A SNP marker and a detection primer pair related to the characteristics of stem and nodule root primordium of sesbania grandiflora and application thereof

By developing SNP molecular markers and specific primer pairs in stem-nodled sesquiterpenes, the problem of locating and identifying adventitious root primordia of stem-nodled sesquiterpenes has been solved, enabling rapid breeding and efficient screening, and demonstrating significant breeding application value.

CN122146934AActive Publication Date: 2026-06-05INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202610640571.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-05-11
Publication Date
2026-06-05
Estimated Expiration
2046-05-11

AI Technical Summary

Technical Problem

The lack of effective SNP molecular markers in existing technologies for the localization and identification of adventitious root primordia in stem nodules of Sesbania sesquiterpenes leads to high breeding costs, long cycles, and difficulty in achieving multi-gene aggregation and genetic gain.

Method used

A molecular marker for the C/T mutation located at 10,433,968 bp on chromosome 4 of the reference genome of sesquiterpenoid stem bud ...

Benefits of technology

This method enables rapid identification of adventitious root primordia in stem-nodled sesbania, shortens the breeding cycle, improves screening efficiency, and has significant potential for breeding applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122146934A_ABST
    Figure CN122146934A_ABST
Patent Text Reader

Abstract

This invention discloses a SNP marker and detection primer pair associated with the adventitious root primordium trait of *Senecio scandens* with stem nodules, and its application, belonging to the field of molecular biology technology. Based on SNP marker technology, this invention develops an SNP marker and detection primer pair linked to the adventitious root primordium trait of *Senecio scandens* with stem nodules. This invention involves phenotypic identification of mutants induced by EMS mutagenesis in *Senecio scandens* with stem nodules, followed by isolation, purification, population construction, and genetic analysis combined with Mutmap. + The SNP marker associated with adventitious root primordia is located at 10,433,968 bp on chromosome 4 of *Senecio scandens*, involving a C / T mutation. When the genotype is T, *Senecio scandens* lacks adventitious root primordia. This invention's SNP molecular marker can screen F2 populations at the early cotyledon stage, identifying mutants and wild types without phenotypic differences, thus improving screening efficiency, shortening the breeding cycle, and demonstrating value in marker-assisted breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to an SNP marker and detection primer pair and its application related to the primordia traits of stem nodule adventitious roots. Background Technology

[0002] Sesbania, widely distributed in tropical and subtropical regions, is characterized by its tolerance to salinity and waterlogging. It is primarily used as green manure, soil conditioner, or forage crop. As green manure, it exhibits excellent nitrogen fixation, contributing to soil improvement. Stem-nodled sesbania, as a diploid plant, has advantages over tetraploid sesbania, such as a smaller genome and simpler genetic background, enabling more efficient functional screening and verification of superior genes. Biological nitrogen fixation is not only an indispensable part of the biological cycle but also an important area of ​​agricultural research. The cultivation and application of highly efficient biological nitrogen-fixing crops are of great significance for environmental and agricultural sustainable development. Stem-nodled sesbania is one of the very few plants capable of nitrogen fixation through stem nodulation. Reports indicate its nitrogen fixation efficiency is 2.3 times that of root nodules. The adventitious root primordia in its stem are the fundamental reason for its interaction with stem nodules to form stem nodules. Therefore, creating mutants with adventitious root primordia formation and identifying key genes for adventitious root primordia formation are crucial for expanding the forms of crop nitrogen fixation and improving nitrogen fixation capacity.

[0003] Molecular marker-assisted selection (MMR) technology enables targeted selection through precise genotype identification, significantly reducing breeding costs and shortening the variety selection cycle. It also allows for multi-gene aggregation, generating significant socio-economic value while enhancing genetic gain. With the rapid development of high-throughput sequencing technology, molecular marker systems based on single nucleotide polymorphisms (SNPs) have become core tools in crop genetic research. These markers have played a crucial role in fine gene mapping and molecular design breeding of important crops such as rice, maize, and wheat. However, the identification and breeding of stem-nodled sesquiterpene varieties requires the systematic mapping of key genetic loci, but currently, there is little research on the mapping of key genes in the adventitious root primordia of stem-nodled sesquiterpene. Therefore, how to develop SNP molecular markers linked to stem-nodled sesquiterpene to assist in the fine mapping of major genes involved in the formation of adventitious root primordia has become a problem urgently needing to be solved by those skilled in the art. Summary of the Invention

[0004] To address the shortcomings of existing technologies, the present invention provides the following technical solution: The first aspect of the present invention provides an SNP molecular marker related to the formation of adventitious root primordia in the stem of sesquiterpene stem. The molecular marker is located at 10,433,968 bp on chromosome 4 of the sesquiterpene stem reference genome and involves a C / T mutation. When the genotype is T, sesquiterpene stem has no adventitious root primordia.

[0005] Wild-type stem nodule sesquiterpene has the nucleotide sequence fragment shown in SEQ ID NO. 4, while the adventitious root primordium mutant M-1 has the nucleotide sequence fragment shown in SEQ ID NO. 3. The mutation site is located at position 283 of SEQ ID NO. 4 or SEQ ID NO. 3, and is a mutation from C in SEQ ID NO. 4 to T in SEQ ID NO. 3.

[0006] A second aspect of this invention provides an SNP-specific primer pair for identifying adventitious root primordia of stem-nodled sesquiterpenes, the nucleotide sequences of which are as follows: SEQ ID NO.1: 5'-TCTGTTTCTAAGTTCGTTTCTTGC-3'; SEQ ID NO.2: 5'-GAACACAGAATTGGTTACATAAATTCAG-3'.

[0007] A third aspect of the present invention provides the application of the specific primer pair, wherein the application is any of the following: (1) Application in identifying adventitious root primordia of stem nodules of sesquiterpene; (2) Application in the preparation of products for identifying the adventitious root primordia of stem nodules of sesquiterpene; The genomic DNA of the stem-nodled sesquiterpenoid was amplified by PCR using the specific primers described above. The PCR amplification products were sequenced. The sequence of the PCR amplification product of stem-nodled sesquiterpenoid without adventitious root primordia is shown in SEQ ID NO.3; the sequence of the PCR amplification product of stem-nodled sesquiterpenoid with adventitious root primordia is shown in SEQ ID NO.4.

[0008] Furthermore, the product includes a stem nodule guarana genome detection kit or a stem nodule guarana whole genome SNP chip.

[0009] A fourth aspect of the present invention provides a method for identifying adventitious root primordia of stem-nodled sesquiterpene, comprising the following steps: S1. Extract genomic DNA from the cotyledons or plants of sessile stem nodules; S2. Using the DNA extracted in step S1 as a template, the DNA of the sample to be tested is amplified by PCR using the above-mentioned specific primers to obtain PCR amplification products. S3. Detection of PCR amplification products: The PCR amplification products were electrophoresed on a 1.2% agarose gel at 100V in 1×TBE buffer. The gel running results were photographed and recorded in a gel imaging system. The amplification product had only one band, and the band size was 478 bp, which was the target band. S4. Result Interpretation: The PCR amplification products were sequenced. The sequence of the PCR amplification product of stem nodule sesquiterpenoid without adventitious root primordia is shown in SEQ ID NO.3; the sequence of the PCR amplification product of stem nodule sesquiterpenoid with adventitious root primordia is shown in SEQ ID NO.4.

[0010] Furthermore, the PCR amplification reaction system is as follows: 20 μL, including 1 μL genomic DNA, 10 μL 2×PCRMix, 0.4 μL each of upstream and downstream primers, and 8.2 μL ddH2O.

[0011] Furthermore, the PCR amplification program is as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 15 s, 54℃ annealing for 15 s, 72℃ extension for 15 s, 35 cycles; 72℃ extension for 5 min.

[0012] The present invention has the following beneficial effects: This invention involves phenotypic identification and screening of a mutant library derived from EMS mutagenesis of *Senecio scandens* var. *stem-nodularis*. The resulting mutant M-1, lacking adventitious root primordia, was isolated, purified, and a population was constructed. Combined with genetic analysis and Mutmap+ mapping, it was determined that a SNP at chromosome 10433968 bp in *Senecio scandens* var. *stem-nodularis ... Attached Figure Description

[0013] Figure 1 Comparison of the whole plant and stem of stem-nodled sesquiterpene 5094 and M-1 mutant: the left is stem-nodled sesquiterpene mutant M-1, and the right is stem-nodled sesquiterpene 5094.

[0014] Figure 2 Genetic localization and mutation site analysis of the stem nodule sesquiterpene mutant M-1.

[0015] Figure 3 Development of molecular markers for adventitious root primordium formation mutants: A is the electrophoretic analysis of wild-type (5094) and mutant PCR amplification, M is the StarMarker D2000 Marker; lane 1 is the electrophoretic band of wild-type WT-1 amplification; lanes 2-3 are the electrophoretic bands of mutants M-1 to M-2 amplification; B is the sequencing peak analysis of mutation sites of WT-1, mutants M-1 and M-2.

[0016] Figure 4The correlation between different genotypes (aa, Aa, and AA) and phenotypes (mutant: no adventitious root primordia; wild type: with adventitious root primordia) in the F2 segregating population was analyzed. The results showed that all individuals with the aa genotype exhibited the mutant phenotype, while individuals with the Aa and AA genotypes exhibited the wild-type phenotype, indicating that this SNP marker is closely linked to the adventitious root primordia trait. Detailed Implementation

[0017] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.

[0018] Unless otherwise specified, the methods used in this embodiment are conventional methods known to those skilled in the art, and the reagents and materials used are commercially available products.

[0019] Explanation of the sequence list: SEQ ID NO.1: TCTGTTTCTAAGTTCGTTTCTTGC SEQ ID NO.2: GAACACAGAATTGGTTACATAAATTCAG SEQ ID NO.3: TCTGTTTCTAAGTTCGTTTCTTGCAAACAAAGGCTTCATGTTGATAAACAAGAAGAATGAGCAAGAACATGAAATTCAGTCGGCTCAGGGATCATTGTGGAGCTTTGTGCTTTTTGGCGGTGTGCTTGTTGTTTCTGAACT TGGGTTTGTGCTGTTCTTTGAATGAAGAAGGTAGTGAAATCTTGAGTTTGTAGAATCTTGTATTCTCCTATGATTAGTTGTGGCCTTGTGTGAAGAAGGTGCTCAATCATAGTCCTATTTGGTTTCTCTGTGCAGGTAACG TTCTTTTGAAATTGAAGCAGAGAATAATGAGTGACCCTTTTGATGCTCTGTCAAATTGGATTGATGATGAAGCAGTTGTTGACCCGTGTAATTGGTTCGGAGTTGAGTGCTCTGATGGAAGAGTTGTGGTCTTGTAAGTGGTGATTCTATTAACTGTTTTTCAGAAAACTGAATTTATGTAACCAATTCTGTGTTC SEQ ID NO.4: TCTGTTTCTAAGTTCGTTTCTTGCAAACAAAGGCTTCATGTTGATAAACAAGAAGAATGAGCAAGAACATGAAATTCAGTCGGCTCAGGGATCATTGTGGAGCTTTGTGCTTTTTGGCGGTGTGCTTGTTGTTTCTGAACT TGGGTTTGTGCTGTTCTTTGAATGAAGAAGGTAGTGAAATCTTGAGTTTGTAGAATCTTGTATTCTCCTATGATTAGTTGTGGCCTTGTGTGAAGAAGGTGCTCAATCATAGTCCTATTTGGTTTCTCTGTGCAGGTAACG C TCTTTTGAAATTGAAGCAGAGAATAATGAGTGACCCTTTTGATGCTCTGTCAAATTGGATTGATGATGAAGCAGTTGTTGACCCGTGTAATTGGTTCGGAGTTGAGTGCTCTGATGGAAGAGTTGTGGTCTTGTAAGTGGTGATTCTATTAACTGTTTTTCAGAAAACTGAATTTATGTAACCAATTCTGTGTTC The M-1 stem-nodled sesquiterpenoid adventitious root primordium mutant used in this experiment was obtained in the laboratory. It was a mutant without adventitious root primordia identified in an EMS mutagenesis population with stem-nodled sesquiterpenoid 5094 as the genetic background. Genome resequencing and Mutmap+ mapping revealed that the SNP at position 10433968 bp on chromosome 4 of the stem-nodled sesquiterpenoid is highly linked to adventitious roots, involving a C / T mutation. When the genotype is T, the stem-nodled sesquiterpenoid has no adventitious root primordia. Furthermore, the M-1 mutant is a recessive mutation, indicating that the wild type is dominant. This invention provides important reference for the rapid identification of adventitious root primordium traits in segregating populations of stem-nodled sesquiterpenoid and for the breeding of varieties of stem-nodled sesquiterpenoid. It also has broad application prospects in the field of locating key genes for adventitious root primordia in sesquiterpenoid and establishing crop stem nitrogen fixation systems.

[0020] Example 1: Development and application of a SNP marker associated with the adventitious root primordia trait of stem-nodled sesquiterpene. 1. Identification and phenotypic analysis of M-1 stem nodule sesquiterpenoid stem adventitious root primordia mutants The M-1 stem-nodled sesquiterpenoid adventitious root primordium mutant used in this experiment was obtained from the laboratory. It was a mutant without stem adventitious root primordia identified within an EMS-induced mutagenesis population with stem-nodled sesquiterpenoid 5094 as the genetic background. After self-crossing the M-1 stem-nodled sesquiterpenoid adventitious root primordium mutant, it was sown with stem-nodled sesquiterpenoid 5094 in the same experimental field. After two generations of self-crossing observation, both results showed that the M-1 mutant had a consistent phenotype and was genetically stable. Figure 1 As shown, the M-1 mutant lacks adventitious root primordia in its stem compared to the wild-type 5094.

[0021] 2. Identification of linked SNPs formed by adventitious root primordia in the stem of M-1 This invention is based on the MutMap+ strategy (MutMap + Genetic mapping and mutant identification without crossing in rice. [J]. PloS one, 2013, 8(7):e68529. DOI:10.1371 / journal.pone.0068529.) To locate the linked SNPs of the adventitious root primordium mutant M-1 in sesquiterpene stem. The specific steps are as follows: During the seedling stage, 31 normal plants and 31 mutant plants with stem adventitious root primordia development loss were collected from the segregating population of *Senecio scandens* 5094. Equal amounts of leaves from each population were mixed to construct a wild-type DNA pool with a normal phenotype and a mutant DNA pool. Whole-genome sequencing analysis was performed on these two DNA pools. Identified SNPs were screened according to the G->A (C->T) base mutation pattern and the SNP-Index = 1.0 standard. Based on this, the variant types of the screened SNPs were analyzed, including premature transcription termination / loss of transcription, splicing site donor / recipient, start codon gain / loss, and non-synonymous mutations. By calculating and analyzing the mean SNP-Index within a 3 Mb range upstream and downstream of each SNP, a significant SNP signaling site region was identified in different segregating populations. A distinct peak was observed on chromosome 4 in the whole genome of *Senecio scandens* 5094 across all populations.

[0022] Analysis of chromosome 4, using Δ(SNP-index)≥0.4 as the screening criterion, revealed that the SNP at position 10433968 bp on chromosome 4 is highly linked to an adventitious root. , The wild-type phenotype is mutated from C to T ( Figure 2 ).

[0023] 3. Molecular marker design for wild-type and M-1 mutants Further sequencing verification of this site was performed. Using genomic DNA as a template, genomic DNA was extracted from wild-type 5094 and the mutant without adventitious root primordia formation using the RaPure Plant DNA Kit. After passing electrophoresis quality checks, the DNA was used for subsequent PCR analysis. Specific primer pairs were designed based on the M-1 mutant gene site, amplifying a 478 bp sequence. The primer pair sequences are as follows: SEQ ID NO.1: 5'-TCTGTTTCTAAGTTCGTTTCTTGC-3'; SEQ ID NO. 2: 5'-GAACACAGAATTGGTTACATAAATTCAG-3'.

[0024] PCR amplification was used to detect WT-1 (plants with a wild-type phenotype (with normal adventitious root primordia) obtained from the segregating population) and mutant M-2 (plants with a mutant phenotype (without normal adventitious root primordia) obtained from the segregating population) using specific primer pairs. The PCR amplification system included 12.5 μL of Taq Master Mix (2X), 1.0 μL of forward and reverse primers, 2.0 μL of genomic DNA, and 8.5 μL of ddH2O, for a total system volume of 25 μL. The PCR amplification reaction program was as follows: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 54℃ annealing for 30 s, 72℃ extension for 40 s, 72℃ total extension for 10 min, and storage at 10℃ for 2 h. After the PCR reaction, the product size was detected by 1.2% agarose gel electrophoresis. The product size was consistent with the theoretical fragment size, the product specificity was high, and there were no impurities. PCR products were sent to a biosequencing company for reverse primer sequencing. The sequencing results were analyzed using SnapGene software to identify mutation sites. The results showed that the sequences of the PCR amplification products of mutants M-1 and M-2 were as shown in SEQ ID NO.3, with no adventitious root primordia; the sequence of the PCR amplification product of the wild-type phenotype 5094 (WT-1) was as shown in SEQ ID NO.4. Figure 3 This indicates that the marker can identify wild-type and mutant genotypes and can be used for molecular identification aids in molecular breeding.

[0025] 4. Application of molecular markers (1) Using the genomic DNA of a single seedling in the cotyledon stage of the F2 population to be tested as a template, PCR amplification was performed using the specific primer pair (SEQ ID NO.1 and SEQ ID NO.2) corresponding to the SNP molecular marker described in this invention to obtain the target amplification product; (2) Detection and analysis of amplification products: After detection by 1.2% agarose gel electrophoresis, the PCR products were recovered, purified and sequenced. The target SNP sites were confirmed by sequence alignment software to determine the genotype. (3) The genotype determination method is as follows: when the detection site is a mutant allele (T type), it is determined to be a mutant genotype, and the corresponding phenotype is no adventitious root primordia; when the detection site is a wild-type allele (C type), it is determined to be a wild-type genotype, and the corresponding phenotype is having normal adventitious root primordia; when the detection site detects C / T bimodal peaks at the same time, it is determined to be a heterozygous genotype. (4) The F2 segregating population was tested using the above method. In this embodiment, 74 individual plants were randomly selected from the F2 population, and genomic DNA was extracted at the cotyledon stage and subjected to PCR amplification and sequencing analysis; (5) The test results showed that among the 74 F2 single plants, the SNP molecular markers described in this invention could clearly distinguish individuals with different genotypes. Among them, the homozygous mutant TT (genotype aa) showed no adventitious root primordia, the homozygous wild-type CC (genotype AA) showed normal adventitious root primordia, and the heterozygous heterozygous CT (genotype Aa) showed a segregated phenotype with adventitious root primordia. (6) Present the molecular detection results (Table 1 and ...) Figure 4 A comparative analysis of the results with the later phenotypic survey results showed that the two were completely consistent, indicating that the SNP marker was closely linked to the target trait and had high accuracy and stability.

[0026] Table 1. Results of SNP marker application in identifying mutants and wild types in the F2 population.

[0027] Therefore, the SNP molecular markers described in this invention can be used for early and rapid screening of the F2 population during the cotyledon stage of plants, and can identify mutants and wild-type individuals without waiting for phenotype formation, thereby significantly improving screening efficiency, shortening the breeding cycle, and having good application value in molecular marker-assisted breeding.

Claims

1. A pair of SNP-specific primers for identifying adventitious root primordia of stem-nodled sesquiterpenes, characterized in that, The nucleotide sequences of the specific primer pair are as follows: SEQ ID NO.1: 5'-TCTGTTTCTAAGTTCGTTTCTTGC-3'; SEQ ID NO. 2: 5'-GAACACAGAATTGGTTACATAAATTCAG-3'.

2. The application of the specific primer pair according to claim 1, characterized in that, The application is any one of the following: (1) Application in identifying adventitious root primordia of stem nodules of sesquiterpene; (2) Application in the preparation of products for identifying the adventitious root primordia of stem nodules of sesquiterpene; The genomic DNA of the stem-nodled sesquiterpenoid was amplified by PCR using the specific primers described above. The PCR amplification products were sequenced. The sequence of the PCR amplification product of stem-nodled sesquiterpenoid without adventitious root primordia is shown in SEQ ID NO.3; the sequence of the PCR amplification product of stem-nodled sesquiterpenoid with adventitious root primordia is shown in SEQ ID NO.

4.

3. The application according to claim 2, characterized in that, The products include a stem nodule guar gum genome detection kit or a stem nodule guar gum whole genome SNP chip.

4. The application of an SNP molecular marker associated with the adventitious root primordia of stem-nodled sesquiterpenes in the identification of adventitious root primordia of stem-nodled sesquiterpenes, characterized in that, The SNP molecular marker is located at chromosome 4, physical location 10433968, of the *Lepidium stolonifera* reference genome, involving C / T single nucleotide polymorphisms: when the base at the SNP site is T, *Lepidium stolonifera* has no adventitious root primordia; when the base at the SNP site is C, *Lepidium stolonifera* has adventitious root primordia.

5. A method for identifying adventitious root primordia of stem-nodled sesquiterpene, characterized in that, Includes the following steps: S1. Extract genomic DNA from the cotyledons or plants of sessile stem nodules; S2. Using the DNA extracted in step S1 as the template for amplification, the DNA of the sample to be tested is amplified by PCR using the SNP-specific primers described in claim 1 to obtain the PCR amplification product. S3. Detection of PCR amplification products: The PCR amplification products were electrophoresed on a 1.2% agarose gel at 100V in 1×TBE buffer. The gel running results were photographed and recorded in a gel imaging system. The amplification product had only one band, and the band size was 478 bp, which was the target band. S4. Result Interpretation: The PCR amplification products were sequenced. The sequence of the PCR amplification product of stem nodule sesquiterpenoid without adventitious root primordia is shown in SEQ ID NO.3; the sequence of the PCR amplification product of stem nodule sesquiterpenoid with adventitious root primordia is shown in SEQ ID NO.

4.

6. The method according to claim 5, characterized in that, The PCR amplification reaction system consisted of 20 μL, including 1 μL of genomic DNA, 10 μL of 2×PCR Mix, 0.4 μL each of upstream and downstream primers, and 8.2 μL of ddH2O.

7. The method according to claim 5, characterized in that, The PCR amplification program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 15 s, 54℃ annealing for 15 s, 72℃ extension for 15 s, 35 cycles; 72℃ extension for 5 min.

Citation Information

Patent Citations

  • Application of SAL protein and coding gene thereof to regulation of root system architecture

    CN106589084A

  • Application of SHR-SCR in fate determination of cortex cells of leguminous plants and modification of division potential of cortical cells of non-leguminous plants

    CN111635955A

  • Application of SNP molecular marker A08-12271831 in identification of Chinese cabbage clubroot resistance

    CN116622896A

  • InDel molecular marker for breeding or assisted breeding of stem tumor sesbania and application of InDel molecular marker

    CN119410834A