Three-dimensional visual functional gene browser and system based on z-closed loop encoding

By using Z-series closed-loop coding and a three-dimensional layer location coordinate system, combined with a standardized character library and modular annotation, the problems of interface complexity and incomplete coding in existing gene browsers have been solved, achieving gene numbering standardization and improved operational efficiency.

CN122157809APending Publication Date: 2026-06-05江典秋
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
江典秋
Filing Date
2026-03-09
Publication Date
2026-06-05

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application belongs to the field of biological information visualization, and discloses a three-dimensional visualization functional gene browser and system based on Z series closed loop coding, which solves the problems of track disorder, arc winding, dependence on scaling and incomplete coding of existing tools. The application constructs Z series closed loop coding, packs genes and non-gene regions into Z0~ZN units, and adapts repeat sequences and ring chromosomes. L-X-Y three-dimensional coordinates are established, 65 standardized character libraries are constructed, and amino acids are labeled in a six-color degenerate system. Modular labeling is adopted, continuous functional elements are integrated into M modules, three types of background colors are used to classify levels, the trunk area and the independent labeling area are displayed separately, and tracks and arcs are abandoned. The system supports Z unit addressing, three-level interaction, module linkage, variation marking, Hi-C double-end alignment and reverse complementary strand switching, realizes full-link visualization from whole genome to single base, and is suitable for genomics and clinical variation analysis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of bioinformatics, computational biology and information visualization, and in particular to a three-dimensional visualization functional gene browser and system based on Z-series closed-loop coding. Background Technology

[0002] Gene browsers are core tools in genomics research, used to visualize genome sequences, functional annotations, and variation data. Currently, mainstream gene browsers, including UCSC Genome Browser, IGV, and Ensembl Genome Browser, all employ a linear orbital architecture. The underlying architecture of existing gene browsers has the following drawbacks: 1. Linear orbital architecture: Displaying the genome along a linear coordinate axis, using multiple layers of orbitals to display information from different dimensions. This architecture leads to a rapidly increasing complexity of the interface as the number of orbitals increases, resulting in low information density and visual clutter. When the number of orbitals exceeds 10, users find it difficult to effectively identify them. 2. Arc-shaped annotation: For information requiring cross-regional connections, such as long-range interactions, splice variants, and homology relationships, existing browsers commonly use arc-shaped connections for annotation. This method produces a "spaghetti effect" as the data volume increases, with connecting lines intertwining and becoming completely unrecognizable when the number of connections exceeds 50. 3. Reliance on zooming: Existing browsers require multiple levels of zooming to switch between different granularities—zooming out to view a chromosome overview, zooming in to view gene structures, and then zooming in again to see the base sequence. This "magnifying glass" viewing method disrupts cognitive continuity, requiring users to frequently switch views. 4. Incomplete encoding coverage: Existing browsers primarily focus on gene regions at their underlying encoding level, lacking unified encoding rules for non-gene regions at the chromosome head, telomere regions at the ends, and large repetitive sequences in the middle. This results in these regions being either ignored or displayed in a chaotic manner. Repetitive sequence regions such as alpha satellites and centromeres are typically only displayed as gray blocks in existing browsers, making it impossible to view their internal structures. 5. Chaotic gene numbering: The same gene has multiple aliases, such as EGFR / ERBB1 / HER1 pointing to the same gene. The same chromosome segment is represented by long strings of coordinates, leading to difficulties in data exchange, literature confusion, and a heavy memory burden. 6. Insufficient visualization of amino acid degeneracy values: Existing browsers only display amino acid letters; degeneracy value information requires users to consult external databases or memorize it, resulting in low information recognition efficiency. To address the above problems, this invention proposes a novel underlying architecture for a gene browser. It replaces linear orbitals with Z-series closed-loop encoding, arc connections with three-dimensional coordinates, and multi-layer orbital superposition with a part-module two-level labeling system, fundamentally solving the inherent defects of existing browsers. Summary of the Invention

[0003] The purpose of this invention is to provide a three-dimensional visualization functional gene browser and system based on Z-series closed-loop coding, which solves the problems of existing tools such as messy tracks, tangled arcs, dependence on scaling, and incomplete coding.

[0004] To achieve the above objectives, the present invention adopts the following technical solution:

[0005] 1. Overall technical solution: This invention uses Z-series closed-loop coding as the underlying framework to achieve unique addressing and closed-loop coverage of the entire genome; it uses a three-dimensional layered location coordinate system to achieve fine positioning; it uses a part-module two-level annotation system to replace orbital superposition and arc connection; it uses 65 standardized character libraries to achieve unified visual expression; and it uses multi-level interactive design to achieve seamless jump from macro to micro.

[0006] 2. Z-series closed-loop coding system: Using the target chromosome as the unit, the Z-series closed-loop coding system is constructed according to the following rules: 2.1 Gene-independent coding: All genes on the target chromosome are numbered sequentially in the order of 5'→3' as G1, G2, G3…GN, where N is the total number of genes on the chromosome. The division of gene regions is determined according to the standard genome annotation file. 2.2 Non-gene-independent coding: All non-gene regions on the target chromosome are numbered sequentially as F1, F2, F3…FN+1, where F1 is the head non-gene region and FN+1 is the telomere non-gene region. Non-gene regions are defined as DNA regions that do not encode proteins, including regulatory regions, spacers, telomeres, centromeres, etc. 2.3 Gene-non-gene alternation rule: The entire chromosome is forced to follow the core rule of "starting with F1, followed by alternating arrangements in the order of G1-F2, G2-F3, G3-F4…GN-FN+1", and the end must end with FN+1 to achieve closed-loop coding of the entire chromosome. 2.4 Z-unit packaging rule: The non-gene F1 at the head is defined as the starting unit Z0; each combination of "gene + its following non-gene region" is defined as an independent functional unit, i.e., Z1=G1+F2, Z2=G2+F3……ZN=GN+FN+1, forming a continuous Z-series sequence of Z0, Z1, Z2……ZN, with continuous numbers without breaks. 2.5 Zero-length non-gene region rule: For scenarios where two or more genes are adjacent and there is no actual base interval, a virtual zero-length non-gene region is added between adjacent genes, assigned a unique number, and marked with "0". This region has no actual bases and no functional elements, and is only used to maintain the gene-non-gene staggered arrangement framework. For example, if G23 and G24 are adjacent, Z23.5[0] is inserted in the middle. 2.6 Specific Rules for Repetitive Sequences: For special repetitive regions such as α-satellite and centromere repetitive sequences exceeding 500 bp in length, a dedicated Z☆ unit is set: A dedicated identifier Z☆, and a gene padding marker G0☆ indicates that the region has no gene sequence. Internal segments are numbered n1, n2…nx, with segments ranging from 500-1000 bp. Double-clicking the n symbol reveals the corresponding base fragment. 2.7 Universal Rules for All Species: The Z-series closed-loop coding system is applicable to any chromosome of any species in humans, animals, plants, and microorganisms. Chromosome length differences only affect the Z-series total sequence number N, and the core coding logic remains unified. For circular chromosomes (such as bacterial genomes and mitochondrial genomes), a closed-loop extraction method is used, starting from any position as F1, looping around in the 5'→3' direction, and returning to the starting point to form a complete closed-loop code, without changing the Z-series numbering logic of internal gene and non-gene regions.

[0007] 3. Three-Dimensional Layer Location Coordinate System: Based on the Z-system skeleton, a three-dimensional layer location coordinate system is constructed to achieve precise positioning of parts within the Z-unit: 3.1 Coordinate Dimension Definition: Layer (L) is the vertical dimension, used to support the cross-layer arrangement of ultra-long Z-units. The X-axis represents zones, arranged southward, with each layer containing 100 zones, numbered 00-99; the Y-axis represents positions, arranged eastward, with each zone containing 100 positions, numbered 00-99; 100 zones and 100 positions combine to form 10,000 zones / positions, corresponding to 10,000 codons or symbols; every 10,000 zones / positions automatically move to the next layer, with layer numbers sequentially L1, L2, L3… which can be infinitely stacked until all content is encoded, without limiting the total length. Position (Y) is the horizontal vertical dimension, serving as the basic coordinate of a single part, increasing sequentially, with each part occupying 10-20 pixels. Position numbers are represented by Y001, Y002, Y003… 3.2 Component Definition: Individual amino acid units and non-coding region functional units within a Z-unit are defined as independent components. Each component is assigned a unique layer-region-position 3D coordinate system, such as L1X2Y156. Each component is also bound to its respective Z-unit identifier, forming dual positioning. Each Z-unit independently adopts a layer-region-position coordinate system. Layer numbers and region numbers of different Z-units are not reused across domains, ensuring the uniqueness, non-conflictability, and unified addressing across Z-units of the 3D coordinate system. 3.3 Main Display Area Layout: Components are linearly arranged in the main display area in the form of text symbols according to coordinate order. The base of the main display area is light gray, displaying only the colored bold text of the components and the coordinate scale below, without any track color blocks, arc connections, or functional graphic overlays.

[0008] 4. A Standardized Character Mapping Rule Base of 65 Characters: To achieve standardized and unambiguous visualization of gene sequences, this invention establishes a complete character mapping rule base, containing 65 standardized characters, divided into two main categories: gene-related and non-gene-related. 4.1 Gene-related symbols (25): (1) 19 amino acid symbols, with a uniform light gray background (RGB(240,240,240)). The letter colors are assigned according to a six-color degeneracy system: M Methionine Red (220,0,0) degenerate 1; W Tryptophan Red (220,0,0) degenerate 1; N Asparagine Yellow (255,205,0) degenerate 2; D Aspartic Acid Yellow (255,205,0) degenerate 2; E Glutamic Acid Yellow (255,205,0) degenerate 2; Q Glutamine Yellow (255,205,0) degenerate 2; H Histidine Yellow (255,205,0) degenerate 2; F Phenylalanine Yellow (255,205,0) degenerate 2; Y Tyrosine Yellow (255,205,0) degenerate 2; 5,205,0) degenerates 2; C cysteine ​​yellow (255,205,0) degenerates 2; K lysine yellow (255,205,0) degenerates 2; I isoleucine green (0,180,0) degenerates 3; A alanine blue (0,120,255) degenerates 4; Glycine blue (0,120,255) degenerates 4; P proline blue (0,120,255) degenerates 4; T threonine blue (0,120,255) degenerates 4; V valine blue (0,120,255) degenerates 4; L leucine violet (150,0,200) degenerates 6; R arginine violet (150,0,200) degenerates 6; S serine violet (150,0,200) degenerates 6. (2) Six special symbols in the gene core: / / Start codon white text on red background RGB(200,0,0); ! Stop codon UAA white text on black background RGB(0,0,0); * Stop codon UAG white text on black background RGB(0,0,0); # Stop codon UGA white text on black background RGB(0,0,0); ○ Non-functional intron black text on light gray background RGB(230,230,230); ● Functional intron black text on light gray background RGB(230,230,230).4.2 Non-gene-related symbols (40): (1) 26 B-series functional symbols, with a dark gray background (RGB(50,50,50)) and a blue-green font (RGB(0,180,255)). They correspond to the following in order from B1 to B26: B1 promoter, B2 weak promoter, B3 enhancer, B4 enhancer repressor element, B5 silencer, B6 repressor / repressor element, B7 operator sequence, B8 insulator, B9 transcription start site (TSS), and B10 transcription termination site (TT). S, B11 Origin of Replication, B12 Splice Donor Site, B13 Splice Acceptor Site, B14 Transcription Pause Site, B15 Untranslated Region (UTR), B16 Regulatory Region, B17 Initiation Regulatory Region, B18 Termination Regulatory Region, B19 Methylation Site, B20 Histone Binding Site, B21 Lysine Modification Site, B22 Nucleosome Localization Region, B23 Protein Binding Site (Universal), B24 Open Chromatin Region, B25 Closed Chromatin Region, B26 Other Regulatory Sites. (2) There are 14 non-gene fixed special symbols with a dark gray background (RGB(50,50,50)) and a blue-green font (RGB(0,180,255)). These include: [DNA start cap,] DNA stop cap, 5′ 5′ end / upstream end, 3′ 3′ end / downstream end, >>> forward transcription direction, || terminated transcription direction, ↔ bidirectional transcription, ⊢ left start end, ⊣ right stop end, ☆ alpha satellite / core element, § neutral spacer region, ▲ mtDNA / mitochondrial DNA, ▼ miDNA / micro-interference DNA, ▶ cDNA / complementary DNA. The system supports the expansion of four types of variation representation symbols in the non-gene fixed special symbols: ∇ (representing deletion), Δ (representing insertion), ∞ (representing inversion), and ⥀ (representing translocation), which are used to visually represent structural variation sites in the main trunk display area.

[0009] 5. M-Module Construction and Independent Annotation Area: Two or more components with continuous three-dimensional coordinates are combined to form an M-module with overall biological function. Each M-module must have two attachment points: a linear start position (M_start) and a linear end position (M_end), and simultaneously annotate the corresponding start coordinates CH38_start and end coordinates CH38_end of the GRCh38 reference genome. All attached gene modules are also annotated with double start and double end positions to ensure complete anchoring of both ends during replication, alignment, and localization. An independent annotation area is set on the right side of the main display area, occupying 25% of the visualization interface, and is spatially separated from the main display area. Three preset light-colored backgrounds are used to color the M-modules: the first background color is light cyan RGB (220, 245, 255) for basic gene modules; the second background color is light purple RGB (240, 235, 255) for nested daughter and granddaughter gene modules; and the third background color is light orange RGB (255, 240, 230) for regulatory, initiation, and enhancement-type attached functional modules. The coordinate range of a nested gene module is completely contained within the coordinate range of its parent gene module. The hierarchical relationship is represented by an indentation of 5-10 pixels in the independent annotation area, without drawing any hierarchical connecting lines.

[0010] 6. Three-level interactive display function: Level 1 display: Clicking on the target chromosome displays a list of all Z segments of that chromosome. Each Z segment corresponds to a gene and non-gene combination unit. Human chromosome 1 can display approximately 2800 Z segments, corresponding to approximately 2800 gene units. Level 2 display: Clicking on any Z segment enters the internal view of that segment. Following the biological standard order from left to right and top to bottom, the complete gene region is displayed first, followed by the non-gene region after the gene region is encoded. If the segment length exceeds 10,000 regions, it is automatically arranged in L1, L2, L3 layers downwards, which can be stacked infinitely until all content is displayed. Level 3 display: Clicking on any part or any M module pops up the complete attribute panel and detailed annotation information of that unit, including 3D coordinates, the Z unit to which it belongs, type definition, biological function, degeneracy information, linear start position, linear end position, and GRCh38 reference genome coordinates. Clicking the reverse button can switch between forward and reverse complementary strand display, and all coordinates, module start and end positions are reversed synchronously. Z unit macroscopic addressing: Set up a chromosome shortcut entry, supporting direct input of Z unit identifier for quick location. Entering "Z18" will locate the corresponding Z-unit, automatically redirecting the main display area and simultaneously highlighting the independent annotation area. Single-point part annotation: Clicking on a part in the main display area will invert the local substrate at that part's location to a very light gray, and a pop-up annotation box will display the 3D coordinates, the Z-unit it belongs to, the amino acid name, the degeneracy value, and the corresponding character symbol. Module range annotation: Clicking on an M module in the independent annotation area will thicken the module's border, and a pop-up annotation box will display the coordinate range, the Z-unit it belongs to, the functional description, the sub-module list, and the linear start CH38_start and linear end CH38_end. Coordinate linkage jump: Double-clicking on an M module in the independent annotation area will automatically scroll the main display area and locate the part arrangement range corresponding to that module, highlighting the corresponding part. n symbol penetration: Double-clicking on the n symbol in a Z☆ unit will pop up a new window displaying the base sequence of the repeating fragment corresponding to that symbol. Mutation marker viewing: Mutated parts will have their borders thickened and changed color in the main display area; clicking will display the mutation details. Dual-end comparison: In Hi-C breakdown point dual-end comparison mode, information is displayed synchronously on both screens, allowing for real-time comparison of differences.

[0011] 7. Dynamic Labeling of Sample Variations: Compatible with mainstream variation data formats such as VCF and BAM; automatic matching of variation sites with Z-units and component coordinates, achieving a matching efficiency of ≥100,000 sites / second under a 3.0GHz quad-core CPU and 16GB memory environment; variation units are marked with a bold border and color change in the main display area; telomere variations are separately labeled as "telomere variation"; repetitive sequence variations are marked with a dark red RGB (220,80,80) fill and a bold border; clicking on a variation component allows you to view the variation base sequence and its corresponding Z-unit information.

[0012] 8. Tumor Hi-C Breakdown Point Dual-End Comparison: Supports dual-screen or dual-machine independent operation modes; Input Z-unit identifier and component coordinate range corresponding to breakdown point A on end A; Input Z-unit identifier and component coordinate range corresponding to breakdown point B on end B; Simultaneously display Z-unit information, component coordinate range, functional attributes, and base changes on both ends; Real-time comparison of positional differences, variant types, and functional impacts, generating a comparison report.

[0013] 9. Viewing the reverse complementary chain: The system automatically generates the reverse complementary chain based on the input base sequence; assigns corresponding Z-units, part coordinates, and M-module annotations to the reverse complementary chain; supports bidirectional switching between viewing the forward and reverse chains; the reverse complementary chain adopts the same Z-series closed-loop coding rules as the forward chain, and independently assigns Z-unit numbers.

[0014] The advantages of this invention are as follows: It achieves the following significant advancements: Standardized gene numbering: Existing technologies often use multiple aliases for the same gene, leading to difficulties in data exchange. This invention uses a unique Z-lineage numbering system to completely eliminate naming confusion. Symbolic representation of functional information: Existing technologies rely on text annotation, requiring extensive text reading. This invention establishes a 65-character symbol system to directly encode information into visual symbols, improving information retrieval efficiency by over 600%. Complete genome-wide coverage: Through Z0-ZN closed-loop coding, it incorporates head non-genes, gene regions, non-gene regions, telomeres, and repetitive sequences into a unified coding system. Modular annotation and automatic alignment: Existing technologies use curved connections, resulting in a "spaghetti effect." This invention uses independent annotation areas with indentation to achieve automatic machine alignment; double-clicking modules... Automatic navigation is possible, improving operational efficiency by tens of times; a single view without scaling, unlike existing browsers which require multiple levels of zooming and switching views, this invention uses Z-unit macro-addressing + single-point interaction of components, allowing all operations to be completed within a single view; perfect adaptation to natural arrangements, with zero-length non-gene regions elegantly solving the problem of continuous gene arrangement; a dedicated solution for repetitive sequences, with Z☆ units + G0☆ + n1~nx segments providing unified encoding and interaction for complex repetitive sequences; universal adaptation across all species, with a single encoding rule adapting to humans, animals, plants, and microorganisms; efficient comparison of breakdown points, reducing the efficiency of dual-end synchronous comparison analysis from hours to seconds; dual attachment point annotation for modules, with each M module annotated with the start and end positions and GRCh38 reference genome coordinates, achieving accurate replication, accurate alignment, and accurate positioning. Attached Figure Description

[0015] Figure 1 This is a schematic diagram of the Z-series closed-loop coding system.

[0016] Figure 2 This is a schematic diagram of the three-dimensional layer location coordinates and the main display area.

[0017] Figure 3 The full representation intent of the 65-character mapping rule library.

[0018] Figure 4 This is a diagram illustrating the external annotations and hierarchical indentation of module M.

[0019] Figure 5 This is a schematic diagram of a multi-level interactive operation process.

[0020] Figure 6 This is a diagram comparing it with existing gene browsers. Detailed Implementation

[0021] Example 1

[0022] Visualization of the BRAF gene on human chromosome 7: This embodiment uses the BRAF gene on human chromosome 7 as an example to verify the core functions of the gene browser of this invention. Implementation environment: Intel i7-10700 CPU, 16GB RAM, Windows 11 operating system, Chrome browser.

[0023] Implementation steps:

[0024] 1. Load Z-lineage skeletal data: Start the browser and load the GRCh38 standard chromosome 7 sequence and Z-lineage coding data. This chromosome contains genes G1-G50, non-gene regions F1-F51, Z0=F1, Z1-Z50, and the terminal F51 is a telomere. There is a region of continuous gene arrangement between genes G23 and G24, and a zero-length non-gene region Z23.5[0] is automatically generated. Z36☆α satellite units are set in the centromere region, and the internal segments are n1-n18.

[0025] 2. Z-cell macro addressing: Enter "Z18" (the Z-cell where the BRAF gene is located) in the browser address bar, and the main display area will automatically jump to the part layout area corresponding to Z18. The jump takes 0.3 seconds.

[0026] 3. View 3D coordinates and part annotations: The parts inside Z18 are arranged in the main display area in the order L1X2Y100-L1X2Y850. Observation reveals: Amino acid parts are displayed with six-color text: M (red), W (red), N (yellow), D (yellow), E (yellow), Q (yellow), H (yellow), F (yellow), Y (yellow), C (yellow), K (yellow), I (green), A (blue), G (blue), P (blue), T (blue), V (blue), L (purple), R (purple), and S (purple); parts in non-coded areas are displayed with cyan-blue B-series symbols; the start codon position is displayed as / / in white on a red background; the stop codon position is displayed as !, *, # in white on a black background; contained sub-regions are displayed as ○ or ● in black on a light gray background; the coordinate scale below clearly marks the LXY coordinates of each part.

[0027] 4. View M module annotations: Within the independent annotation area, Z18 displays multiple M modules: the gene basic module M-BRAF has a first background color of light cyan RGB (220, 245, 255), with coordinates L1X2Y100-L1X2Y750; the nested exon modules M-EX1, M-EX2, and M-EX3 have a second background color of light purple RGB (240, 235, 255), arranged with an indentation of 8 pixels; the promoter regulation module M-Prom has a third background color of light orange RGB (255, 240, 230), with coordinates L1X2Y50-L1X2Y120; there are no curved lines connecting all modules, and the hierarchical relationship is only reflected by indentation; each M module is annotated with a linear start CH38_start and a linear end CH38_end.

[0028] 5. Single-point interaction of parts: Clicking on a yellow N symbol (asparagine) in the main display area will reverse the background color of the part and pop up a label box to display the three-dimensional coordinates L1X2Y356, the Z unit Z18, the amino acid name Asparagine, the degeneracy value of 2 (yellow), and the corresponding character symbol N. The response time is 0.1 seconds.

[0029] 6. Module Interaction: Clicking the M-BRAF module within the independent annotation area will thicken the module border and pop up an annotation box displaying the coordinate range L1X2Y100-L1X2Y750, the Z unit Z18, the gene name BRAF, the functional description B-Raf proto-oncogene serine / threonine protein kinase, the sub-modules M-EX1, M-EX2, M-EX3, M-EX4, the linear start CH38_start, and the linear termination CH38_end. The response time is 0.15 seconds.

[0030] 7. Coordinate linkage jump: Double-click the M-EX1 external display submodule in the independent annotation area, and the main display area will automatically scroll and position to the L1X2Y100-L1X2Y250 area. The corresponding part will be highlighted. The jump process is smooth and flicker-free.

[0031] 8. Special region verification: Click on the zero-length non-gene region Z23.5[0], there is no corresponding part in the main trunk display area, and the corresponding position in the independent labeling area displays a ∅ placeholder, labeled "zero-length non-gene region"; Click on Z36☆α satellite unit, the independent labeling area displays Z36☆ module with a dark red background, double-click the n5 symbol to pop up the window to display the corresponding α satellite base sequence CTTCTGTGTTGTTCTAGGGGTGTGTGTGTGT; Click on the end Z50 containing F51 telomere, the main trunk display area displays telomere parts as ☆ symbols (orange-yellow), click to display telomere repeat sequences.

[0032] 9. Performance test: Under the conditions of 3.0GHz quad-core CPU and 16GB memory, loading all 850 parts of Z18 takes 0.8 seconds, single click interaction response time is ≤0.15 seconds, double click jump response time is ≤0.3 seconds, which meets the real-time interaction requirements.

[0033] Example 2

[0034] Tumor Sample KRAS Gene Mutation Analysis and Hi-C Pairwise Alignment: This embodiment uses the KRAS gene G12C mutation analysis and Hi-C breakdown point alignment of lung cancer samples as an example to verify the application of this invention in tumor genome analysis. Sample Data: Sample 1 is a lung cancer tissue sample with a KRAS gene G12C mutation; Sample 2 corresponds to a normal tissue sample. Hi-C detection revealed two breakdown points: Breakdown point A is located in the KRAS gene region of chromosome 12 (Z42-L3X1Y890-L3X1Y900), and breakdown point B is located in the telomere region near the end of chromosome 12 (Z98-L5X2Y1200-L5X2Y1250). Implementation Environment: Dual-screen workstation, Intel i9-10900K CPU, 32GB RAM, Ubuntu 20.04 operating system.

[0035] Implementation steps:

[0036] 1. Data Import and Matching: Importing a 2.3GB VCF mutation data file from a tumor sample, the system automatically matched the mutation sites with Z-units and part coordinates. The matching process took 1.8 seconds, with a total of 235,000 matched sites, resulting in a matching efficiency of 132,000 sites / second.

[0037] 2. Z-unit localization: Input the Z-unit where the KRAS gene “Z42” is located on screen A, and jump to the L3X1Y1-L3X1Y1200 region in the main trunk area; input the Z-unit where the telomere adjacent region “Z98” is located on screen B, and jump to the L5X2Y1000-L5X2Y1500 region in the main trunk area.

[0038] 3. Mutation Marker Viewing: In the Z42 backbone display area of ​​Screen A, the amino acid component at position L3X1Y892, originally blue (Glycine), is now marked with a bold red border as a mutation. Clicking on this component brings up a details box displaying the 3D coordinates L3X1Y892, the Z-unit Z42, the gene name KRAS, the mutation type (missense mutation), the base change (GGT→TGT), the amino acid change (Gly→Cys (G12C), and the mutation frequency (38.5%). In the independent annotation area, the M-KRAS module is marked with a bold border indicating "Mutation region: Exon 2, Codon 12". In the Z98 backbone display area of ​​Screen B, telomere components are displayed as orange-yellow ☆ symbols. Multiple ☆ symbols in the L5X2Y1220-L5X2Y1240 region are marked with bold borders as telomere amplification. Clicking on the mutated part will bring up a details box displaying the associated Z unit Z98, the mutated type telomere repeat sequence amplification, the amplification fold of approximately 2.3 times, the normal telomere length of 3.2kb, and the detected telomere length of 7.4kb. 4. Hi-C breakdown point end-to-end alignment: Enter “Z42-L3X1Y890-L3X1Y900” in the breakdown point input box on screen A, and enter “Z98-L5X2Y1200-L5X2Y1250” in the breakdown point input box on screen B. Click the "Dual-End Alignment" button, and the system will automatically generate the alignment results: A-terminal position 12p12.1 KRAS exon 2, mutation type: point mutation G12C+ local break, base change GGT→TGT, function affecting sustained activation of KRAS protein; B-terminal position 12q telomere region, mutation type: telomere repeat sequence amplification, base change (TTAGGG)n repeat number increase, function affecting abnormal telomere function; spatial correlation: no direct physical correlation, possibly independent events. The alignment report takes 2.1 seconds to generate and can be exported as PDF or Excel format.

[0039] Example 3

[0040] Full-species compatibility verification: This embodiment verifies the full-species universality of the invention by selecting human chromosome 21, Arabidopsis chromosome 5, and Escherichia coli K12 genomes for testing. Implementation environment: Single-screen multi-tab mode, Intel i7-10700 CPU, 16GB RAM.

[0041] Implementation steps:

[0042] 1. Human Chromosome 21 Verification: Load the GRCh38 sequence and Z-lineage coding data of human chromosome 21, including genes G1-G300, non-genes F1-F301, Z0=F1, Z1-Z300, and the terminal F301 telomere. Set the Z120☆α satellite unit segment n1-n25 in the centromere region. Input "Z120☆", and the trunk region jumps to the α satellite region. The Z120☆ module in the independently labeled area is dark red RGB(180,80,80). The secondary coordinate expansion displays the symbols n1-n25. Double-clicking n8 pops up a window to display the α satellite base sequence CTTCTGTGTTGTTCTAGGGGTGTGTGTGTGT, verifying that the α satellite repetitive sequence can be displayed and penetrated normally.

[0043] 2. Arabidopsis Chromosome 5 Validation: Load the TAIR10 sequence and Z-line coding data of Arabidopsis chromosome 5, including genes G1-G180, non-genes F1-F181, Z0=F1, Z1-Z180, and the terminal F181 telomere. Set the centromere region to the Z85☆ centromere repeat unit segment n1-n12. Inputting "Z85☆" will jump to the centromere region in the main area. The Z85☆ module in the independently labeled area will be dark red. The secondary coordinate expansion will display the symbols n1-n12. Double-clicking n3 will pop up a window displaying the centromere repeat unit CAAAGAGCTCTCTCAAAGAGCTCTC, verifying that the plant repeat sequence can be displayed correctly.

[0044] 3. *E. coli* K12 Genome Verification: The *E. coli* K12 genome sequence U00096.3 and Z-series coding data were loaded. The genome was linearized into a circular format. Genes G1-G400, non-genes F1-F401, Z0=F1, Z1-Z400, and the terminal F401 were designated as end points. No repetitive sequences or Z☆ units were present. Browsing the Z1-Z400 region, the six-color amino acid coding was displayed correctly, and the B-series symbols in the non-coding region were displayed correctly. Gene modules within the independently labeled region were categorized by function, with metabolic genes colored light blue and transport genes light purple. The terminal F401 non-gene region was marked with an end marker, verifying that the prokaryote can adapt normally.

[0045] 4. Cross-species homologous gene comparison: Simultaneously open human Z42 (KRAS), mouse corresponding homologous Z35, and rat corresponding homologous Z38, displaying three screens side by side. The main display area scrolls synchronously to the homologous region. Homologous modules in the independent annotation area use the same background color to facilitate visual comparison. The system automatically marks the conserved region with thickened borders and the variant region with red markers. The matching degree of the conserved region reaches 92%.

[0046] Verification conclusion: All three species fully support all functions such as Z-series addressing, three-dimensional coordinate positioning, six-color annotation of parts, external annotation of M modules, n-symbol penetration, mutation marking, and interactive jump. The core coding logic is completely unified, with only the total Z-series sequence number N adjusted according to the genome length, proving that the present invention has universal adaptability across all species.

[0047] Figure 1 This invention demonstrates the construction process of the core underlying architecture of the invention—the Z-series closed-loop coding system, including gene-independent coding, non-gene-independent coding, gene-non-gene interleaving rules, Z-unit packaging rules, and special treatments for zero-length non-gene regions, Z☆ repetitive sequence units, and circular chromosomes.

[0048] Explanation of reference numerals in the attached figures:

[0049] 101: Traditional base line linear sequence (original arrangement of chromosome 5'→3');

[0050] 102: Genes independently encode G1, G2, G3...GN (represented by light blue blocks);

[0051] 103: Non-gene-independent coding F1, F2, F3...FN+1 (represented by light gray blocks);

[0052] 104: Schematic diagram of gene-nongene crossover rules (F1-G1-F2-G2-F3……GN-FN+1).

[0053] 105: Packing results for Z-units: Z0=F1, Z1=G1+F2, Z2=G2+F3……ZN=GN+FN+1;

[0054] 106: Example of a zero-length non-gene region (Z23.5[0]), located between genes G23 and G24, is indicated by a dashed box with “0” inside;

[0055] 107: Z☆ is a dedicated unit for repeating sequences, internally marked with G0☆ and segments n1, n2, n3...nx, indicated by dark red blocks;

[0056] 108: FN+1 in the non-genetic region of the terminal telomere, marked with the telomere termination marker ☆;

[0057] 109: Example of circular chromosome coding (bacteria / mitochondria), showing a closed loop truncation method with the beginning and end connected, starting from any position as F1, and returning to the starting point after one loop.

[0058] Figure 2The system demonstrates the construction of a three-dimensional layered coordinate system (LXY) and the linear arrangement of parts within the main display area, showcasing a clean interface without curves or tracks. Each layer contains 100 zones (X00-X99), and each zone contains 100 positions (Y00-Y99), for a total of 10,000 zones. Once full, it automatically moves to the next layer.

[0059] Explanation of reference numerals in the attached figures:

[0060] 201: Layer identifiers (L1, L2, L3), vertical dimension;

[0061] 202: Zone identifiers (X00, X01, X02...X99), horizontally southward, 100 zones per floor;

[0062] 203: Bit identifier (Y00, Y01, Y02...Y99), horizontally eastward, 100 bits per zone;

[0063] 204: Amino acid component, displayed as six-color text:

[0064] 204a: Red text M, W (simplified 1);

[0065] 204b: Yellow lettering N, D, E, Q, H, F, Y, C, K (abbreviated 2);

[0066] 204c: Green Text I (Simplified 3);

[0067] 204d: Blue lettering A, G, P, T, V (abbreviated 4);

[0068] 204e: Purple lettering L, R, S (simplified to 6);

[0069] 205: Special symbols in the gene core:

[0070] 205a: / / Start codon (white text on red background);

[0071] 205b: !stop codon UAA (white text on a black background);

[0072] 205c: *stop codon UAG (white text on a black background);

[0073] 205d: #stop codon UGA (white text on a black background);

[0074] 205e: ○ Non-functional intron (black text on a light gray background);

[0075] 205f: ● Contains functional introns (black text on a light gray background);

[0076] 206: Parts in the non-coded area are displayed as blue-green B-series symbols (B1, B5, B12, etc.).

[0077] 207: Structural variation extension symbols: ∇ (missing), Δ (insertion), ∞ (inversion), ⥀ (transposition);

[0078] 208: Coordinate scale, located below the main display area, marking the complete LXY coordinates (e.g., L1X02Y56).

[0079] 209: Base of the main display area (light gray RGB 240,240,240);

[0080] 210: Cross-level schematic line, showing that L1 will automatically enter L2 after reaching 10,000 locations.

[0081] Figure 3 The mapping rules for 65 standardized characters are presented in a complete table format, divided into two categories: gene-related and non-gene-related, and color coding rules and structural variation extension symbols are marked.

[0082] Explanation of reference numerals in the attached figures:

[0083] 301: Table 1 title "Gene-related symbols (25)";

[0084] 302: Amino acid symbol region (19), arranged in six-color degenerate grouping:

[0085] 302a: Red Group (M, W);

[0086] 302b: Yellow group (N, D, E, Q, H, F, Y, C, K);

[0087] 302c: Green Group (I);

[0088] 302d: Blue group (A, G, P, T, V);

[0089] 302e: Purple Group (L, R, S);

[0090] 303: Special symbol regions in the gene core (6 in total):

[0091] 303a: / / Start codon (white text on red background);

[0092] 303b: !stop codon UAA (white text on a black background);

[0093] 303c: *stop codon UAG (white text on a black background);

[0094] 303d: #stop codon UGA (white text on a black background);

[0095] 303e: ○ Non-functional intron (black text on a light gray background);

[0096] 303f: ● Contains functional introns (black text on light gray background);

[0097] 304: Table 2 title "Non-gene related symbols (40)";

[0098] 305: B-series function symbol area (26 symbols), arranged in the order B1-B26:

[0099] 305a: Left columns B1-B13;

[0100] 305b: Columns to the right of B14-B26;

[0101] Each line is labeled with its corresponding function (e.g., B1 promoter, B2 weak promoter, etc.).

[0102] 306: Non-gene-fixed special symbol regions (14):

[0103]

[0104] 307: Structural variation extended symbol region (4):

[0105] ∇ (delete), Δ (insert), ∞ (invert), ⥀ (transfer);

[0106] 308: Examples of segmentation symbols for repeating sequences (n1, n2, n3...);

[0107] 309: Zero-length non-genetic region markers ([0] and ∅);

[0108] 310: Color legend: Red RGB(220,0,0), Yellow RGB(255,205,0), Green RGB(0,180,0), Blue RGB(0,120,255), Purple RGB(150,0,200), Cyan RGB(0,180,255), Dark RGB(50,50,50), Light Gray RGB(240,240,240).

[0109] Figure 4 The text demonstrates the three background colors, nested indentation layout, and dual attachment point annotations (M_start / CH38_start) of the M module within the independent annotation area, contrasting sharply with the existing browser's arc connection method.

[0110] Explanation of reference numerals in the attached figures:

[0111] 401: Main display area, showing text on continuously arranged parts;

[0112] 402: Independent labeling area, located on the right side of the main display area, accounting for 25% of the width;

[0113] 403: Genetic Basis M Module (First background color: light cyan RGB 220,245,255):

[0114] 403a: Module name identifier "M-BRAF";

[0115] 403b: Linear start position “M_start: L1X2Y100”;

[0116] 403c: Linear termination position “M_end: L1X2Y750”;

[0117] 403d: GRCh38 reference coordinates "CH38_start: chr7:140,000,000";

[0118] 403e: GRCh38 reference coordinates "CH38_end: chr7:140,200,000";

[0119] 404: Nested sub-gene M module (second background light purple RGB 240,235,255):

[0120] 404a: Module name identifier "M-EX1", indented 8 pixels;

[0121] 404b: Module name identifier "M-EX2", indented 8 pixels;

[0122] All are marked with dual attachment points;

[0123] 405: Sun Gene M Module (second background light purple, further indented):

[0124] 405a: Module name identifier "M-EX2a", indented 16 pixels;

[0125] Mark the dual attachment points;

[0126] 406: Attachment function M module (third background color light orange RGB 255,240,230):

[0127] 406a: Module name identifier "M-Prom";

[0128] 406b: Linear start "M_start: L1X2Y50";

[0129] 406c: Linear termination "M_end: L1X2Y120";

[0130] 407: Comparison of existing browser curved link diagrams:

[0131] 407a: Multiple curved lines intertwine to form "spaghetti";

[0132] 407b: Problem points are marked with a red cross (✗);

[0133] 408: Dashed line indicating indentation (for illustration purposes only, not an actual drawn line).

[0134] Figure 5 The three-level interactive display function of the browser of this invention is shown in the form of a flowchart. All operations are completed within a single view without the need for zooming or switching tracks.

[0135] Explanation of reference numerals in the attached figures:

[0136] 501: Level 1 Display – List of Chromosome Z Fragments:

[0137] 501a: Chromosome shortcut (1-22, X, Y);

[0138] 501b: Z-fragment list window, displaying Z0, Z1, Z2...Z50;

[0139] 501c: Each Z segment is labeled with a gene name (e.g., Z18 BRAF);

[0140] 502: Secondary Display - Internal View of Segment Z:

[0141] 502a: Click Z18 to enter, and arrange multiple layers according to L1, L2, and L3;

[0142] 502b: Genetic regions first, non-genetic regions second;

[0143] 502c: Cross-level indication line; automatically moves to L2 after L1 is full.

[0144] 503: Level 3 Display – Part / Module Attribute Labeling:

[0145] 503a: Clicking on a part will bring up a property box, displaying its 3D coordinates, Z-element, amino acid name, degeneracy value, and character symbol;

[0146] 503b: Clicking on module M will bring up a property box, displaying the coordinate range, the corresponding Z-cell, the function description, the list of submodules, the linear start CH38_start, and the linear end CH38_end;

[0147] 504: Z-cell macro addressing input box, currently input "Z18";

[0148] 505: Single-point annotation effect for parts:

[0149] 505a: The yellow "N" symbol is displayed normally before clicking;

[0150] 505b: Clicking this part will invert the background color of that area;

[0151] 505c: Pop-up annotation box;

[0152] 506: Module range labeling effect:

[0153] 506a: The M-BRAF module displays normally before clicking;

[0154] 506b: The module border becomes thicker after clicking;

[0155] 506c: Pop-up annotation box;

[0156] 507: Coordinate-linked jump effect:

[0157] 507a: Double-click the M-EX1 module;

[0158] 507b: The main display area automatically scrolls and positions itself to the corresponding area;

[0159] 507c: The corresponding part is highlighted;

[0160] 508: The 'n' symbol penetration effect:

[0161] 508a: Double-click the n5 symbol within cell Z36☆;

[0162] 508b: A new window pops up displaying the corresponding base sequence;

[0163] 509: Reverse direction button; click to switch between forward and reverse chains.

[0164] 510: Operation flow arrows (1→2→3);

[0165] 511: The bottom label reads "Three-level interaction, single view, no scaling required".

[0166] Figure 6 By using a left-right comparison, the essential differences between the browser of this invention and existing mainstream browsers (UCSC / IGV) in terms of interface style and underlying architecture are intuitively demonstrated.

[0167] Explanation of reference numerals in the attached figures:

[0168] 601: Existing browser interface illustration (left side);

[0169] 602: Existing browser track overlay area:

[0170] 602a: Gene Prediction Orbit

[0171] 602b: Transcription track

[0172] 602c: Conservative orbital

[0173] 602d: Mutant orbital

[0174] Multiple parallel tracks, distinguished by different colors

[0175] The red cross indicates "chaotic track layout and low information density".

[0176] 603: Existing browser curved connection area:

[0177] 603a: Multiple curved lines intertwine and interweave

[0178] 603b: Marked with a red cross: "Spaghetti Effect"

[0179] 604: Existing browser zoom control bar:

[0180] 604a: Chromosome-level view

[0181] 604b: Gene-level view

[0182] 604c: Base-level view

[0183] Multiple zoom levels are required; indicated by a red cross.

[0184] 605: Schematic diagram of the browser interface of this invention (right side)

[0185] 606: Main display area of ​​this invention:

[0186] 606a: Clean layout of component text

[0187] 606b: Coordinate scale

[0188] No tracks, no curves

[0189] A green checkmark indicates "clean interface, no curved lines".

[0190] 607: Independent annotation area for this invention:

[0191] 607a: M Module Indented Display

[0192] 607b: The dual attachment points are clearly marked.

[0193] The green checkmark indicates "modular, indented layout".

[0194] 608: Schematic diagram of the three-level interaction of this invention:

[0195] 608a: Level 1 Z-list

[0196] 608b: Secondary internal view

[0197] 608c: Level 3 Attribute Annotation

[0198] The green checkmark indicates "Three-level interaction, no zoom required".

[0199] 609: Comparison and Summary Table:

[0200] 609a: Existing technology: linear track + arc + multi-level scaling

[0201] 609b: This invention: Z-series encoding + 3D coordinates + independent annotation + three-level interaction

[0202] Tips for drawing attached diagrams:

[0203] 1. Color specifications (strictly according to RGB values):

[0204] Six colors of amino acids:

[0205] Red RGB(220,0,0);

[0206] Yellow RGB(255,205,0);

[0207] Green RGB(0,180,0);

[0208] Blue RGB(0,120,255);

[0209] Purple RGB(150,0,200);

[0210] Non-encoded area: Cyan blue RGB(0,180,255);

[0211] Module background color:

[0212] First base color (light cyan) RGB(220,245,255);

[0213] Second base color (light purple) RGB(240,235,255);

[0214] Third base color (light orange) RGB(255,240,230);

[0215] Base color:

[0216] The main area is light gray RGB (240,240,240);

[0217] The non-encoded area is dark gray RGB(50,50,50);

[0218] Repeating sequence deep red RGB(180,80,80);

[0219] 2. Symbol Standards:

[0220] Amino acid symbols: M, W, N, D, E, Q, H, F, Y, C, K, I, A, G, P, T, V, L, R, S;

[0221] Gene symbols: / / , !, *, #, ○, ●;

[0222] Non-genetic B series: B1-B26;

[0223] Non-genetic fixed symbols:

[0224] Structural variation symbols: ∇, Δ, ∞, ⥀;

[0225] Repeating sequence segmentation: n1, n2, n3...;

[0226] Zero-length identifiers: [0], ∅.

[0227] 3. Emphasis through contrast:

[0228] Figure 1 , Figure 4 , Figure 6 Be sure to include elements comparing it with existing technologies;

[0229] Mark the problems with the existing technology with a red cross;

[0230] Use a green checkmark to mark the innovative aspects of this invention;

[0231] Figure 6 The left-right comparison is the most crucial, and the essential differences must be clearly shown.

[0232] 4. Text annotation:

[0233] All figure labels are marked with small numbers within the figure;

[0234] The accompanying illustrations include a label correspondence table.

[0235] Key innovations are accompanied by brief text descriptions, such as "no curves," "no tracks," "no scaling required," "machine alignment," "dual attachment points," and "three-level interaction."

[0236] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made within the scope of the claims of the present invention should be included in the scope of the present invention.

Claims

1. A method for fine visualization and annotation of gene sequences based on Z-lineage closed-loop coding, characterized in that, Includes the following steps: S1. Construct a Z-series closed-loop coding system, specifically including: numbering all genes on the target chromosome sequentially as G1, G2, G3...GN in 5'→3' order, where N is the total number of genes on the chromosome; numbering all non-gene regions on the target chromosome sequentially as F1, F2, F3...FN+1, where F1 is the head non-gene region and FN+1 is the terminal telomere non-gene region; the entire chromosome is forced to follow the core rule of "starting with F1, then alternating in the order of G1-F2, G2-F3, G3-F4...GN-FN+1, and ending with FN+1", forming a whole-chromosome coding closed loop; for circular chromosomes, a closed-loop truncation method with the beginning and end joined is adopted, with any position as F1 to complete one cycle of closed loop, ensuring continuous and conflict-free coding logic; defining the head non-gene F1 as a separate starting unit Z0; and assigning each "gene + its..." to the corresponding gene sequence. The "post-joining non-gene region" combination is defined as an independent functional unit, that is, G1-F2 is packaged as Z1, G2-F3 is packaged as Z2...GN-FN+1 is packaged as ZN, forming a continuous Z-series sequence of Z0, Z1, Z2...ZN; for scenarios where two or more genes are adjacent to each other without actual base spacing, a virtual zero-length non-gene region is added between adjacent genes, assigned a unique number and marked with "0". This region has no actual bases and no functional elements, and is only used to maintain the gene-non-gene alternating arrangement framework; for special repetitive regions such as α-satellite and centromere repeat sequences with a length exceeding 500bp, a dedicated Z☆ unit is set, and its gene unit is marked with 0 to indicate G0☆. The internal repetitive sequences are segmented into segments of 500-1000bp and numbered as n1, n2...nx. Double-clicking the n symbol will reveal the corresponding base fragment; S2. A three-dimensional layer-region coordinate system is constructed to replace the existing browser's arc connection method. Specifically, this includes: defining individual amino acid units and non-coding functional units within a Z-unit as independent parts; assigning a unique layer-region-position three-dimensional coordinate system to each part, where layer (L) is the vertical dimension, region (X) is the horizontal southward dimension, and position (Y) is the horizontal eastward dimension; the X-axis represents regions, with each layer containing 100 regions, numbered 00-99; the Y-axis represents positions, with each region containing 100 positions, numbered 00-99; 100 regions × 100 positions = 10,000 regions / positions, corresponding to 10,000 codons or symbols; every 10,000 regions / positions automatically move to the next layer, numbered L1, L2, L3… and can be infinitely stacked until all content is encoded; each Z-unit independently adopts the layer-region-position coordinate system, with layer and region numbers not reused across Z-units, ensuring unique addressing and conflict-free arrangement of the three-dimensional coordinates; parts are linearly arranged in the main display area in the form of text symbols according to coordinate order, with each part bound to its respective Z-unit information; S3.A standardized character mapping rule library of 65 symbols was established, including 25 gene-related symbols and 40 non-gene-related symbols. The specific rules are as follows: The 25 gene-related symbols consist of 19 amino acid symbols and 6 gene core special symbols; the 19 amino acid symbols are colored according to a six-color degeneracy system, with each color uniquely corresponding to its degeneracy number; the 6 gene core special symbols include the start codon / / , stop codons !, *, #, non-functional intron ○, and functional intron ●, using fixed color schemes; the 40 non-gene-related symbols consist of 26 B-series functional symbols and 14 non-gene fixed special symbols; the 26 B-series functional symbols use a uniform dark gray background and cyan-blue font color; the 14 non-gene fixed special symbols use a uniform dark gray background and cyan-blue font color; S4. The labeling method for the main display area includes: amino acid component text is colored using a six-color degeneracy system, with each color uniquely corresponding to a degeneracy number; non-coding region component text is labeled with a bold cyan-blue font; the main display area only displays colored text and coordinate scales, without any orbital color blocks, arc lines, or functional graphic overlays; S5. Constructing M modules specifically includes: combining two or more components with continuous three-dimensional coordinates to form an M module with overall biological function; each M module must be labeled with two attachment points, namely the linear start position M_start and the linear end position M_end, and simultaneously label the start coordinate CH38_start and end coordinate CH38_end corresponding to the GRCh38 reference genome; the attached gene module is also labeled with double start and double end positions; an independent labeling area is set up to be spatially separated from the main display area, with the independent labeling area located to the right of the main display area, occupying 25% of the width; the labeling content of the M module is arranged within the independent labeling area, and the coordinate intervals of the M module are bound one-to-one with the three-dimensional layer location coordinate intervals of the components in the main display area, while the M module is also associated with the corresponding Z unit; S6. The M-module differentiation annotation specifically includes: using three fixed light-colored backgrounds to distinguish M-module types, with the basic gene module using the first background color, nested daughter and granddaughter gene modules using the second background color, and regulatory, initiating, and enhancing attachment function modules using the third background color; the visual contrast of the three background colors is no less than 30%, and they do not overlap with the six amino acid colors; the coordinate range of nested gene modules is completely contained within the coordinate range of their parent gene modules, arranged in an independent annotation area with an indentation of 5-10 pixels, and no hierarchical connection lines are drawn; S7.The system implements a three-level interactive display function, specifically including: Level 1 display: Clicking on a chromosome displays a list of all Z-fragments, with each Z corresponding to a gene and non-gene combination unit; Level 2 display: Clicking on any Z-fragment enters the fragment's interior, displaying the gene region sequentially from left to right and top to bottom, followed by the non-gene region. Long fragments are automatically arranged in L1, L2, and L3 layers; Level 3 display: Clicking on any part or M-module displays the unit's complete attributes and detailed annotation information, including coordinates, type, function, reference genome location, start and end sites; Clicking on a part in the main display area triggers single-point fine annotation of that part, displaying its 3D coordinates, the Z-unit it belongs to, biological attributes, degeneracy value details, and corresponding character symbols; Clicking on an M-module in the independent annotation area triggers interval fine annotation of that module, displaying the module's coordinate range, the Z-unit it belongs to, biological function, hierarchical relationship, and linear initiation CH38_star. t is the linear terminator CH38_end; double-clicking the M module enables coordinate-linked jumps in the backbone display area, directly locating the corresponding component arrangement interval; double-clicking the n symbol within the Z☆ unit displays the base sequence of the corresponding repeating fragment; a chromosome shortcut entry is set, supporting direct input of the Z unit identifier for rapid location, after which the backbone display area automatically jumps to the component arrangement interval corresponding to that Z unit, and the corresponding M module is synchronously highlighted in the independent annotation area; when the number of Z units exceeds 10,000, the backbone display area adopts a multi-layer stacked mode; the backbone display area supports the expansion of non-gene fixed special symbols, including ∇ for deletion (del), Δ for insertion (ins), ∞ for inversion (inv), and ⥀ for translocation (trans), which can be used to characterize structural variation sites; S8. Supports module direction reversal function, clicking the reverse button switches between the forward and reverse complementary strand display of gene and non-gene regions, and all coordinates, module start and end positions are synchronously reversed.

2. The method according to claim 1, characterized in that, The color definitions of the six-color degeneracy system are as follows: Degeneracy number 1: Red RGB (220,0,0), corresponding to amino acids M and W; Degeneracy number 2: Yellow RGB (255,205,0), corresponding to amino acids N, D, E, Q, H, F, Y, C, K; Degeneracy number 3: Green RGB (0,180,0), corresponding to amino acid I; Degeneracy number 4: Blue RGB (0,120,255), corresponding to amino acids A, G, P, T, V; Degeneracy number 6: Purple RGB (150,0,200), corresponding to amino acids L, R, S; The background color of the amino acid text is uniformly light gray RGB (240,240,240).

3. The method according to claim 1, characterized in that, The six core special symbols for the genes are as follows: / / Start codon: white text RGB(255,255,255), red background RGB(200,0,0); ! Stop codon UAA: white text RGB(255,255,255), black background RGB(0,0,0); * Stop codon UAG: white text RGB(255,255,255), black background RGB(0,0,0); # Stop codon UGA: white text RGB(255,255,255), black background RGB(0,0,0); ○ Non-functional intron: black text RGB(0,0,0), light gray background RGB(230,230,230); ● Functional intron: black text RGB(0,0,0), light gray background RGB(230,230,230).

4. The method according to claim 1, characterized in that, The 26 B-series functional symbols have a uniform dark gray RGB (50,50,50) background and a uniform cyan RGB (0,180,255) font color. They correspond to the following functions in order from B1 to B26: B1 promoter, B2 weak promoter, B3 enhancer, B4 enhancer repressor element, B5 silencer, B6 repressor / repressor element, B7 operator sequence, B8 insulator, B9 transcription start site (TSS), B10 transcription termination site (TTS), B11 origin of replication, B12 splice donor site, B13 splice acceptor site, B14 transcription pause site, B15 untranslated region (UTR), B16 regulatory region, B17 initiation regulatory region, B18 termination regulatory region, B19 methylation site, B20 histone binding site, B21 lysine modification site, B22 nucleosome localization region, B23 protein binding site (general), B24 open chromatin region, B25 closed chromatin region, and B26 other regulatory sites.

5. The method according to claim 1, characterized in that, The 14 non-gene-fixed special symbols have a uniform dark gray RGB (50,50,50) background color and a uniform cyan RGB (0,180,255) font color. Specifically, they include: [DNA start cap,] DNA stop cap, 5′ 5′ end / upstream end, 3′ 3′ end / downstream end, >>> forward transcription direction, || stop transcription direction, ↔ bidirectional transcription, ⊢ left start end, ⊣ right stop end, ☆ alpha satellite / core element, § neutral spacer region, ▲ mtDNA / mitochondrial DNA, ▼ miDNA / micro-interference DNA, ▶ cDNA / complementary DNA.

6. The method according to claim 1, characterized in that, The background colors of the three M modules are as follows: First background color (light cyan): RGB(220,245,255), used for the gene basic module; Second background color (light purple): RGB(240,235,255), used for nested daughter gene and granddaughter gene modules; Third background color (light orange): RGB(255,240,230), used for regulation, activation, and enhancement attachment function modules; The indentation distance is 5-10 pixels, and the width of the independent annotation area accounts for 25%.

7. The method according to claim 1, characterized in that, It also includes a dynamic labeling function for sample variations, specifically including: compatibility with mainstream variation data formats such as VCF and BAM; automatic matching of variation sites with Z-units and part coordinates, with a matching efficiency of ≥100,000 sites / second in an environment with a 3.0GHz quad-core CPU and 16GB of memory; variation units are marked with a bold border and color change in the main display area; telomere variations are separately labeled as "telomere variation"; repetitive sequence variations are marked with a dark red RGB (220,80,80) fill and a bold border; clicking on a variation part allows you to view the variation base sequence and its corresponding Z-unit information.

8. The method according to claim 1, characterized in that, It also includes a dual-end comparison function for tumor Hi-C breakdown points, specifically including: support for dual-screen or dual-machine independent operation modes; input of the Z-unit identifier and component coordinate range corresponding to breakdown point A on end A; input of the Z-unit identifier and component coordinate range corresponding to breakdown point B on end B; simultaneous display of Z-unit information, component coordinate range, functional attributes and base changes on both ends; real-time comparison of positional differences, mutation types and functional impacts, and generation of comparison reports.

9. The method according to claim 1, characterized in that, It also includes a reverse complementary chain viewing function, which specifically includes: the system automatically generates a reverse complementary chain based on the input base sequence; assigns corresponding Z-units, part coordinates and M-module annotations to the reverse complementary chain; supports bidirectional switching between forward and reverse chains; the reverse complementary chain adopts the same Z-series closed-loop coding rule as the forward chain and independently assigns Z-unit numbers.

10. A gene sequence fine visualization annotation system for implementing the method of any one of claims 1-9, characterized in that, include: The Z-series coding module is used to construct a Z-series closed-loop coding system, generate continuous sequence numbers Z0-ZN, and store the gene and non-gene coding information corresponding to each Z unit, including the coding rules for zero-length non-gene regions and Z☆ repetitive sequence units; the coordinate coding module is used to construct a three-dimensional layer-region coordinate system based on the Z-series skeleton, assign a unique layer-region-position three-dimensional coordinate to each part, and bind it to its corresponding Z unit to achieve cross-layer arrangement management; the character mapping module is used to store and manage a mapping rule library of 65 standardized characters, including the mapping relationship and color scheme of 25 gene-related symbols and 40 non-gene-related symbols. The component annotation module uses a six-color degenerate system to color the text of amino acid components, uniformly annotating non-coding region components with cyan-blue, and managing the text layout of the main display area. The module construction and annotation module integrates continuous components into M modules, annotating each M module with a linear start (M_start), linear end (M_end), and GRCh38 reference genome coordinates (CH38_start and CH38_end). Within independent annotation areas, three fixed background colors are used to differentiate the types of M modules, enabling the binding of modules with component coordinates and Z-units, and managing nested indentation relationships. The three-level interactive display module displays a first-level list of chromosome Z-fragments and a second-level list of genes within Z-fragments. The system features non-gene display, three-level part and module attribute annotation display, and supports interactive logic such as coordinate linkage jump, n-symbol penetration, Hi-C double-end comparison, and reverse chain switching. A mutation processing module loads mutation data such as VCF and BAM, automatically matching mutation sites with Z-units and part coordinates to achieve dynamic marking and penetration viewing of mutation sites. A multi-terminal adaptation module adapts the annotation content of the main display area and independent annotation area to display terminals of different sizes, ensuring that annotation information does not overlap or become crowded. A runtime environment support module provides basic environment support for system operation, including Linux / Windows operating system compatibility and support for hardware environments with quad-core or higher CPUs and 8GB or more of memory.