A method for detecting geobacillus thermocatenulatus in raw milk based on real-time fluorescent quantitative polymerase chain reaction

By combining real-time quantitative polymerase chain reaction (qPCR) with specific primer and probe design, the problems of long detection time and poor repeatability of traditional detection methods have been solved, realizing rapid and accurate detection of heat-phage amyloliquefaciens in raw milk, and improving detection efficiency and sensitivity.

CN122146901APending Publication Date: 2026-06-05INST OF AGRO FOOD SCI & TECH CHINESE ACADEMY OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
INST OF AGRO FOOD SCI & TECH CHINESE ACADEMY OF AGRI SCI
Filing Date
2026-02-04
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

Existing technologies cannot quickly and accurately detect heat-consuming amyloliquefaciens in raw milk. Traditional methods are cumbersome, time-consuming, and have poor repeatability, making it difficult to meet the rapid testing needs of dairy companies.

Method used

A detection method based on real-time quantitative polymerase chain reaction (qPCR) was adopted. Through the design of specific primers and probes, combined with pretreatment steps of suspension buffer and lysozyme buffer, a high-efficiency and specific detection of Bacillus amyloliquefaciens was achieved.

Benefits of technology

This method enables rapid and accurate quantitative detection of heat-phage amyloliquefaciens in raw milk, with a sensitivity of 100 CFU/mL. It shortens the detection time, improves detection efficiency and accuracy, and avoids false positive results.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122146901A_ABST
    Figure CN122146901A_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of analytical detection, and in particular to a detection method of Geobacillus thermophilus in raw milk based on real-time fluorescent quantitative polymerase chain reaction. The detection method of the present application is based on nucleic acid specific detection mechanism, which replaces the phenotype culture mechanism, realizes the rapid and accurate quantification of the target bacteria, and replaces the time-consuming and inaccurate colony counting. Through the design of specific primers and probes, the species level specificity identification is realized, and the problem that the traditional method cannot distinguish the specific contaminated bacteria is solved. Through the optimization of the pretreatment method, the sensitivity of the detection method is greatly improved. The detection method of the present application shortens the detection time, realizes the leap from "days" to "hours", greatly improves the detection efficiency, and has a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of analytical detection technology, and in particular to a method for detecting Bacillus amyloliquefaciens in raw milk based on real-time fluorescence quantitative polymerase chain reaction. Background Technology

[0002] Thermophobic amyloliquefaciens ( Caldibacillus thermoamylovorans *Bacillus subtilis* is one of the main heat-resistant spore-forming bacteria that contaminate raw milk. This bacterium is highly heat-resistant, produces a high spore yield, and can generate heat-resistant proteases and lipases. Its spores can remain in dairy products and germinate during shelf life, leading to product spoilage, nutrient loss, and flavor deterioration, causing serious package contamination incidents and significantly damaging the economic and reputational health of dairy companies. Therefore, the detection of this bacterium in raw milk has become a key indicator for quality assessment in the industry.

[0003] Currently, the detection methods for *Bacillus thermophilus* are not yet perfect, and the industry mainly relies on the People's Republic of China agricultural industry standard "Determination of Psychrophilic Bacteria, Aerobic Spores and Thermophilic Aerobic Spore Counts in Milk and Dairy Products" (NY / T 1331—2007). This standard adopts a traditional method, the main steps of which include: heating the raw milk sample at 100℃ for 30 minutes, culturing it in DTA medium at 55℃ for 48 hours, and finally calculating the number of bacteria per milliliter of sample by colony counting. However, this method is cumbersome and time-consuming (requiring 48 hours of incubation, and the entire detection process takes more than 3 days), and the test results have poor repeatability, making it difficult to meet the current needs of dairy companies for rapid and accurate detection of *Bacillus thermophilus* in raw milk. Summary of the Invention

[0004] To address the shortcomings of the prior art, this invention provides a method for detecting heat-phage amyloliquefaciens in raw milk, comprising: After centrifuging the raw milk, the precipitate was resuspended in suspension buffer, centrifuged again, and then resuspended in lysozyme buffer. The precipitate was then treated sequentially with lysozyme and proteinase K to obtain a pretreatment solution. Nucleic acids were extracted from the pretreatment solution. The suspension buffer is a mixture of Tris-HCl solution, EDTA solution, glucose and water; the lysozyme buffer is a mixture of PBS buffer, EDTA solution and glycerol. Using the nucleic acid as a DNA template, qPCR was performed using primers and probes; The primers include an upstream primer and a downstream primer; The sequence of the upstream primer is: CAAGAAGCCGATCAAACGGT The sequence of the downstream primer is: TGACAATGTCGCGATCTACC The probe sequence is: TATTTTACTTGC.

[0005] This invention provides a method for detecting Bacillus amyloliquefaciens in raw milk based on real-time quantitative polymerase chain reaction (qPCR). Compared with traditional detection methods, it has the characteristics of high efficiency, high sensitivity and high specificity, realizing rapid and accurate quantitative detection of the target bacteria.

[0006] Specifically, this invention designs the aforementioned specific primers for *Bacillus thermophilus* to ensure that only *Bacillus thermophilus* DNA can be efficiently amplified, while DNA from other similar bacterial species cannot be effectively identified and amplified (i.e., no amplification signal). Simultaneously, the designed specific probes, through their strict matching with the target sequence, further guarantee the specificity of the detection signal, effectively avoiding false positive results.

[0007] Furthermore, by employing the aforementioned specific formulations of suspension buffer and lysozyme buffer, along with pretreatment using lysozyme and proteinase K, high-level extraction of trace microbial nucleic acids can be achieved. Combined with the signal amplification capabilities of subsequent qPCR, the detection sensitivity of target bacteria can be significantly improved, reaching a sensitivity of 10. 0 CFU / mL (i.e., single colony forming unit) enables early warning of contamination levels, even at extremely low levels.

[0008] The "quantitative" capability of qPCR stems from its monitoring of the number of cycles required to reach a specific fluorescence threshold. The more initial template DNA in a sample, the sooner it reaches this threshold, and the lower the corresponding cycle number. By comparing the cycle number of an unknown sample with a standard curve of known concentration, the software can automatically and accurately calculate the copy number of the initial target DNA in the sample, thus directly reflecting the quantity of the target bacteria in the original sample.

[0009] Furthermore, traditional colony counting is a manual estimation, which is subject to subjective error and cannot count dead or unculturable bacteria. qPCR provides objective, digital results with high accuracy and good reproducibility.

[0010] Preferably, in the suspension buffer, the ratio of Tris-HCl solution, EDTA solution and glucose is (25~30) mL: (15~25) mL: (8~10) g; the concentration of Tris-HCl solution is 100 mmol / L (pH 7.2), and the concentration of EDTA solution is 1 mmol / L.

[0011] Preferably, the concentration of glucose in the suspension buffer is (8~10) g / L.

[0012] Preferably, in the lysozyme buffer, the volume ratio of PBS buffer, EDTA solution and glycerol is (8~12):(3~6):(2~5); the concentration of PBS buffer is 10 mmol / L (pH 7.2), and the concentration of EDTA solution is 1 mmol / L.

[0013] In some embodiments, the treatment with lysozyme and proteinase K is treatment with a PBS solution of lysozyme and a PBS solution of proteinase K.

[0014] Preferably, the temperature for lysozyme treatment is 36°C to 38°C.

[0015] Preferably, the lysozyme treatment time is 10-20 minutes.

[0016] Preferably, the concentration of lysozyme in the PBS solution is 40-60 μg / mL; Preferably, the concentration of proteinase K in the PBS solution is 80-120 μg / mL.

[0017] Preferably, after resuspending the precipitate with suspension buffer, it is first centrifuged at 2000-5000 rpm (preferably for more than 10 min), then centrifuged at more than 12000 rpm (preferably for more than 5 min), and then resuspended with lysozyme buffer.

[0018] Preferably, the nucleic acid in the pretreatment solution is extracted using an adsorption column method.

[0019] Preferably, the step of extracting nucleic acids from the pretreatment solution includes: The pretreatment solution was mixed with lysis buffer and shaken. The mixture was then treated at 65°C to 75°C for 5 to 10 minutes. Ethanol was added and shaken again. All solutions and precipitates were transferred to an adsorption column. After centrifugation, neutralization buffer was added. After centrifugation, rinsing buffer was added. After removing the rinsing buffer, sterile enzyme-free water was added to reconstitute the solution. The reconstituted solution was collected by centrifugation to obtain the nucleic acid.

[0020] In some embodiments, the 5' end of the probe is attached to a fluorescent reporter group, and the 3' end of the probe is attached to a fluorescent quencher group.

[0021] Preferably, the fluorescent reporter group is FAM; and the fluorescent quencher group is BHQ.

[0022] Preferably, the reaction program for the qPCR reaction is as follows: pre-denaturation at 95°C for 5 minutes; denaturation at 95°C for 15 seconds; annealing extension at 58.5°C for 30 seconds; and denaturation and annealing extension cycles for 35-40 times.

[0023] In some implementations, the raw milk is cow's milk raw material, finished cow's milk, or dairy products.

[0024] Compared with the prior art, the beneficial effects of the present invention are as follows: Compared to the traditional plate count method, the detection method established in this invention can complete the entire process from sample processing to result analysis within 3 hours, significantly improving detection efficiency. Furthermore, while traditional methods can only perform colony counting and cannot achieve species-specific identification, this method can accurately identify *Bacillus thermophilus* with significantly improved sensitivity, achieving a detection limit as low as 100 CFU / mL. In addition, this method has significant technical advantages in the nucleic acid extraction stage: raw milk has a complex composition, rich in interfering substances such as fat and protein, making direct extraction of high-quality bacterial nucleic acids challenging. This invention, by optimizing the pretreatment steps and combining raw milk enrichment and centrifugation techniques, effectively removes interference from milk fat and milk protein, achieving efficient and rapid extraction of bacterial nucleic acids from complex matrices, further improving the sensitivity and reliability of the method.

[0025] In summary, the detection method of this invention, based on a nucleic acid-specific detection mechanism, replaces the phenotypic culture mechanism, achieving rapid and accurate quantification of target bacteria, and replacing time-consuming and inaccurate colony counting. Through the design of specific primers and probes, species-level specific identification is achieved, solving the problem that traditional methods cannot distinguish specific contaminating bacterial species. Optimization of the pretreatment method significantly improves the sensitivity of the detection method. The detection method of this invention shortens the detection time, achieving a leap from "days" to "hours," greatly improving detection efficiency and possessing broad application prospects. Attached Figure Description

[0026] Figure 1 This is a graph showing the results of a specific test.

[0027] Figure 2 It is a standard curve graph.

[0028] Figure 3 This is a comparison chart of the amplification results of the two sets of primers in Example 1 and the comparative example. Detailed Implementation

[0029] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0030] Example 1 This embodiment provides a method for detecting heat-phage amyloliquefaciens in raw milk, the steps of which are as follows: 1. Experimental Materials and Reagents Sample: Raw milk sample to be tested.

[0031] Main reagents: commercial qPCR premix (Takara, Dalian, China), sterile nuclease-free water.

[0032] Suspension buffer: 25 mL Tris-HCl solution (100 mmol / L, pH 7.2), 20 mL EDTA solution (1 mmol / L), 9 g glucose, add water to make up to 1 L, dispense and autoclave.

[0033] Lysozyme solution: The lysozyme powder (Solarbio-L8120) was dissolved in PBS buffer to achieve a final storage concentration of 50 μg / mL.

[0034] Lysozyme buffer: 10 mL of PBS buffer (10 mmol / L, pH 7.2), 5 mL of EDTA solution (1 mmol / L), and 4 mL of glycerol.

[0035] Proteinase K solution: Dissolve the proteinase powder in PBS buffer to achieve a final storage concentration of 100 μg / mL.

[0036] Centrifuge column method for bacterial genomic DNA extraction kit: includes lysis buffer (NaOH-SDS solution 250 mmol / L NaOH, 1% (w / v) SDS), neutralization buffer (NaAc solution 3 mol / L NaAc (pH=4.8)), wash buffer (Tris-HCl alcohol solution 10 mmol / L Tris-HCl (pH 7.5), 80% ethanol), centrifuge tubes, and DNA adsorption column.

[0037] Main instruments: Real-time quantitative PCR instrument; Centrifuge 1: maximum relative centrifugal force 20913 g, rotor capacity 6×50 mL centrifuge tubes; Centrifuge 2: maximum relative centrifugal force 21300 g, rotor capacity 24×2.0 mL centrifuge tubes; Metal bath: temperature control range 0-100℃, equipped with 1.5 mL and 2 mL working modules.

[0038] 2. Genomic DNA extraction from samples Before starting qPCR testing, microbial genomic DNA must first be extracted from the raw milk sample.

[0039] Take 20 mL of the raw milk to be tested and put it into a 50 mL centrifuge tube. Centrifuge at 10,000 rpm for 15 min, pour out the supernatant, and wipe off the fat on the tube wall with tissue paper. Add 2 mL of suspension buffer, aspirate and mix the precipitate at the bottom of the centrifuge tube, and transfer it to a 2 mL centrifuge tube. Centrifuge at 2,000 rpm for 10 min. Transfer all the supernatant to a new 1.5 mL centrifuge tube, centrifuge at 12,000 rpm for 5 min, and discard the supernatant. Resuspend the precipitate with 110 μL of lysozyme buffer, add 70 μL of lysozyme solution, and treat at 37 ℃ for 15 min. Add 20 μL of proteinase K solution and 220 μL of lysis buffer to the above solution, vortex, and incubate at 70 °C for 5 min. Add 220 μL of anhydrous ethanol and vortex thoroughly for 15 s. Transfer all the above solutions and precipitate to a DNA adsorption column and centrifuge at 12000 rpm for 1 min. Add 500 μL of neutralization buffer and centrifuge at 12000 rpm for 1 min. Add 600 μL of wash buffer and centrifuge at 12000 rpm for 1 min, then discard the waste liquid. Add another 600 μL of wash buffer and centrifuge at 12000 rpm for 3 min. Place the adsorption column on clean filter paper and let it stand for 2 min. Add 50 μL of ddH2O, let it stand for 2 min, and then centrifuge at 12000 rpm for 2 min to obtain the extracted nucleic acid. Finally, dissolve the extracted nucleic acid in 50 μL of sterile, nucleic acid-free water. The concentration and purity of the extracted DNA were determined using a micro spectrophotometer (A260 / A280 ratio between 1.8 and 2.0), and the DNA template was stored at -20°C for later use.

[0040] 3. Preparation of qPCR reaction system This step details the preparation methods for individual reactions and overall systems of multiple reactions.

[0041] A single reaction system (total volume 25 μL) was prepared as follows: 13 μL of 2× qPCR premix, 1 μL of upstream primer F (10 μM), 1 μL of downstream primer R (10 μM), 1 μL of probe (10 μM), 4 μL of sterile nuclease-free water, 5 μL of DNA template, and a total volume of 25 μL.

[0042] The upstream primer F is: CAAGAAGCCGATCAAACGGT (SEQ ID No. 1) Downstream primer R: TGACAATGTCGCGATCTACC (SEQ ID No. 2) Probe: FAM-TATTTTACTTGC-BHQ (SEQ ID No. 3).

[0043] Preparation of the overall multi-reaction system (for n samples, it is recommended to prepare n+1 reaction amounts to compensate for losses): Calculate the required total amount: For example, for 10 samples, a system of 11 reactions needs to be prepared.

[0044] In a sterile 1.5 mL centrifuge tube, add the following components in sequence and vortex to mix: 2× qPCR premix: 13 × (n+1) μL Upstream primer F: 1 × (n+1) μL Downstream primer R: 1 × (n+1) μL Probe: 1 × (n+1) μL Sterile nuclease-free water: 4 × (n+1) μL The above mixture is thoroughly vortexed and mixed, and the droplets on the tube wall are collected by short-term centrifugation.

[0045] Using a pipette, accurately dispense 20 μL of the mixture into each qPCR reaction well / tube.

[0046] 4. Sample addition and preparation Add 5 μL of template DNA from the corresponding sample to each reaction well / tube containing 20 μL of the mixture. Set up a negative control (replace the template DNA with 5 μL of water) and a positive control (replace the template DNA with 5 μL of plasmid containing the target sequence or DNA from a known positive strain).

[0047] Tightly cap the qPCR eight-tube strip. Gently tap the tube or plate wall to ensure the liquid is thoroughly mixed, then briefly centrifuge in a mini centrifuge to collect all the liquid at the bottom of the tube, avoiding the formation of air bubbles.

[0048] 5. qPCR amplification program setup and execution Place the prepared qPCR reaction plate / tube into the real-time quantitative PCR instrument and run it according to the following procedure: Stage 1: Pre-denaturation at 95℃ for 5 minutes; Phase 2: Amplification Cycle (repeated 40 times) Step 1: Denature at 95°C for 15 seconds; Step 2: Annealing / Extension at 58.5℃ for 30 seconds (fluorescence signal is acquired at this step). Note: The fluorescence acquisition channel should be set according to the fluorophore of the probe used, such as the FAM channel.

[0049] 6. Results Analysis Baseline and threshold settings: After the reaction, use the instrument's software to automatically or manually set the baseline and threshold of the fluorescence signal. The threshold is usually set in the middle of the exponential growth phase of the amplification curve.

[0050] Ct value determination: Each reaction well will have a Ct value (cycle threshold), which is the number of cycles required for the fluorescence signal to reach the set threshold.

[0051] Result interpretation criteria: Positive: The amplification curve of the test sample shows a typical S-shape, and the Ct value is ≤ 35 (this threshold can be determined by experimental verification), and the coefficient of variation (CV) of the Ct value of the three parallel replicates should be less than 5%, which is considered positive.

[0052] Negative: No amplification curve or Ct value > 35, judged as negative.

[0053] Quality control: Positive controls should be positive and negative controls should be negative; otherwise, the experiment is invalid and needs to be repeated.

[0054] Example 2 This embodiment tests the specificity of the detection method in Example 1, and the steps are as follows: Raw milk samples containing *Bacillus thermophilus*, *Bacillus licheniformis*, *Bacillus subtilis*, and *Bacillus cereus*, with a bacterial concentration of 10, were used. 3 CFU / mL was tested according to the detection method in Example 1, and the results are as follows: Figure 1 As shown.

[0055] The results show that the detection method of the present invention can accurately distinguish Bacillus thermophilus from other Bacillus species in raw milk samples, with only Bacillus thermophilus showing specific amplification, indicating that the detection method of the present invention has good specificity.

[0056] Example 3 This embodiment tests the sensitivity of the detection method in Example 1, and the steps are as follows: Known concentration (10) 5 The thermophilic Bacillus amyloliquefaciens solution (CFU / mL) was serially diluted 10-fold, and samples of different concentrations were tested according to the detection method in Example 1 to establish a standard curve. Figure 2 As shown, the standard curve for *Bacillus thermophilus* is Y = -2.119x + 33.95.

[0057] The test results are shown in Table 1.

[0058] Table 1

[0059] It is evident that different bacterial concentrations correspond to different CT values; the bacterial concentration is 10...5 At that time, the CT value was the lowest. (The last part, "10," appears to be a typo and can be left as is.) 5 The bacterial suspensions of different concentrations were diluted sequentially to obtain 10... 4 10 3 10 2 10 1 10 0 10 -1 The bacterial solutions of various concentrations were tested. Except for the lowest concentration solution, all other concentrations were detectable. This demonstrates that the sensitivity of the detection method of this invention can reach 10. 0 CFU / mL.

[0060] In summary, the detection method of this invention advances the detection technology of Bacillus amyloliquefaciens in dairy products from the "time-consuming, crude, and non-specific" era of classical microbiology to the "rapid, accurate, highly sensitive, and automated" era of molecular biology. It not only directly addresses the technical shortcomings of existing industry standards, but more importantly, it provides the dairy industry with a brand-new quality monitoring tool, possessing significant practical application value for ensuring dairy product safety and improving the overall technical level of the industry.

[0061] Comparative Example 1 This comparative example provides a method for detecting heat-consuming amyloliquefaciens in raw milk, the only difference from Example 1 being the following steps: In the suspension buffer formulation, the 100 mmol / L, pH 7.2 Tris-HCl solution was replaced with a 10 mmol / L, pH 8 solution, and the 1 mmol / L EDTA solution was replaced with a 5 mmol / L solution, with the same volume as in Example 1, but without the addition of glucose.

[0062] The sensitivity was tested according to the detection method in Example 3, and the results showed that the sensitivity was only 4.1 × 10⁻⁶. 2 CFU / mL.

[0063] Comparative Example 2 This comparative example provides a method for detecting heat-consuming amyloliquefaciens in raw milk. The only difference from Example 1 is that the step of bacterial enrichment in raw milk is omitted.

[0064] The sensitivity was tested according to the detection method in Example 3, and the results showed that the sensitivity was only 1.9 × 10⁻⁶. 2 CFU / mL.

[0065] Comparative Example 3 This comparative example provides a method for detecting heat-consuming amyloliquefaciens in raw milk, the only difference from Example 1 being the following steps: The step of transferring all supernatant to a new 1.5 mL centrifuge tube after centrifugation at 2000 rpm for 10 min was omitted. The sensitivity was then tested according to the detection method in Example 3, and the results showed a sensitivity of only 2.1 × 10⁻⁶. 3 CFU / mL.

[0066] Comparative Example 4 This comparative example provides a method for detecting heat-consuming amyloliquefaciens in raw milk, the only difference from Example 1 being the following steps: Real-time quantitative amplification was performed using different primers. The two sets of primers after the replacement are as follows: Upstream primer 1: CGTCCATGCCGGAATCTGTT (SEQ ID No. 4); Downstream primer 1: CCCTTTCCCCTCGTCAACTC (SEQ ID No. 5).

[0067] Upstream primer 2: CGATTACCAAAAGCGGTCGG (SEQ ID No. 6); Downstream primer 2: GCAAAATTGGCGATGGCTGT (SEQ ID No. 7).

[0068] The specificity was tested according to the detection method of Example 2. The results showed that the amplification efficiency of the two sets of primers used in this comparative example for Bacillus amyloliquefaciens was much lower than that in Example 1. At the same time, the melting curve of the replaced primers had disordered peaks, with obvious non-specific amplification and the CT value was also significantly higher than that in Example 1. Figure 3 ).

[0069] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for detecting heat-consuming amyloliquefaciens in raw milk, characterized in that, include: After centrifuging the raw milk, the precipitate was resuspended in suspension buffer, centrifuged again, and then resuspended in lysozyme buffer. The precipitate was then treated sequentially with lysozyme and proteinase K to obtain a pretreatment solution. Nucleic acids were extracted from the pretreatment solution. The suspension buffer is a mixture of Tris-HCl solution, EDTA solution, glucose and water; the lysozyme buffer is a mixture of PBS buffer, EDTA solution and glycerol. Using the nucleic acid as a DNA template, qPCR was performed using primers and probes; The primers include an upstream primer and a downstream primer; The sequence of the upstream primer is: CAAGAAGCCGATCAAACGGT The sequence of the downstream primer is: TGACAATGTCGCGATCTACC The probe sequence is: TATTTTACTTGC.

2. The detection method according to claim 1, characterized in that, In the suspension buffer, the ratio of Tris-HCl solution, EDTA solution and glucose is (25~30) mL: (15~25) mL: (8~10) g; The concentration of the Tris-HCl solution was 100 mmol / L, the pH was 7.2, and the concentration of the EDTA solution was 1 mmol / L.

3. The detection method according to claim 2, characterized in that, The concentration of glucose in the suspension buffer is (8~10) g / L.

4. The detection method according to any one of claims 1 to 3, characterized in that, In the lysozyme buffer, the volume ratio of PBS buffer, EDTA solution and glycerol is (8~12):(3~6):(2~5); the concentration of PBS buffer is 10 mmol / L, the pH is 7.2, and the concentration of EDTA solution is 1 mmol / L.

5. The detection method according to any one of claims 1 to 3, characterized in that, The treatment with lysozyme and proteinase K is described as treatment with a PBS solution of lysozyme and a PBS solution of proteinase K. Preferably, the concentration of lysozyme in the PBS solution is 40-60 μg / mL; Preferably, the concentration of proteinase K in the PBS solution is 80~120 μg / mL.

6. The detection method according to any one of claims 1 to 3, characterized in that, After resuspending the precipitate with suspension buffer, centrifuge at 2000-5000 rpm, then centrifuge at 12000 rpm or higher, and then resuspend the precipitate with lysozyme buffer.

7. The detection method according to any one of claims 1 to 3, characterized in that, Nucleic acid was extracted from the pretreatment solution using an adsorption column method.

8. The detection method according to any one of claims 1 to 3, characterized in that, The probe has a fluorescent reporter group attached to its 5' end and a fluorescent quencher group attached to its 3' end. Preferably, the fluorescent reporter group is FAM; and the fluorescent quencher group is BHQ.

9. The detection method according to any one of claims 1 to 3, characterized in that, The reaction procedure for the qPCR reaction is as follows: pre-denaturation at 95°C for 5 minutes; denaturation at 95°C for 15 seconds; annealing and extension at 58.5°C for 30 seconds; repeat the denaturation and annealing extension cycles 35-40 times.

10. The detection method according to any one of claims 1 to 3, characterized in that, The raw milk refers to cow's milk raw materials, finished cow's milk, or dairy products.