shown in SEQ ID NO:11 above.
[0021] 4. Plasmid Construction Methods
[0022] The above plasmids can all be efficiently constructed using site-specific recombination systems, such as:
[0023] Cre-loxP system: The loxP site is catalyzed by Cre recombinase to form a stable lox66 / 71 recombinant sequence, realizing the irreversible integration of Ori and PN sequence;
[0024] Flp-FRT system: The FRT sites in the same direction recombine under the action of Flp recombinase to form FRT recombination products;
[0025] The phiC31-attB / attP system: The attB / attP sites in the same direction are converted into attR / attL complex sites by the action of phiC31 recombinase.
[0026] The plasmids of this invention can be prepared by microloop plasmid technology, and the specific details can be found in the patent document CN120137964A of General Biosystems (Anhui) Co., Ltd.
[0027] 5. Preparation methods of high molecular weight polynucleotides
[0028] The preparation method provided by this invention includes the following steps:
[0029] Step 1: Plasmid amplification. The constructed recombinant plasmid is transformed into host cell culture to obtain a large amount of plasmid DNA.
[0030] Step 2: Rolling circle replication amplification. Using the purified plasmid as a template, rolling circle replication (RCA) is performed using a DNA polymerase with strand displacement activity (preferably φ29 DNA polymerase or Bst DNA polymerase) to achieve exponential amplification of the PN sequence.
[0031] Step 3: Restriction enzyme digestion and purification. The RCA product is digested using the appropriate restriction endonuclease (HhaI, PvuII, or StuI) to release the linearized PN fragment. Due to the precise design of the restriction sites, the digestion product is theoretically entirely composed of PN sequences, free from scaffold DNA contamination. Subsequent purification by gel electrophoresis or column chromatography yields high-purity high-molecular-weight polynucleotides.
[0032] Beneficial effects
[0033] Compared with the prior art, the advantages of the present invention are as follows:
[0034] Maximizing theoretical recovery rate: Through the "functional unit" design concept, restriction sites are directly configured on both sides of the PN fragment. After restriction, all amplification products are the target sequence, and the theoretical recovery rate reaches 100%.
[0035] Zero risk of residual backbone: The target fragment is completely fused with the plasmid backbone in sequence, and there is no "backbone contamination" problem common in traditional vectors. The purity of the product meets the standards for injectable drugs.
[0036] High sequence universality: Applicable to PN sequences of any composition, with particularly optimized amplification efficiency for AT-rich PN sequences (such as those from salmon genomes), and the sequence length can support ultra-large inserts of >5000 bp.
[0037] The process is simple and efficient: RCA amplification combined with a double enzyme digestion strategy requires only two core operations from plasmid to final product, making it suitable for large-scale production.
[0038] Precise quality control: The product has high molecular weight uniformity and small batch-to-batch differences, providing reliable process stability data for drug registration.
[0039] In summary, this invention, through the systematic design of plasmid templates containing PN sequences, introduces specific restriction enzyme sites while maintaining the biological function of the replication origin site, and precisely controls the base composition ratio of the PN fragment. This integrates the plasmid backbone into the PN fragment, enabling the complete release of the PN fragment after enzyme digestion, thus achieving a 100% theoretical recovery rate, significantly superior to existing technologies. This invention, through the synergistic innovation of plasmid structure optimization, precise sequence design, and large-scale preparation processes, opens a new path for the industrial production of long-chain PN fragments. This path allows for flexible customization of sequence length and nucleotide ratios, while ensuring high recovery rates and high purity, ultimately achieving the goal of high-quality, low-cost, traceable, and safe production. Attached Figure Description
[0040] Figure 1 PN design schematic diagram;
[0041] Figure 2 ColE2-P9-PN plasmid map;
[0042] Figure 3 Purification results of φ29 DNA polymerase;
[0043] Figure 4 RCA electrophoresis results in Example 1;
[0044] Figure 5 Electrophoresis results of RCA enzyme digestion reaction in Example 1;
[0045] Figure 6 Map of the ColE2-CA42-PvuII-PN plasmid;
[0046] Figure 7 Electrophoresis results of RCA enzyme digestion reaction in Example 2;
[0047] Figure 8 Map of the ColE3-CA38-StuI-PN plasmid;
[0048] Figure 9 Electrophoresis results of RCA enzyme digestion reaction in Example 3;
[0049] Figure 10 Image of ColE5-O99-PvuII-PN plasmid;
[0050] Figure 11 Electrophoresis results of RCA enzyme digestion reaction in Example 4. Detailed Implementation
[0051] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.
[0052] Unless otherwise specified, the materials and reagents used in the following examples are all commercially available products that can be purchased on the market.
[0053] The present invention will be further described below through embodiments, but these descriptions are not intended to further limit the scope of the invention. Those skilled in the art should understand that equivalent substitutions or corresponding improvements made to the present invention still fall within the protection scope of the present invention.
[0054] Example 1: Construction of ColE2-P9-PN template plasmid and preparation of PN fragment
[0055] The preparation of the template plasmid of this invention is mainly carried out through microloop plasmid technology, including the following steps: (1) Design of plasmid backbone: The plasmid backbone sequence (replication start site and recombination site sequence) is designed as part of the PN fragment, and restriction enzyme sites are designed, mutated or added, so as to make them part of the PN fragment, so as to achieve 100% recovery of the PN fragment. Figure 1 (2) Construction of precursor plasmid: Referring to the technical content disclosed in the patent CN120137964A of General Biosystems (Anhui) Co., Ltd., General Biosystems (Anhui) Co., Ltd. was commissioned to construct the plasmid. The precursor plasmid already contains functional elements such as screening tag genes. The replication origin site, paired recombination sites and PN fragment designed in step (1) were constructed into the precursor plasmid to obtain the precursor plasmid for preparing the template plasmid; (3) Preparation of template plasmid: The paired recombination sites can cause the precursor plasmid to undergo self-recombination under the action of recombinase to form a molecule of template plasmid and a molecule of circular double-stranded DNA. After separation and purification, the template plasmid can be used as a template for rolling circle replication amplification. The specific steps are as follows:
[0056] 1.1 Selection and Modification of Plasmid Replication Origin Sites
[0057] Using the natural ColE2-P9 replication origin site (ColE2-P9 Ori, 40 bp, J Bacteriol. 2006; 188(3): 999-1010., sequence as shown in SEQ ID NO: 1) as the starting backbone, the HhaI restriction endonuclease recognition site (GCG↓C) within the PN fragment was selected as the restriction site based on the nucleotide sequence characteristics of the fragment, in order to facilitate the subsequent modification and purification of the PN fragment. The ColE2-P9 Ori fragment was synthesized by General Biosystems (Anhui) Co., Ltd.
[0058] 1.2 Adaptive Modification of PN Fragments
[0059] 1.2.1 Sequence Origin
[0060] The PN fragments (PN-1 and PN-2) selected in this embodiment are both derived from the Atlantic salmon genome (GCF_905237065.1), with original lengths of 2000 bp and 2500 bp, respectively, and their nucleotide sequences are shown in SEQ ID NO:2 and SEQ ID NO:3, respectively. An HhaI restriction endonuclease recognition site (GCG↓C) was designed between PN-1 and PN-2 and incorporated into the PN sequence.
[0061] 1.2.2 End-point directional fusion design
[0062] To achieve the fusion of the plasmid backbone residue after enzyme digestion with the PN fragment, PN-1 and PN-2 were adaptively modified: without changing the A:T:G:C ratio of each fragment (PN-1: A 30.7%, T 29.8%, G 19.7%, C 19.9%; PN-2: A 30.3%, T 30.4%, G 19.5%, C 19.8%), the original sequences of corresponding lengths at the 3' end of PN-2 and the 5' end of PN-1 were replaced by the ColE2-P9 Ori and lox66 / lox71 site sequences (SEQ ID NO:4) described in Section 1.1. The specific replacement strategy is as follows:
[0063] a) Modification of the 3' end of PN-2: Replace the original 36 bp sequence at the 3' end of PN-2 with positions 1-36 of the plasmid backbone sequence;
[0064] b) Modification of the 5' end of PN-1: The original 37 bp sequence at the 5' end of PN-1 was replaced with positions 37-73 of the plasmid backbone sequence.
[0065] The modified PN fragments were named PN-1-M and PN-2-M, respectively, with the same total length and base ratio as the original fragments (SEQ ID NO:5 and SEQ ID NO:6). The fragments were synthesized by General Biotechnology Co., Ltd. (Anhui).
[0066] 1.3 Construction of precursor plasmid and template plasmid
[0067] Referring to the technical solution disclosed in CN119487197A, the exogenous Rep gene encoding the replication protein was integrated into the genome of Escherichia coli host cells to construct engineered Escherichia coli cells Top10 / Rep. The strain construction was entrusted to General Biotechnology Co., Ltd. (Anhui) Co., Ltd.
[0068] The construction scheme of the precursor plasmid was based on the technical content disclosed in patent CN120137964A of General Biotechnology Co., Ltd. (Anhui), and was commissioned to General Biotechnology Co., Ltd. (Anhui). Under the action of Cre site-specific recombinase, the PN fragment underwent site-specific recombination with the plasmid replication initiation site, forming a mini-plasmid containing only the plasmid replication initiation site, the PN fragment, and the lox66 / lox71 site, named ColE2-P9-PN. As described in Section 1.2.2 of Example 1, the plasmid replication initiation site and the lox66 / lox71 site were specifically fused into the PN fragment. Therefore, the nucleotide sequence of the final template plasmid ColE2-P9-PN consists only of the PN-1-M and PN-2-M fragments, and its plasmid map is shown below. Figure 2 As shown.
[0069] 1.4 Preparation of template plasmid
[0070] The template plasmid was transformed into E. coli Top10 / Rep cells and mass-produced by General Biosystems (Anhui) Co., Ltd. The obtained plasmids must meet the following quality standards: concentration ≥500 ng / μL, A260 / A280 ratio 1.8~1.9; qualified plasmids were stored at -20℃ for later use.
[0071] 1.5 Preparation and purification of φ29 DNA polymerase
[0072] Engineered bacteria carrying the pET28a(+)-Phi29 (UniProtKB / Swiss-Prot: P03680.1) plasmid were amplified on LB medium (containing kanamycin), and OD... 600 When the bacterial cell growth rate reached 0.6-0.8, the temperature was lowered to 25℃, and 0.1 mM IPTG was added to induce expression for 18 hours. After cell lysis and centrifugation, the supernatant was filtered through a 0.45 μm filter to obtain crude enzyme solution. Purification was performed using a three-step chromatography process: Ni column affinity chromatography: after loading the crude enzyme solution, elution was performed with a 0-50% imidazole gradient, and the target peak was collected; SP column cation exchange: the sample was diluted and eluted with a 0-100% SPB buffer gradient, and the target fraction was combined; Q column anion exchange: after two dilutions, elution was performed with 0-100% QB buffer to obtain high-purity product. The product was diluted and desalted with 20 mM Tris-HCl (pH 7.5) buffer between each step, and finally filtered and stored. The entire process achieved efficient separation and impurity removal, with the recombinant φ29 DNA polymerase achieving a purity of 95% and an activity of 5000 U / mL. Figure 3 ).
[0073] 1.6 Rolling circle amplification
[0074] Prepare the RCA (Rolling Circle Amplification) system according to Table 1 and perform amplification operations. The circular DNA template was obtained from the preparation step of template plasmid ColE2-P9-PN in Section 1.4 of this example; the φ29 DNA polymerase was obtained from the preparation and purification step of φ29 DNA polymerase in Section 1.5 of this example; the remaining reagents were commonly used commercial products. First, prepare the denaturing mixture, incubate at 95℃ for 3 min, then cool on ice for 5 min; then add the reaction mixture, mix thoroughly, and add φ29 DNA polymerase and pyrophosphatase (NEB, catalog number M2403S), reacting at 30℃ for 12-16 h. Take 5 μL of RCA product into a 0.6% agarose gel and electrophoresis at 120 V for 30 min. The electrophoresis results are shown below. Figure 4 As shown in the electrophoresis results, the RCA product is diffuse and mainly remains in the sample wells.
[0075] Table 1. RCA System and Reaction Process
[0076]
[0077] 1.7 Restriction endonuclease digestion
[0078] The enzyme digestion reaction system was configured according to Table 2, where the RCA product was derived from the rolling circle amplification step in Section 1.6 of this example. The reaction was terminated at 37°C for 1 hour and then at 65°C for 10 minutes. 5 μL of the digestion product was transferred to a 1% agarose gel and electrophoresed at 120 V for 30 minutes. After digestion with the restriction endonuclease HhaI, only two clear bands appeared in the RCA product, with sizes consistent with the theoretical values of 2000 bp (PN-1-M) and 2500 bp (PN-2-M), respectively. Figure 5 The absence of a backbone fragment indicates that the PN fragment recovery rate is approximately 100%.
[0079] Table 2 Enzyme digestion reaction system
[0080]
[0081] Example 2 Construction of ColE2-CA42-PvuII-PN template plasmid and preparation of PN fragment
[0082] 2.1 Selection and Modification of Plasmid Replication Origin Sites
[0083] ColE2-CA42 belongs to the ColE2-related plasmid family. Its 38 bp minimal replication region (ColE2-C42 Ori, JBacteriol. 2006; 188(3): 999-1010.) is highly homologous to ColE2-P9 Ori, and the Rep protein binding site and stem-loop structure are conserved. Using the natural ColE2-CA42 replication initiation site as the starting backbone, without changing the key bases essential for its replication function and preserving the integrity of the functional subregion, a PvuII restriction endonuclease recognition site (CAG↓CTG) was introduced into its sequence through site-directed mutagenesis to facilitate the subsequent modification and purification of the PN fragment. The mutated ColE2-C42 Ori-PvuII sequence is shown in SEQ ID NO: 7. The mutated fragment was synthesized by General Biosystems (Anhui) Co., Ltd.
[0084] 2.2 Adaptive Modification of PN Fragments
[0085] 2.2.1 Sequence Origin
[0086] The original sequences of PN-1 and PN-2 are the same as those in Section 1.2.1 of Example 1.
[0087] 2.2.2 End-point directional fusion design
[0088] Without altering the A:T:G:C ratio of each fragment, the original sequences of corresponding lengths at the 3' end of PN-2 and the 5' end of PN-1 were replaced by the ColE2-CA42 Ori-PvuII and FRT sequences (SEQ ID NO:8) described in Section 2.1. The modified PN fragments were named PN-1-C and PN-2-C, respectively, with the same total length and base ratio as the original fragments. The fragments were synthesized by General Biotechnology Co., Ltd. (Anhui).
[0089] 2.3 Construction of precursor plasmid and template plasmid
[0090] The construction scheme of the precursor plasmid is the same as in Section 1.3 of the Examples. Under the action of Flp site-specific recombinase, the PN fragment can undergo site-specific recombination with the plasmid initiation site, forming the template plasmid ColE2-C42-PvuII-PN composed only of the PN-1-C and PN-2-C fragments. Its plasmid map is shown below. Figure 6 As shown.
[0091] 2.4 Preparation of template plasmid ColE2-CA42-PN
[0092] The template plasmid ColE2-C42-PvuII-PN was prepared according to the method described in Section 2.1 of Example 2. The original plasmid (ColE2-C42-PN) of ColE2-CA42 Ori without mutation and the modified plasmid (ColE2-C42-PvuII-PN) were commissioned to General Biosystems (Anhui) Co., Ltd. for large-scale preparation. Five single clones of each plasmid were selected and cultured overnight. At the same OD... 600 Under the specified conditions, plasmids were extracted from 2 mL of overnight culture. As shown in Table 3, an average of 3.77 μg and 3.75 μg of plasmid DNA were obtained per tube from the original plasmid and mutant plasmid, respectively, indicating that the ColE2-C42A Ori mutant design did not cause a significant change in plasmid copy number, and its replication function was fully preserved. Therefore, the obtained ColE2-C42-PvuII-PN plasmid DNA can be used as a template for subsequent rolling circle amplification.
[0093] Table 3 Comparison of plasmid extraction yields of ColE2-C42-PN and ColE2-C42-PvuII-PN
[0094]
[0095] 1 The results, calculated using an unpaired one-tailed Student's t-test, showed no statistically significant difference between the two groups.
[0096] 2.5 Rolling circle amplification and enzyme digestion verification
[0097] Using ColE2-C42-PvuII-PN as a template, rolling circle amplification (RCA) was performed according to the conditions in Section 1.6 of Example 1. 1 μg of the RCA product was digested with 2 U HhaI and PvuII at 37℃ for 1 h. 1% agarose gel electrophoresis showed only two clear bands, with sizes consistent with the theoretical values of 2000 bp (PN-1-C) and 2500 bp (PN-2-C), respectively. Figure 7 The absence of a backbone fragment indicates that the PN fragment recovery rate is approximately 100%.
[0098] Example 3 Construction of ColE3-CA38-StuI-PN template plasmid and preparation of PN fragment
[0099] 3.1 Selection and Modification of Plasmid Replication Origin Sites
[0100] ColE3-CA38 belongs to the ColE2-related plasmid family. Its 36 bp minimal replication region (ColE3-CA38 Ori, JBacteriol. 2006; 188(3): 999-1010.) is highly homologous to ColE2-P9 Ori, and the Rep protein binding site and stem-loop structure are conserved. Using the natural ColE3-CA38 replication initiation site as the starting backbone, without changing the key bases essential for its replication function and preserving the integrity of the functional subregion, a StuI restriction endonuclease recognition site (AGG↓CCT) was introduced into its sequence through site-directed mutagenesis to facilitate the subsequent modification and purification of the PN fragment. The mutated ColE3-CA38Ori-StuI sequence is shown in SEQ ID NO: 9. The mutant fragment was synthesized by General Biosystems (Anhui) Co., Ltd.
[0101] 3.2 Adaptive Modification of PN Fragments
[0102] 3.2.1 Sequence Origin
[0103] The original sequences of PN-1 and PN-2 are the same as those in Section 1.2.1 of Example 1. A StuI restriction endonuclease recognition site (AGG↓CCT) was designed between PN-1 and PN-2 and incorporated into the PN sequence.
[0104] 3.2.2 End-point directional fusion design
[0105] Without altering the A:T:G:C ratio of each fragment, the original sequences of corresponding lengths at the 3' end of PN-2 and the 5' end of PN-1 were replaced by the ColE3-CA38 Ori-StuI and attR sequences (SEQ ID NO:10) described in Section 3.1. The modified PN fragments were named PN-1-A and PN-2-A, respectively, with the same total length and base ratio as the original fragments. The mutant fragment gene synthesis was commissioned to General Biotechnology Co., Ltd. (Anhui) Co., Ltd.
[0106] 3.3 Construction of precursor plasmid and template plasmid
[0107] The construction scheme of the precursor plasmid is the same as in Section 1.3 of Example. Under the action of phiC31 site-specific recombinase, the PN fragment can undergo site-specific recombination with the plasmid replication initiation site to form the template plasmid ColE3-CA38-StuI-PN, which consists only of PN-1-A and PN-2-A fragments. Its plasmid map is shown below. Figure 8 As shown.
[0108] 3.4 Preparation of template plasmid ColE3-CA38-PN
[0109] The template plasmid ColE3-CA38-StuI-PN was prepared according to the method described in Section 1.4 of Example 1. The original plasmid (ColE3-CA38-PN) without mutation of ColE3-CA38 Ori and the modified plasmid (ColE3-CA38-StuI-PN) were commissioned to General Biosystems (Anhui) Co., Ltd. for large-scale preparation. Five single clones of each plasmid were selected and cultured overnight. At the same OD... 600 Under these conditions, plasmid extraction was performed on 2 mL of overnight culture. As shown in Table 4, an average of 3.63 μg and 3.59 μg of plasmid DNA were obtained per tube from the original plasmid and mutant plasmid, respectively, indicating that the ColE3-CA38 Ori mutant design did not cause a significant change in plasmid copy number, and its replication function was fully preserved. Therefore, the obtained ColE3-CA38-StuI-PN plasmid DNA can be used as a template for subsequent rolling circle amplification.
[0110] Table 4 Comparison of plasmid extraction yields of ColE3-CA38-PN and ColE3-CA38-StuI-PN plasmids
[0111]
[0112] 1 The results, calculated using an unpaired one-tailed Student's t-test, showed no statistically significant difference between the two groups.
[0113] 3.5 Rolling circle amplification and enzyme digestion verification
[0114] Using ColE3-CA38-StuI-PN as a template, rolling circle amplification (RCA) was performed according to the conditions in Section 1.6 of Example 1. 1 μg of the RCA product was digested with 2 U StuI at 37℃ for 1 h. 1% agarose gel electrophoresis showed only two clear bands, with sizes consistent with the theoretical values of 2000 bp (PN-1-A) and 2500 bp (PN-2-A), respectively. Figure 9 The absence of a backbone fragment indicates that the PN fragment recovery rate is approximately 100%.
[0115] Example 4 Construction of ColE5-O99-PN template plasmid and preparation of PN fragment
[0116] 4.1 Selection and Modification of Plasmid Replication Origin Sites
[0117] ColE5-O99 belongs to the ColE2-related plasmid family. Its 38 bp minimal replication region (ColE5-O99 Ori, JBacteriol. 2006; 188(3): 999-1010.) is highly homologous to ColE2-P9 Ori, and the Rep protein binding site and stem-loop structure are conserved. Using the natural ColE5-O99 replication origin site as the starting backbone, an additional PvuII restriction endonuclease recognition site (CAG↓CTG) was introduced at its end to facilitate the subsequent modification and purification of the PN fragment. The mutated ColE5-O99 Ori-PvuII sequence is shown in SEQ ID NO: 11. The mutant fragment gene was synthesized by General Biosystems (Anhui) Co., Ltd.
[0118] 4.2 Adaptive Modification of PN Fragments
[0119] 4.2.1 Sequence Origin
[0120] The original sequences of PN-1 and PN-2 are the same as those in Section 1.2.1 of Example 1.
[0121] 4.2.2 End-point directional fusion design
[0122] Without altering the A:T:G:C ratio of each fragment, the original sequences of corresponding lengths at the 3' end of PN-2 and the 5' end of PN-1 were replaced by the ColE5-O99 Ori-PvuII and lox66 / lox71 site sequences (SEQ ID NO:4) described in section 4.1. The modified PN fragments were named PN-1-O and PN-2-O, respectively, with the same total length and base ratio as the original fragments. Gene fragment synthesis was commissioned to General Biotechnology Co., Ltd. (Anhui) Co., Ltd.
[0123] 4.3 Construction of precursor plasmid and template plasmid
[0124] The construction scheme of the precursor plasmid is the same as in Section 1.3 of the Examples. Under the action of Cre recombinase site-specific recombinase, the PN fragment can undergo site-specific recombination with the plasmid replication initiation site to form the template plasmid ColE5-O99-PvuII-PN, which consists only of the PN-1-O and PN-2-O fragments. Its plasmid map is shown below. Figure 10 As shown.
[0125] 4.4 Preparation of template plasmid ColE5-O99-PvuII-PN
[0126] The template plasmid ColE5-O99-PvuII-PN was prepared according to the method described in Section 1.4 of Example 1, and its large-scale preparation was entrusted to General Biosystems (Anhui) Co., Ltd.
[0127] 4.5 Rolling circle amplification and enzyme digestion verification
[0128] Using ColE5-O99-PvuII-PN as a template, rolling circle amplification (RCA) was performed according to the conditions in Section 1.6 of Example 1. 1 μg of the RCA product was digested with 2 U HhaI and PvuII at 37℃ for 1 h. 1% agarose gel electrophoresis showed only two clear bands, with sizes consistent with the theoretical values of 2000 bp (PN-1-O) and 2500 bp (PN-2-O), respectively. Figure 11 The absence of a backbone fragment indicates that the PN fragment recovery rate is approximately 100%.
[0129] Example 5: PN Scale-up Preparation
[0130] The plasmid ColE2-P9-PN from Example 1 was used as a template for RCA. The amplification reaction system described in Section 1.6 of Example 1 was scaled up 400-fold (40 mL), and the final DNA concentration of the amplified product was determined to be 15.3 g / L using Qubit dye. After digestion with HhaI restriction endonuclease, the DNA was separated and purified using anion exchange chromatography in an automated chromatography system. The target DNA was collected based on UV values, with a recovery rate exceeding 98%. The purity of the purified product was analyzed using IE-HPLC, with the detection wavelength fixed at 260 nm. Based on peak shape, resolution, and peak area ratio, the DNA purity was determined to be up to 99%. Finally, 680 mg of PN was obtained.
[0131] sequence list
[0132] SEQ ID NO:1
[0133] Aaaatgagaccagataagccttatcagataacagcgccct
[0134] 40 bp
[0135] SEQ ID NO:2
[0136]
[0137] 2000 bp
[0138] SEQ ID NO:3
[0139]
[0140] 2500 bp
[0141] SEQ ID NO:4
[0142] TACCGTTCGTATAGCATACATTATACGAACGGTA
[0143] 34 bp
[0144] SEQ ID NO:5
[0145]
[0146] 2000 bp
[0147] SEQ ID NO:6
[0148]
[0149] 2500 bp
[0150] SEQ ID NO:7
[0151] TGGAAAAGCGGAAAATAGCCTATATCAGATAACAGCTGC
[0152] 39 bp
[0153] SEQ ID NO:8
[0154] gaagttcctatactttctagaataggaacttcggaataggaacttc
[0155] 48 bp
[0156] SEQ ID NO:9
[0157] AGAGTAGACCAAATAAGCCTATATCAGATAACAGGCCTGC
[0158] 40 bp
[0159] SEQ ID NO:10
[0160] cccaactggggtaacctttgggctccccgggcg
[0161] 37 bp
[0162] SEQ ID NO:11
[0163] AGAGTAGACCAAATAAAACCTATATCAGATAACAGCAGCTGC
[0164] 42 bp
Claims
1. A recombinant plasmid for preparing high molecular weight polynucleotides, characterized in that, The plasmid is a circular double-stranded DNA and contains the following transcription units linked in sequence: (i) Origin of replication; (ii) First restriction enzyme site; (iii) PN sequence; (iv) The second restriction enzyme site between the PN sequences; Among them, (i)–(iv) constitute a single transcription unit, wherein the replication initiation site and the restriction enzyme site are seamlessly fused to the 5' and 3' ends of the PN sequence, respectively, forming a continuous nucleotide fragment; after restriction enzyme digestion, the unit is completely linearized and the PN fragment is released, achieving 100% theoretical recovery of the PN fragment.
2. The plasmid as described in claim 1, characterized in that, The replication initiation site is the minimum replication region of the ColE2 family, selected from ColE2-P9 Ori, ColE2-CA42 Ori, ColE3-CA38 Ori, or ColE5-O99 Ori; the first / second restriction enzyme sites are selected from the recognition sequences of HhaI, PvuII, or StuI.
3. The plasmid according to claim 2, characterized in that: The percentage contents of A, T, G and C in the PN sequence are 30.3±10%, 30.3±10%, 19.5±10% and 19.9±10%, respectively; the PN sequence is preferably derived from the Atlantic salmon genome.
4. The plasmid according to claim 3, characterized in that: The length of the PN sequence is greater than 500 bp, preferably greater than 1500 bp.
5. The plasmid as described in claim 2, characterized in that, The nucleotide sequence of the ColE2-P9 Ori is shown in SEQ ID NO:1; the PN sequence is shown in SEQ ID NO:2 and SEQ ID NO:3, with its 5' end fusion recombination site sequence, preferably a loxP series sequence, as shown in SEQ ID NO:4, and its 3' end fused with the sequence shown in SEQ ID NO:1, forming the modified PN sequence shown in SEQ ID NO:5 and SEQ ID NO:6; the first / second restriction enzyme cleavage site is the HhaI recognition site GCG↓C.
6. The plasmid as described in claim 2, characterized in that, The mutated sequence of the PvuII site CAG↓CTG introduced into the ColE2-CA42 Ori is shown in SEQ ID NO:7; the PN sequence is shown in SEQ ID NO:2 and SEQ ID NO:3, and its 5' end is fused with the recombination site sequence, preferably the FRT sequence, which is shown in SEQ ID NO:8, and its 3' end is fused with the sequence shown in SEQ ID NO:
7.
7. The plasmid as described in claim 2, characterized in that, The mutated sequence after introducing the StUI site AGG↓CCT into the ColE3-CA38 Ori is shown in SEQ ID NO:
9. The PN sequence is shown in SEQ ID NO:2 and SEQ ID NO:
3. Its 5' end is fused with the recombination site sequence, preferably the attR sequence, which is shown in SEQ ID NO:
10. The 3' end is fused with the sequence shown in SEQ ID NO:
9.
8. The plasmid as claimed in claim 2, wherein the mutant sequence after introducing the PvuII site CAG↓CTG at the ColE5-O99 Ori end is shown in SEQ ID NO:11, and the PN sequence is shown in SEQ ID NO:2 and SEQ ID NO:3; its 5' end fusion recombination site sequence, preferably a loxP series sequence, is shown in SEQ ID NO:4, and the 3' end is fused with the sequence shown in SEQ ID NO:
11.
9. The plasmid according to any one of claims 1-8, characterized in that, The plasmids were prepared using recombination systems such as Cre-loxP, Flp-FRT, and phiC31-attB / attP, and the recombination systems were selected from: The Cre-loxP system, in which the loxP site in the same direction is converted into the lox66 / 71 sequence by Cre recombinase; The Flp-FRT system, in which the co-directed FRT site is acted upon by Flp recombinase to form an FRT recombination sequence; or The phiC31-attB / attP system, in which the attB / attP sites are converted into attR sequences by phiC31 recombinase.
10. A method for preparing a high molecular weight polynucleotide, characterized in that, The preparation method includes the following steps: amplifying any one of the plasmids described in claims 1-8 within a host cell; performing rolling circle replication amplification using the purified plasmid as a template; and purifying the amplified fragment by restriction enzyme digestion to obtain the target high molecular weight polynucleotide.
11. The preparation method according to claim 10, characterized in that: The rolling circle amplification uses a DNA polymerase with rolling circle amplification capability, preferably φ29 DNA polymerase or Bst DNA polymerase.
Citation Information
Patent Citations
Production of gene therapy vectors in engineered bacteria
CN119487197A
Micro-ring plasmid synthesis method
CN120137964A