A siglec6 gene-modified non-human animal and methods of use thereof

Abstract

The present application provides a non-human animal expressing a human or chimeric sialic acid-binding Ig-like lectin 6 (SIGLEC6) protein and methods of using the same. In certain embodiments, the genome of the non-human animal comprises an exogenous polynucleotide sequence encoding a human or chimeric SIGLEC6 protein.

Description

Technical Field

[0001] This invention relates to transgenic nonhuman animals. Specifically, this invention relates to nonhuman animals expressing human or chimeric (e.g., humanized) SIGLEC6 protein and methods of using them. Background Technology

[0002] Traditional drug development typically employs in vitro screening methods. However, these methods cannot provide the in vivo environment (such as the tumor microenvironment, stromal cells, extracellular matrix components, and immune cell interactions), leading to a high failure rate in drug development. Furthermore, given the differences between humans and non-human animals, results obtained from in vivo pharmacological studies using conventional laboratory animals may not reflect the true disease state and target site interactions, resulting in significant discrepancies between clinical trial results and animal experimental results.

[0003] Humanized animals are experimental models created by using techniques such as genetic engineering, cell transplantation, or tissue replacement to imbue animals with human genes, cells, tissues, or immune system components, thereby more closely resembling the human state at physiological, immune, or metabolic levels. Common humanized animals include humanized mice, humanized immune system mice, and transgenic animals carrying specific human organs or metabolic enzymes. These models overcome the limitations of traditional animal models in addressing species differences, providing a more predictive experimental platform for studying human disease mechanisms and drug responses. In drug development, humanized animal models help evaluate the efficacy, safety, and immunogenicity of candidate drugs, improving the success rate of clinical translation.

[0004] Traditional humanized transgenic methods involve randomly inserting humanized genes into the animal's genome. This random insertion often results in poor regulation of humanized gene expression, manifesting in many pathological symptoms in these transgenic animals, thus limiting their application.

[0005] Therefore, it is necessary to develop humanized animal models suitable for drug screening and evaluation, thereby improving the efficiency of new drug development and reducing drug research and development costs. Invention Overview This disclosure provides a genetically modified non-human animal whose genome contains a foreign polynucleotide sequence encoding a human or chimeric sialic acid-binding Ig-like lectin 6 (SIGLEC6) protein. In some embodiments, the human or chimeric SIGLEC6 protein has at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity with the amino acid sequence (SEQ ID NO: 1) of the human SIGLEC6 protein. In some embodiments, the foreign polynucleotide sequence encodes the human SIGLEC6 protein. In some embodiments, the amino acid sequence of the human SIGLEC6 protein is SEQ ID NO: 1.

[0006] Another aspect of this disclosure provides a method for producing genetically modified non-human animals. In some embodiments, the method comprises modifying the genome of the non-human animal to include a foreign polynucleotide sequence encoding a human or chimeric SIGLEC6 protein. In some embodiments, the human or chimeric SIGLEC6 protein has at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity with the amino acid sequence (SEQ ID NO: 1) of the human SIGLEC6 protein. In some embodiments, the foreign polynucleotide sequence encodes the human SIGLEC6 protein. In some embodiments, the amino acid sequence of the human SIGLEC6 protein is SEQ ID NO: 1.

[0007] In another aspect, this disclosure provides a non-human animal cell whose genome contains a foreign polynucleotide sequence encoding a human or chimeric SIGLEC6 protein. In some embodiments, the human or chimeric SIGLEC6 protein has at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity with the amino acid sequence (SEQ ID NO: 1) of the human SIGLEC6 protein. In some embodiments, the foreign polynucleotide sequence encodes the human SIGLEC6 protein. In some embodiments, the amino acid sequence of the human SIGLEC6 protein is SEQ ID NO: 1.

[0008] In another aspect, this disclosure provides a non-human animal genome comprising a foreign polynucleotide sequence encoding a human or chimeric SIGLEC6 protein. In some embodiments, the human or chimeric SIGLEC6 protein shares at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity with the amino acid sequence (SEQ ID NO: 1) of the human SIGLEC6 protein. In some embodiments, the foreign polynucleotide sequence encodes the human SIGLEC6 protein. In some embodiments, the amino acid sequence of the human SIGLEC6 protein is SEQ ID NO: 1.

[0009] In some embodiments, the exogenous polynucleotide sequence encoding the human or chimeric SIGLEC6 protein comprises all or part of exons 1 to 8 of the human SIGLEC6 gene. In some embodiments, the exogenous polynucleotide sequence has at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity with the polynucleotide sequence shown at positions 51517511-51552070 of the NC_000019.10. In some embodiments, the exogenous polynucleotide sequence is the polynucleotide sequence shown at positions 51517511-51552070 of the NC_000019.10.

[0010] In some embodiments, the exogenous polynucleotide sequence encoding the human or chimeric SIGLEC6 protein is inserted into an endogenous safety site in the genome of the non-human animal. In some embodiments, the endogenous safety site is the ROSA26 gene site or the Hipp11 gene site. In some embodiments, the endogenous safety site is the Hipp11 gene site.

[0011] In some embodiments, the exogenous polynucleotide sequence encoding the human or chimeric SIGLEC6 protein is regulated by an exogenous regulatory element. In some embodiments, the exogenous regulatory element is the human SIGLEC6 promoter, 5'UTR, and / or 3'UTR. In some embodiments, the exogenous regulatory element comprises at least 50 bp or at least 308 bp of continuous nucleotides downstream of the 3'UTR of an exon of the human SIGLEC6 gene. In some embodiments, the exogenous regulatory element comprises at least 50 bp or at least 20400 bp of continuous nucleotides upstream of the 5'UTR of an exon of the human SIGLEC6 gene.

[0012] In some embodiments, the exogenous polynucleotide sequence encoding the human or chimeric SIGLEC6 protein replaces the endogenous SIGLEC6 gene in a non-human animal. In some embodiments, the exogenous polynucleotide sequence is regulated by endogenous regulatory elements in a non-human animal.

[0013] In some embodiments, the genome of the non-human animal further includes a second exogenous polynucleotide sequence encoding a second human or chimeric protein. In some embodiments, the second human or chimeric protein is selected from CD3E, CD3D, CD3G, KIT, KITLG, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, and CTLA4.

[0014] In some embodiments, the non-human animal is a mammal. In some embodiments, the mammal is a monkey or a rodent. In some embodiments, the rodent is a mouse or a rat.

[0015] In another aspect, this disclosure also provides a method for determining the effectiveness of a human SIGLEC6-targeted therapeutic agent in treating a disease. In some embodiments, the method includes: (1) administering the human SIGLEC6-targeted therapeutic agent to a non-human animal provided in this disclosure, wherein the non-human animal has the disease; and (2) evaluating the therapeutic effect of the therapeutic agent on the disease.

[0016] In some embodiments, the disease is cancer. In some embodiments, the cancer is a solid tumor or a hematologic malignancy. In some embodiments, the solid tumor is colorectal cancer, bladder cancer, head and neck cancer, liver cancer, or lung cancer. In some embodiments, the hematologic malignancy is chronic lymphocytic leukemia and acute myeloid leukemia.

[0017] In some embodiments, the non-human animal comprises tumor cells injected into the non-human animal. In some embodiments, the evaluation includes measuring the tumor volume in the non-human animal.

[0018] In some embodiments, the disease is an immune disease. In some embodiments, the immune disease is allergy, chronic urticaria, atopic dermatitis, osteoarthritis, asthma, rheumatoid arthritis, multiple sclerosis, psoriasis, chronic obstructive pulmonary disease, or inflammatory bowel disease (IBD).

[0019] In some embodiments, the human SIGLEC6-targeting therapeutic agent is an antibody or peptide drug. In some embodiments, the human SIGLEC6-targeting therapeutic agent is an anti-human SIGLEC6 antibody.

[0020] In some embodiments, the method further includes administering a second therapeutic agent to the non-human animal. In some embodiments, the non-human animal also contains a foreign polynucleotide sequence encoding human or chimeric PD-1, human or chimeric PD-L1, and / or human or chimeric CTLA4, and wherein the second therapeutic agent is an anti-human PD-1 antibody, an anti-human PD-L1 antibody, or an anti-human CTLA4 antibody. Attached Figure Description

[0021] Figure 1 The results of PCR identification of the F1 generation of humanized mice with the SIGLEC6 gene are shown. WT represents the wild-type control, and H2O represents the water control.

[0022] Figure 2The results of RT-PCR detection are shown. + / + represent wild-type C57BL / 6 mice, H / H represent SIGLEC6 gene-humanized homozygous mice, H2O represents water control, and mGADPH represents internal control.

[0023] Figure 3 The results of spleen immunophenotyping by flow cytometry from wild-type C57BL / 6 mice and SIGLEC6 gene-humanized homozygous mice are shown. Figure 3 A represents the white blood cell typing results in the spleen; Figure 3 B represents the T cell typing results in the spleen. + / + represents wild-type C57BL / 6 mice, H / H represents SIGLEC6 gene-humanized homozygous mice, TC represents T cells, BC represents B cells, NK represents NK cells, DC represents dendritic cells, NE represents neutrophils, MC represents monocytes, Mφ represents macrophages, Th represents CD4+ T cells, Tc represents CD8+ T cells, and Treg represents Treg cells.

[0024] Figure 4 The results of blood immunophenotyping by flow cytometry in wild-type C57BL / 6 mice and SIGLEC6 gene-humanized homozygous mice are shown. Figure 4 A represents the white blood cell typing results in the blood; Figure 4 B represents the T cell typing results in the blood. + / + represents wild-type C57BL / 6 mice, H / H represents SIGLEC6 gene-humanized homozygous mice, TC represents T cells, BC represents B cells, NK represents NK cells, DC represents dendritic cells, NE represents neutrophils, MC represents monocytes, Mφ represents macrophages, Th represents CD4+ T cells, Tc represents CD8+ T cells, and Treg represents Treg cells; Figure 5 The results of lymph node immunophenotyping by flow cytometry in wild-type C57BL / 6 mice and SIGLEC6 gene-humanized homozygous mice are shown. Figure 5 A represents the white blood cell typing results in the lymph nodes; Figure 5 B represents the T cell typing results in lymph nodes. + / + represents wild-type C57BL / 6 mice, H / H represents SIGLEC6 gene humanized homozygous mice, TC represents T cells, BC represents B cells, NK represents NK cells, Th represents CD4+ T cells, Tc represents CD8+ T cells, and Treg represents Treg cells. Invention Details This invention can be implemented in many different forms and is not limited to the embodiments described herein. It should be understood that these embodiments are provided so that a thorough and complete understanding of the disclosure of this invention will be achieved.

[0025] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the specification of this invention is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. Although the numerical ranges and parameter approximations shown in the broad scope of the invention are provided, the values ​​shown in the specific embodiments are described as accurately as possible. However, any value inherently contains a certain degree of error due to the standard deviation present in their respective measurements. Furthermore, all scopes disclosed herein should be understood to encompass any and all subscopes contained herein.

[0026] This invention relates to an animal model possessing human or chimeric sialic acid-binding Ig-like lectin 6 (SIGLEC6) protein. This animal model can express human or chimeric SIGLEC6 protein (e.g., humanized SIGLEC6). It can be used to study the function of the SIGLEC6 gene and also for screening and evaluating SIGLEC6 signaling pathway regulators (e.g., anti-human SIGLEC6 antibodies and / or peptide drugs). This invention provides a powerful tool for studying the function of the SIGLEC6 protein and a platform for screening related drugs.

[0027] definition As used herein, the terms “non-human animal” and “animal” are used interchangeably throughout the specification and include, but are not limited to, non-human primates (e.g., monkeys, chimpanzees, gorillas, etc.), rodents (e.g., rats, mice, gerbils, hamsters, ferrets), lagomorphs (e.g., rabbits), pigs (e.g., pigs, miniature pigs), equines, canids (e.g., dogs), felines (e.g., dogs), bovines, and other domestic, farm, and zoo animals.

[0028] As used in this article, the term "genome" refers to the sum of genetic information contained in a complete set of monoliths within a cell of an organism, typically composed of DNA. The genome includes all coding genes and non-coding sequences.

[0029] As used herein, the terms “polypeptide,” “peptide,” and “protein” are used interchangeably to refer to an amino acid polymer of any length having at least two amino acids.

[0030] As used herein, the terms “polynucleotide,” “nucleic acid molecule,” and “nucleic acid sequence” are used interchangeably to refer to polymers of nucleotides of any length having at least two nucleotides, including but not limited to DNA, RNA, DNA / RNA hybrids, and their modified forms.

[0031] As used herein, the terms "chimeric protein" or "chimeric polypeptide" refer to a protein or polypeptide where two or more portions of the polypeptide or protein originate from different species, or where at least one sequence of the protein or polypeptide differs from the amino acid sequence of a wild-type animal. In some embodiments, at least a portion of the sequence of a chimeric protein or chimeric polypeptide has origins from two or more different species, for example, identical (or homologous) proteins from different species. In some embodiments, a chimeric protein or chimeric polypeptide refers to a humanized protein or humanized polypeptide. As used herein, the terms "chimeric gene" or "chimeric nucleic acid" refer to a gene or nucleic acid where two or more portions of the gene or nucleic acid originate from different species, or where at least one sequence of the gene or nucleic acid differs from the nucleic acid of a wild-type animal. In some embodiments, a chimeric gene or chimeric nucleic acid has at least a portion of its sequence having origins from two or more different species, for example, a sequence encoding a different protein or a sequence encoding identical (or homologous) proteins from two or more different species. In some embodiments, a chimeric gene or chimeric nucleic acid refers to a humanized gene or humanized nucleic acid.

[0032] As used herein, the terms "humanized protein" or "humanized polypeptide" refer to a protein or polypeptide, wherein at least a portion of the protein or polypeptide is derived from a human protein or polypeptide. In some embodiments, a humanized protein or humanized polypeptide refers to a human protein or polypeptide. As used herein, the term "humanized nucleic acid" refers to a nucleic acid, wherein at least a portion of the nucleic acid is derived from a human. In some embodiments, all nucleic acids in a humanized nucleic acid are derived from humans. In some embodiments, a humanized nucleic acid refers to a humanized exon, which may be a human exon or a chimeric exon.

[0033] As used herein, the terms “regulatory element” and “gene regulatory element” are used interchangeably to refer to specific regions located on the DNA sequence that precisely regulate the initiation, rate, and efficiency of gene transcription by binding to protein factors. Regulatory elements include, but are not limited to, promoters, enhancers, silencers, and terminators. Depending on their location relative to the gene they regulate, regulatory elements include the 5'UTR (the untranslated region located upstream of the 5' end of a gene) and the 3'UTR (the untranslated region located downstream of the 3' end of a gene).

[0034] As used in this article, the term "cancer" refers to cells with autonomous growth capacity, that is, an abnormal state or condition characterized by rapid cell growth and proliferation. This term is intended to encompass all types of cancerous growth or carcinogenic processes, metastatic tissue, or malignant transformation of cells, tissues, or organs, regardless of histopathological type or stage of invasiveness.

[0035] SIGLEC6 gene The sialic acid-binding Ig-like lectin 6 (SIGLEC6) gene encodes a member of the sialic acid-binding immunoglobulin-like lectin family, belonging to type I transmembrane proteins. This protein possesses a typical immunoglobulin-like domain, recognizes sialic acid-containing glycan molecules, and participates in negative signal regulation through the intracellular immune receptor tyrosine repressor motif (ITIM), thus playing an important role in immune regulation. SIGLEC6 is primarily expressed in placental trophoblast cells, B cells, and certain immune cell subsets (such as mast cells, basophils, and specific dendritic cell subsets). SIGLEC6 initially attracted attention due to its high expression in placental tissue, and was considered to have potential functions in maternal-fetal interface immune tolerance and placental development. Furthermore, it has been reported to bind to leptin, suggesting its potential involvement in metabolic and endocrine-related signaling pathways.

[0036] In the field of immunology, SIGLEC6 is considered an inhibitory receptor that can maintain immune homeostasis by recruiting phosphatases such as SHP-1 or SHP-2 to inhibit cell activation signals. Recent studies have found that SIGLEC6 is upregulated in certain B-cell malignancies (such as chronic lymphocytic leukemia and acute myeloid leukemia), making it a potential therapeutic target. Because its expression is relatively limited in normal tissues, antibody or cell therapy strategies targeting SIGLEC6 are considered to have a certain selective advantage. Furthermore, members of the SIGLEC family are generally closely related to tumor immune escape; cancer cells are rich in sialic acid structures on their surface, which can inhibit immune cell activity through interaction with SIGLEC receptors. Therefore, the function of SIGLEC6 in the tumor microenvironment is also receiving increasing attention.

[0037] In the human genome, the SIGLEC6 gene (NCBI Gene ID: 946, UniProt ID: O43699, located on chromosome 19, NC_000019.10, vertices 51517819 to 51531670) contains eight exons: exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, and exon 8. The positions of each exon in the human SIGLEC6 gene in the transcript nucleotide sequence NM_001245.7 and the amino acid sequence of the human SIGLEC6 protein NP_001236.4 (SEQ ID NO: 1) are as follows: Table 1. SIGLEC6 sequence The SIGLEC6 gene, protein, and gene loci of other species in this field are also known. For example, relevant information (e.g., intron sequences, exon sequences, and amino acid sequences) of the SIGLEC6 gene in Musmusculus (mouse), Rattus norvegicus (rat), Macaca mulatta (rhesus monkey), Canis lupusfamiliaris (dog), and Sus scrofa (pig) can be found in NCBI, and the full contents are incorporated herein by reference.

[0038] Genetically modified non-human animals This disclosure provides, in one aspect, a non-human animal genetically modified with the SIGLEC6 gene. In some embodiments, the genome of the non-human animal contains a foreign polynucleotide sequence encoding a human or chimeric SIGLEC6 protein. In some embodiments, the non-human animal contains at least one genetically modified cell whose genome contains a foreign polynucleotide sequence encoding a human or chimeric SIGLEC6 protein. For example, at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, or 50% of the cells in the genetically modified non-human animal contain a foreign polynucleotide sequence encoding a human or chimeric SIGLEC6 protein. The cells having the foreign polynucleotide sequence can be various types of cells, such as endogenous cells, somatic cells, immune cells, T cells, B cells, NK cells, antigen-presenting cells, macrophages, dendritic cells, germ cells, blastocysts, or endogenous tumor cells. In some embodiments, the non-human animal is capable of passing the genetic modification to offspring through germline propagation.

[0039] The genetically modified non-human animal can be a variety of animals, such as mice, rats, rabbits, pigs, cattle (e.g., cows, bulls, buffalo), deer, sheep, goats, chickens, cats, dogs, ferrets, and primates (e.g., marmosets, rhesus monkeys). In some embodiments, the animal is a mammal. In some embodiments, the genetically modified non-human animal is a rodent. The rodent can be selected from mice, rats, and hamsters. In some embodiments, the rodent is selected from mice and rats. In some embodiments, the non-human animal is a mouse.

[0040] In some embodiments, the mice are selected from the C57BL strain. In some embodiments, the C57BL strain is selected from C57BL / A, C57BL / An, C57BL / GrFa, C57BL / KaLwN, C57BL / 6, C57BL / 6J, C57BL / 6ByJ, C57BL / 6NJ, C57BL / 10, C57BL10ScSn, C57BL / 10Cr, and C57BL / Ola. In some embodiments, the mice are selected from strains 129, including 129P1, 129P2, 129P3, 129X1, 129S1 (e.g., 129S1 / SV, 129S1 / SvIm), 129S2, 129S4, 129S5, 129S9 / SvEvH, 129S6 (129 / SvEvTac), 129S7, 129S8, 129T1, and 129T2. These mice are described, for example, in Festing et al., Revised nomenclature for strain 129 mice, MammalianGenome 10: 836 (1999); Auerbach et al., Establishment and Chimera Analysis of 129 / SvEv- and C57BL / 6-Derived Mouse Embryonic Stem Cell Lines (2000), the relevant content of which is incorporated herein by reference in its entirety. In some embodiments, the mice are BALB strains, such as BALB / c, BALB / cHeAn, BALB / cJ, BALB / cRl, and BALB / cWt. In some embodiments, the mice are BLD, CM, DX, FX, HZ, JD, KM, PD, QP, SMX, SY, TW, TZ, YP, YX, ZC, ZZ1, or ZZ2 strains, or mice with a NOD, NOD / SCID, or NOD-PrkdcscidIL-2rgnull background. In some embodiments, the mice are derived from hybrid lines (e.g., 50% BALB / c - 50% 129; or 50% C57BL / 6 - 50% 129). In some embodiments, the mice are hybrids of the 129 strain or the C57BL / 6 strain. In some embodiments, the mice are hybrids of a BALB strain and another strain.

[0041] In some embodiments, the genetically modified non-human animal provided in this disclosure expresses the human or chimeric SIGLEC6 protein in at least one cell. In some embodiments, the human or chimeric SIGLEC6 protein has at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity with the amino acid sequence (SEQ ID NO: 1) of the human SIGLEC6 protein. In some embodiments, the exogenous polynucleotide sequence encodes the human SIGLEC6 protein. In some embodiments, the amino acid sequence of the human SIGLEC6 protein is SEQ ID NO: 1.

[0042] In some embodiments, the genetically modified non-human animals provided in this disclosure contain a foreign polynucleotide sequence encoding the human or chimeric SIGLEC6 protein in the genome of at least one cell. In some embodiments, the foreign polynucleotide sequence comprises all or part of exons 1 to 8 of the human SIGLEC6 gene. In some embodiments, the foreign polynucleotide sequence has at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity with the polynucleotide sequence shown at positions 51517511-51552070 of the NC_000019.10. In some embodiments, the foreign polynucleotide sequence is the polynucleotide sequence shown at positions 51517511-51552070 of the NC_000019.10.

[0043] In some embodiments, the exogenous polynucleotide sequence encoding the human or chimeric SIGLEC6 protein is inserted into an endogenous safe site in the genome of the non-human animal. A genomic safe site refers to a specific region in the genome where exogenous gene insertion or gene editing will not interfere with the normal gene function of the host cell, nor induce tumorigenesis or other adverse effects, while simultaneously achieving stable and continuous exogenous gene expression. Ideal genomic safe sites typically possess the following characteristics: first, they are located in non-coding regions or "gene desert" areas, not affecting the transcriptional regulation of nearby key genes; second, they are far from proto-oncogenes or tumor suppressor genes, reducing the risk of tumorigenesis caused by insertion mutations; third, their chromatin structure is open, facilitating stable expression of the exogenous gene; and fourth, they exhibit high consistency and predictability across different cell types. Common mouse genomic safe sites include Rosa26 and Hipp11. In some embodiments, the exogenous polynucleotide sequence encoding the human or chimeric SIGLEC6 protein is inserted into the Rosa26 gene site or the Hipp11 gene site. In some embodiments, the exogenous polynucleotide sequence encoding the human or chimeric SIGLEC6 protein is inserted into the Hipp11 gene site.

[0044] In some embodiments, the exogenous polynucleotide sequence encoding the human or chimeric SIGLEC6 protein is regulated by an exogenous regulatory element after insertion into an endogenous safety site in the genome of a non-human animal. In some embodiments, the exogenous regulatory element includes the human SIGLEC6 promoter, 5'UTR, and / or 3'UTR. In some embodiments, the exogenous regulatory element comprises at least 50 bp, at least 100 bp, at least 150 bp, at least 200 bp, at least 250 bp, at least 300 bp, at least 350 bp, at least 400 bp, at least 450 bp, or at least 500 bp of continuous nucleotides downstream of the 3'UTR of the exon of the human SIGLEC6 gene. In some embodiments, the exogenous regulatory element comprises at least 308 bp of continuous nucleotides downstream of the 3'UTR of the exon of the human SIGLEC6 gene. In some embodiments, the exogenous regulatory element comprises at least 50 bp, at least 100 bp, at least 200 bp, at least 300 bp, at least 400 bp, at least 500 bp, at least 600 bp, at least 700 bp, at least 800 bp, at least 900 bp, at least 1000 bp, at least 2000 bp, at least 3000 bp, at least 4000 bp, at least 5000 bp, at least 6000 bp, at least 7000 bp, at least 8000 bp, at least 9000 bp, at least 10000 bp, at least 20000 bp, at least 30000 bp, at least 40000 bp, or at least 50000 bp of continuous nucleotides upstream of the 5'UTR of the human SIGLEC6 gene. In some embodiments, the exogenous regulatory element is a regulatory system of a specific inducer or repressor. In some implementations, the regulatory system is a tetracycline system (Tet-Off System / Tet-On System) or a tamoxifen system.

[0045] In some embodiments, the exogenous polynucleotide sequence encoding the human or chimeric SIGLEC6 protein is inserted into or replaces the endogenous SIGLEC6 gene locus in a nonhuman animal. In some embodiments, the exogenous polynucleotide sequence is regulated by endogenous regulatory elements in the nonhuman animal. In some embodiments, the genetically modified nonhuman animal can express human or chimeric SIGLEC6 under the control of endogenous regulatory elements. Insertion or substitution at the endogenous locus provides nonhuman animals that express the human or chimeric SIGLEC6 protein in suitable cells without causing potential pathology.

[0046] This disclosure also provides a transgenic animal having two or more human or chimeric genes. The animal may contain a human or chimeric SIGLEC6 gene and a sequence encoding an additional human or chimeric protein. In some embodiments, the additional human or chimeric protein is selected from human or chimeric proteins targeting the CD3E, CD3D, CD3G, KIT, KITLG, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, and CTLA4 genes.

[0047] This disclosure also provides a cell line or primary cell culture derived from the genetically modified non-human animal or its offspring. The cell culture can be obtained by isolating cells from the non-human animal, or by using the constructs provided in this disclosure and cell cultures established using standard cell transfection techniques. Therefore, this disclosure, in another aspect, provides a non-human animal cell whose genome contains an exogenous polynucleotide sequence encoding a human or chimeric SIGLEC6 protein. In some embodiments, the non-human animal cell does not include embryonic stem cells, pluripotent stem cells, induced pluripotent stem cells (iPS cells), or germ cells.

[0048] This disclosure also provides genomes derived from the genetically modified non-human animals. In some embodiments, the non-human animal genome contains a foreign polynucleotide sequence encoding a human or chimeric SIGLEC6 protein.

[0049] Methods for constructing genetically modified non-human animals The genetically modified nonhuman animals disclosed herein can be prepared using several genome editing techniques known in the art, including homologous recombination using embryonic stem cells, non-homologous end joining (NHEJ) technology, CRISPR / Cas9 technology, zinc finger nuclease technology, transcription activator-like effector nuclease technology, and homing endonuclease technology. In some embodiments, homologous recombination technology is preferred. These genome editing techniques are described in Yin et al., “Delivery technologies for genome editing,” Nature Reviews Drug Discovery 16.6 (2017):387-399, which is incorporated herein by reference.

[0050] In some embodiments, a polynucleotide sequence encoding a human or chimeric SIGLEC6 protein is introduced into the endogenous genome of at least one cell of a non-human animal. In some embodiments, the introduction occurs in embryonic stem cells, germ cells, or blastocysts. In some embodiments, the introduction occurs in somatic cells (e.g., fibroblasts). The nucleus of the somatic cell into which the polynucleotide sequence is introduced can be inserted into an enucleated oocyte to produce a non-human animal.

[0051] In some embodiments, the introduction of the exogenous polynucleotide sequence into the endogenous genome of non-human animal cells can be accomplished using a targeting vector. In some embodiments, the targeting vector comprises a 5' homologous arm, a human or chimeric SIGLEC6 gene fragment, and a 3' homologous arm. In some embodiments, the targeting vector also comprises an auxiliary sequence. In some embodiments, the auxiliary sequence includes a stop codon, an insulator, a WPRE (WHP post-transcriptional response element), a loxP, and / or a polyA.

[0052] In some embodiments, homologous recombination can be used to insert a human or chimeric SIGLEC6 polynucleotide sequence into the genome of a nonhuman animal cell (e.g., an endogenous safe site). In some embodiments, a method for preparing the genetically modified nonhuman animal includes: (1) providing a plasmid containing a fragment of the human SIGLEC6 gene, the plasmid flanked by 5' and 3' homologous arms, wherein the 5' and 3' homologous arms target an endogenous safe site; (2) modifying the genome of a fertilized egg or embryonic stem cell using the plasmid of step (1); (3) transplanting the fertilized egg obtained in step (2) into the oviduct of a pseudopregnant female mouse, or transplanting the embryonic stem cell obtained in step (2) into a blastocyst, and then transplanting the blastocyst into the oviduct of a pseudopregnant female mouse to produce offspring mice functionally expressing the humanized SIGLEC6 protein; and (4) mating the offspring mice obtained in step (3) to obtain homozygous mice.

[0053] In some implementations, DNA double-strand breaks can be induced upstream and downstream of a target site (e.g., via zinc finger nucleases, TALEN, or CRISPR), and then homologous recombination can be used to insert human or chimeric SIGLEC6 polynucleotide sequences into the genome of non-human animal cells.

[0054] For non-human animals from which suitable genetically modified embryonic stem cells (ES) are not readily available, alternative methods can be employed to construct non-human animals containing genetic modifications. Such methods include, for example, modifying the genome of non-ES cells (e.g., fibroblasts or induced pluripotent stem cells) and transferring the modified genome to suitable cells, such as oocytes, via nuclear transfer, and gestating the modified cells (e.g., modified oocytes) in a non-human animal under appropriate conditions to form an embryo. The aforementioned methods of construction are known in the art and are described in “A. Nagy, et al., “Manipulating the Mouse Embryo: A Laboratory Manual (Third Edition),” Cold Spring Harbor Laboratory Press, 2006, the entire contents of which are incorporated herein by reference.

[0055] This disclosure also provides a method for generating genetically modified non-human animals having two or more human or chimeric genes. In some embodiments, the method includes: (1) obtaining a non-human animal using the above-described construction method; and (2) mating the non-human animal obtained in step (1) with other genetically modified non-human animals, performing in vitro fertilization or direct gene editing, and screening to obtain a multi-gene-modified non-human animal. In some embodiments, the method includes obtaining fertilized eggs or embryonic stem cells from non-human animals with other gene modifications, and performing gene editing targeting SIGLEC6 on the obtained fertilized eggs or embryonic stem cells to obtain a multi-gene-modified non-human animal.

[0056] Application of genetically modified non-human animals This disclosure also provides, in another aspect, an application of the aforementioned SIGLEC6 gene modification. The applications include: (A) applications in product development involving SIGLEC6-related immune processes in human cells; (B) applications as SIGLEC6-related model systems in pharmacological, immunological, microbiological, and medical research; (C) applications involving the production and use of animal experimental disease models for SIGLEC6-related etiological research and / or for the development of diagnostic and / or therapeutic strategies; (D) applications in the screening, efficacy testing, efficacy assessment, validation, or evaluation of human SIGLEC6 signaling pathway modulators in vivo; and (E) applications in studying SIGLEC6 gene function, investigating drugs targeting human SIGLEC6, their efficacy, and drugs for SIGLEC6-related tumors, inflammation, and immune-related diseases.

[0057] In some embodiments, this disclosure provides a method for determining the effectiveness of a human SIGLEC6-targeted therapeutic agent in treating a disease. In some embodiments, the method includes: (1) administering the human SIGLEC6-targeted therapeutic agent to a non-human animal provided in this disclosure, wherein the non-human animal has the disease; and (2) evaluating the therapeutic effect of the therapeutic agent on the disease.

[0058] In some embodiments, the disease is cancer. The "tumor" includes, but is not limited to, lymphoma, non-small cell lung cancer, cervical cancer, leukemia, ovarian cancer, nasopharyngeal carcinoma, breast cancer, endometrial cancer, colon cancer, rectal cancer, stomach cancer, bladder cancer, glioma, lung cancer, bronchial cancer, bone cancer, prostate cancer, pancreatic cancer, liver and bile duct cancer, esophageal cancer, kidney cancer, thyroid cancer, head and neck cancer, testicular cancer, glioblastoma, astrocytoma, melanoma, myelodysplastic syndrome, and sarcoma. The leukemia is selected from acute lymphoblastic leukemia, acute myeloid leukemia, myeloid leukemia, chronic lymphocytic leukemia, multiple myeloma, plasma cell leukemia, and chronic myeloid leukemia; the lymphoma is selected from Hodgkin's lymphoma and non-Hodgkin's lymphoma, including B-cell lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, marginal zone B-cell lymphoma, T-cell lymphoma, and Waldenström macroglobulinemia; the sarcoma is selected from osteosarcoma, Ewing's sarcoma, leiomyosarcoma, synovial sarcoma, soft tissue sarcoma, angiosarcoma, liposarcoma, fibrosarcoma, rhabdomyosarcoma, and chondrosarcoma. In some embodiments, the tumor is breast cancer, pancreatic cancer, endocrine cancer, head and neck cancer, gastrointestinal cancer, colorectal cancer, bladder cancer, non-small cell lung cancer, glioblastoma, prostate cancer, neuroendocrine tumor, mesothelial tissue tumor, oropharyngeal tumor, female reproductive system cancer, or meningioma.

[0059] In some embodiments, the method includes detecting the inhibitory effect of a therapeutic agent on cancer or tumor. In some embodiments, the detection includes determining the size and / or proliferation rate of tumor cells. In some embodiments, the detection method includes caliper measurement, flow cytometry, and / or in vivo animal imaging. In some embodiments, the detection includes assessing individual body weight, fat mass, activation pathways, neuroprotective activity, or metabolic changes, including changes in food or water consumption.

[0060] In some embodiments, the disease is an immune disease. In some embodiments, the immune disease includes, but is not limited to, GVHD (graft-versus-host disease), psoriasis, allergies, asthma, myocarditis, nephritis, hepatitis (preferably non-alcoholic steatohepatitis), systemic lupus erythematosus, rheumatoid arthritis, scleroderma, hyperthyroidism, primary thrombocytopenic purpura, autoimmune hemolytic anemia, ulcerative colitis, autoimmune liver disease, diabetes, pain, or neurological disorders. In some embodiments, the immune disease is osteoarthritis, asthma, rheumatoid arthritis, or multiple sclerosis.

[0061] In some embodiments, the disease is various types of inflammation. In some embodiments, the inflammation includes both acute and chronic inflammation. Specifically, it includes, but is not limited to, degenerative inflammation, exudative inflammation (serous inflammation, fibrinous inflammation, purulent inflammation, hemorrhagic inflammation, necrotizing inflammation, catarrhal inflammation), proliferative inflammation, and specific inflammation (tuberculosis, syphilis, leprosy, lymphogranuloma venereum, etc.). In some embodiments, the inflammation is psoriasis, inflammatory bowel disease, chronic obstructive pulmonary disease, or inflammatory bowel disease (IBD).

[0062] In some embodiments, the human SIGLEC6-targeting therapeutic agent is an antibody or peptide drug. In some embodiments, the human SIGLEC6-targeting therapeutic agent is an anti-human SIGLEC6 antibody. In some embodiments, the SIGLEC6-targeting therapeutic agent blocks or inhibits SIGLEC6-mediated signaling pathways. In some embodiments, the SIGLEC6-targeting therapeutic agents described herein can block interactions between SIGLEC6 complexes, thereby inhibiting the SIGLEC6 signaling pathway.

[0063] On the other hand, the multi-gene-modified non-human animal models provided in this disclosure can be used to evaluate the effectiveness of combination therapies targeting two or more proteins, such as anti-SIGLEC6 antibodies and adjunctive therapeutic agents for treating cancer or immune diseases (e.g., asthma or atopic dermatitis). In some embodiments, the method includes administering an anti-SIGLEC6 antibody and an adjunctive therapeutic agent to an animal having a tumor or immune disease and determining the effect of the combination therapy on the immunotumor or immune disease. In some embodiments, the adjunctive therapeutic agent is an antibody that specifically binds to CD3E, CD3D, CD3G, KIT, KITLG, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, and / or CTLA4.

[0064] In some embodiments, the combination therapy is used to treat various cancers described herein, such as breast cancer, ovarian cancer, endometrial cancer, melanoma, kidney cancer, lung cancer, or other cancers. In some embodiments, the combination therapy is designed to treat immune disorders described herein, such as psoriasis. In some embodiments, the methods described herein can be used to evaluate combination therapy with other methods. Methods for treating cancer that can be used alone or in combination with the methods described herein include chemotherapy, such as camphor, doxorubicin, cisplatin, carboplatin, procarbazine, meloratadine, cyclophosphamide, doxorubicin, ifosfamide, melphalan, chlorpromazine, bismuth subcitrate, nitrosourea, daktarin, daunorubicin, bleomycin, prilocytic erythromycin, mitomycin, etoposide, verapamil, podophyllotoxin, tamoxifen, paclitaxel, transplatinum, 5-fluorouracil, vincristine, vinblastine, and / or methotrexate.

[0065] This disclosure also provides a method for determining the toxicity of a SIGLEC6-targeting therapeutic agent. The method includes administering an antibody to a non-human animal as described above and assessing changes in the animal's body weight, red blood cell count, hematocrit, and / or hemoglobin. In some embodiments, the antibody may reduce red blood cells (RBCs), hematocrit, or hemoglobin by more than 20%, 30%, 40%, or 50%. In some embodiments, the animal's body weight is at least 5%, 10%, 20%, 30%, or 40% less than that of a control group (e.g., the average body weight of animals not treated with the antibody).

[0066] In some embodiments, this disclosure provides a method for validating the in vivo efficacy of TCR-T, CAR-T, and / or other immunotherapies (e.g., T-cell adoptive transfer therapy). For example, the method includes transplanting human tumor cells into the animals described herein and administering human CAR-T to the animals containing human tumor cells. The effectiveness of CAR-T therapy can be determined and evaluated. In some embodiments, the animals are selected from SIGLEC6 gene-humanized non-human animals prepared by the methods described herein, or dual- or multiple-humanized non-human animals (or their progeny) produced by the methods described herein.

[0067] Example The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer as a result. However, these embodiments are merely exemplary and do not constitute any limitation on the scope of the present invention. Those skilled in the art should understand that modifications or substitutions can be made to the details and form of the technical solutions of the present invention without departing from the spirit and scope of the present invention, but all such modifications and substitutions fall within the protection scope of the present invention.

[0068] Example 1: SIGLEC6 gene-humanized mice This embodiment demonstrates the insertion of a nucleotide sequence of the human SIGLEC6 protein into the mouse Hipp11 or ROSA26 site, enabling mice to express human SIGLEC6. Specifically, this embodiment uses gene editing technology to insert a 34.56 kb polynucleotide sequence containing the human SIGLEC6 gene upstream of the 5'UTR and downstream of the 3'UTR into the mouse Hipp11 site, thereby achieving humanization of the SIGLEC6 gene in mice.

[0069] To implement the targeting strategy of this embodiment, a targeting vector was constructed via BAC (BAC No.: RP11-145E6) recombination. The targeting vector contains, at 5'-3': an upper homologous arm sequence (5' homologous arm) of the mouse Hipp11 site, a 5' 2xInsulator sequence (SEQ ID NO: 2), an A fragment containing the human SIGLEC6 gene, a 3' 2xInsulator sequence, and a lower homologous arm sequence (3' homologous arm) of the mouse Hipp11 site. The 5' homologous arm sequence is SEQ ID NO: 3, and the 3' homologous arm sequence is SEQ ID NO: 4. The nucleotide sequence of the human SIGLEC6 gene fragment is positions 51517511-51552070 of the gene accession number NC_000019.10.

[0070] The connection sequence between the mouse and the 5' end 2xInsulator is as follows: 5'-gacagtagattataatccttcagctg cccact tctagacatggaatcgatgtcaggtacc gagc tcacggggacagcccc-3' (SEQ ID NO: 6).

[0071] In the sequence “CCCACT”, the “T” is the last nucleotide of the mouse sequence linked to 2xInsulator, and the first “G” in the sequence “GAGC” is the first nucleotide of 2xInsulator at the 5' end. The underlined curves represent unrelated sequences such as restriction sites and vector sequences.

[0072] The downstream connection sequence of the 5' end 2xInsulator to the human SIGLEC6 fragment is as follows: 5'-GGAGTCAGTGAGA ATATT CTCGAGGATCCGCGGCCGC AGAC ACAGGACAAGTTCTTTCTGCCTCACCCTG-3' (SEQ ID NO: 7).

[0073] The last "T" in the sequence "ATATT" is the last nucleotide of the 5' end 2xInsulator, the first "A" in the sequence "AGAC" is the first nucleotide of the human SIGLEC6 fragment, the underlined (curved) sequences are restriction enzyme sites, vector sequences and other irrelevant sequences.

[0074] The connection sequence between the human SIGLEC6 fragment and the 3' end 2xInsulator is as follows: 5'-ggaaagtgtagctatacgttgttt ataa GCGATCGCATAAatcgatgtcaggtacc gagc tcacggggacagcccccccc-3' (SEQ ID NO: 8).

[0075] In the sequence “ATAA”, the last “A” is the last nucleotide of the human SIGLEC6 fragment, and the first “G” in the sequence “GAGC” is the first nucleotide of the 3' end 2xInsulator. The underlined (curved) sequences are restriction enzyme sites, vector sequences, and other irrelevant sequences.

[0076] The downstream connection sequence of the 3' end 2xInsulator to the mouse is as follows: 5'-CCAACTCCAGGACGGAGTCAGTGAGA ATATT CTCGAG CTAC TGGAGGAGGACAAACTGGTCACTTTTCAGC-3' (SEQ ID NO: 9).

[0077] In the sequence “ATATT”, the last “T” is the last nucleotide of the 3' end 2xInsulator, and the first “C” in the sequence “CTAC” is the first nucleotide of the mouse connected to the 3' end 2xInsulator. The underlined curves represent restriction sites, vector sequences, and other irrelevant sequences.

[0078] The mRNA sequence of the modified humanized mouse SIGLEC6 is shown in SEQ ID NO: 5, and the expressed protein sequence is shown in SEQ ID NO: 1.

[0079] The targeting vector also includes a self-excision cassette, which contains the following elements from 5'-3': a recombination site loxP for the specific recombination system, an antibiotic resistance gene (Neo) for positive clone selection, a tissue-specific promoter (such as a testis-specific promoter or an ovary-specific promoter), Cre recombinase, and loxP. During germline transfer, Cre is expressed under the regulation of the specific promoter and is removed from the mouse cell genome along with Neo.

[0080] The construction of the target vector can be performed using conventional methods, such as enzyme digestion and ligation, and sequencing verification. The constructed target vector was transfected into embryonic stem cells of C57BL / 6 mice (purchased from the National Rodent Seed Center of the China National Institutes for Food and Drug Control) via electroporation. The resulting cells were screened using a positive clone selection marker gene. The selected positive clone cells (black mice) were introduced into isolated blastocysts (white mice) using techniques known in the art. The resulting chimeric blastocysts were transferred to culture medium for a short period before being transplanted into the oviducts of recipient female mice (white mice) to produce F0 generation chimeric mice (black and white). F0 generation chimeric mice (males) were backcrossed with wild-type mice (females) to obtain F1 generation mice. F2 generation homozygous mice were then bred together with F1 generation heterozygous mice to obtain F2 generation homozygous mice.

[0081] The genotype of F1 generation mouse somatic cells can be identified using PCR. The primers shown in the table below are used for detection. Example results are shown below. Figure 1 As shown, the three mice numbered F1-01 to F1-03 were positive mice.

[0082] Table 2 Primer sequences and recombinant fragment sizes for F1 generation genotype PCR detection The expression of SIGLEC6 gene mRNA in humanized mice was detected by RT-PCR. Specifically, one 7-week-old C57BL / 6 mouse (+ / +) and one 7-week-old female SIGLEC6 gene humanized homozygous mouse (H / H) prepared in this study were selected. After euthanasia by cervical dislocation, spleen tissue was collected. RT-PCR was performed using the primer sequences shown in the table below. The results are as follows. Figure 2 As shown. From Figure 2 As can be seen, human SIGLEC6 mRNA was not detected in wild-type C57BL / 6 mice; human SIGLEC6 mRNA was detected in humanized homozygous mice, but mouse SIGLEC6 mRNA was not detected.

[0083] Table 3 RT-PCR primer sequences and target fragment sizes The expression of human SIGLEC6 protein in mice was confirmed by flow cytometry. Specifically, peritoneal lavage fluid, spleen tissue, peripheral blood, and lymph nodes were collected from 7-week-old female wild-type C57BL / 6 mice and SIGLEC6 gene-humanized homozygous mice. The following antibodies were used: Invitrogen CD45 Monoclonal Antibody (30-F11), eFluor™ 506, eBioscience™ (mCD45), PerCP / Cy5.5 anti-mouse TCR βchain (mTCRβ), Brilliant Violet 650™ anti-mouse CD19 Antibody (mCD19), APC / Cyanine7 anti-mouse CD335 (NKp46) Antibody (mNKp46), Alexa Fluor® 700 anti-mouse CD11c Antibody (mCD11c), and Brilliant Violet 785™ anti-mouse / human monocyte marker antibody. The following antibodies were used for flow cytometry detection after staining: CD11b Antibody (mCD11b), macrophage marker antibody PE / Cyanine7 anti-mouse F4 / 80 Antibody (mF4 / 80), neutrophil marker antibody FITC anti-mouse Ly-6G Antibody (mLy-6G), mast cell marker antibody APC anti-mouse FcεRIα Antibody (mFcεRIα), Brilliant Violet 711™ anti-mouse CD117 (c-Kit) Antibody (mCD117), and anti-human SIGLEC6 antibody BD OptiBuild™ BV421 Mouse Anti-HumanSiglec-6 (CD327) (hSIGLEC6).

[0084] The detection results are shown in Table 4. Specifically, human SIGLEC6 protein expression was detected in mast cells of peritoneal lavage fluid from SIGLEC6 gene-humanized homozygous mice (H / H), B cells and natural killer cells in the spleen, peripheral blood, and lymph nodes, as well as neutrophils, dendritic cells, monocytes, and macrophages in the spleen and peripheral blood. Human SIGLEC6 protein was not detected in T cells of the spleen and lymph nodes of SIGLEC6 gene-humanized homozygous mice (H / H), but low expression of human SIGLEC6 protein was detected in T cells of peripheral blood. The expression results of human SIGLEC6 protein in SIGLEC6 gene-humanized homozygous mice (H / H) were consistent with the expression profile of human SIGLEC6 protein. Human SIGLEC6 protein was not detected in wild-type C57BL / 6 mice (+ / +). This indicates that the SIGLEC6 gene-humanized mice constructed using the method described in this application can normally express human SIGLEC6 protein.

[0085] Table 4 Flow cytometry results To investigate whether SIGLEC6 humanization affects the distribution of immune cell subsets in the spleen, blood, and lymph nodes of mice, flow cytometry was used. Specifically, three 6-week-old female wild-type C57BL / 6 mice (+ / +) and three SIGLEC6 gene-humanized homozygous mice (H / H) were used. Peripheral blood was collected, and after euthanasia, spleen and lymph node tissues were collected to obtain spleen cells and lymphocytes. The following antibodies were used: mCD45 antibody BioLegend PerCP anti-mouse CD45 Antibody (purchased from Biolegend, 103130); m / hCD11b antibody BioLegend Brilliant Violet 785™ anti-mouse / human CD11b Antibody (purchased from Biolegend, 101243); mLy6G antibody Brilliant Violet 650™ anti-mouse Ly-6G Antibody (purchased from Biolegend, 127641); mCD11c antibody Brilliant Violet 711™ anti-mouse CD11c Antibody (purchased from Biolegend, 117349); mNK1.1 antibody Brilliant Violet 421™ anti-mouse NK-1.1 Antibody (purchased from Biolegend, 108732); and mTCRβ antibody APC / Cy7 anti-mouse TCRβ. Chain (purchased from Biolegend, 109220), mCD19 antibody FITC anti-mouse CD19 (purchased from Biolegend, 115506), mCD4 antibody Brilliant Violet 510™ anti-mouse CD4 (purchased from Biolegend, 100559), mCD8 antibody PE anti-mouse CD8a Antibody (purchased from Biolegend, 100708), mFoxp3 antibody FOXP3 Monoclonal Antibody (FJK-16s) (purchased from eBioscience™, 46-5773-82), and mF4 / 80 antibody PE / Cyanine7 anti-mouse F4 / 80 Antibody (purchased from Biolegend, 123114) were used to identify and stain spleen cells, blood cells, and lymphocytes before flow cytometry detection. The flow cytometry gating strategy is shown in the table below. The percentage of T cells, B cells, NK cells, dendritic cells, neutrophils, monocytes, and macrophages in the spleen's white blood cells was determined. Figure 3A) The percentage of CD4+ T cells, CD8+ cells, and Treg cells in the spleen ( ) Figure 3 B) The percentage of T cells, B cells, NK cells, dendritic cells, neutrophils, monocytes, and macrophages in white blood cells in the blood ( Figure 4 A) The percentage of CD4+ T cells, CD8+ cells, and Treg cells in the blood ( ) Figure 4 B) The percentage of T cells, B cells, and NK cells among white blood cells in lymph nodes ( Figure 5 A) and the percentage of CD4+ T cells, CD8+ T cells, and Treg cells in lymph nodes ( Figure 5 B).

[0086] Table 5 Different flow cytometry gating strategies for immune cells The results showed no significant differences in the percentages of T cells, B cells, NK cells, dendritic cells, neutrophils, monocytes, and macrophages in the spleen and blood of SIGLEC6 gene-humanized homozygous mice (H / H) and wild-type C57BL / 6 mice (+ / +). There were also no significant differences in the percentages of T cells, B cells, and NK cells in the lymph nodes, nor in the percentages of CD4+ T cells, CD8+ T cells, and Treg cells among T cells. This indicates that SIGLEC6 gene-humanized mice can express human SIGLEC6 protein, and the proportion and distribution of immune cells are normal.

[0087] Example 2, Colon adenocarcinoma model This embodiment demonstrates the in vivo preparation of a colon adenocarcinoma model using humanized mice induced with the SIGLEC6 gene. This model can be used to test the in vivo efficacy of human-specific antibodies, such as to evaluate the efficacy, pharmacokinetics, and in vivo therapeutic effects of human-specific SIGLEC6 signaling pathway antagonists on colon adenocarcinoma.

[0088] SIGLEC6 humanized mouse homozygotes were subcutaneously inoculated with MC38 cells until the tumor volume reached approximately 100 mm. 3 Mice were then divided into control or treatment groups based on tumor volume. The treatment group received a drug targeting human SIGLEC6 randomly, while the control group received an equal volume of saline. Tumor volume and mouse weight were measured periodically. By comparing changes in mouse weight and tumor size, the in vivo safety and efficacy of the compound could be effectively assessed.

[0089] Example 3, Leukemia Model This embodiment demonstrates the in vivo preparation of a leukemia model using humanized mice inducing the SIGLEC6 gene. This model can be used to test the in vivo efficacy of human-specific antibodies, such as to evaluate the efficacy, pharmacokinetics, and in vivo therapeutic effects of antagonists of the human-specific SIGLEC6 signaling pathway against leukemia.

[0090] SIGLEC6 humanized mice homozygous were inoculated intravenously with 5 × 10⁶ mice. 6 One murine leukemia cell (characteristic: mCD5) + mCD19 + mCD3 - hSIGLEC6 + Once the proportion of circulating leukemia cells exceeded 3%, mice were randomly divided into a control group or a treatment group. The treatment group received a drug targeting human SIGLEC6, while the control group received an equal volume of saline. Peripheral blood was collected periodically to detect the proportion of circulating leukemia cells, and the mice were weighed. The in vivo safety and efficacy of the compound were assessed by comparing changes in mouse weight and the proportion of circulating leukemia cells.

[0091] Example 4: Preparation of dual-gene or multi-gene humanized mice This example demonstrates three methods for preparing multi-humanized mouse models using SIGLEC6 gene-humanized mice.

[0092] Method 1: In Example 1 above, the embryonic stem cells used for microinjection were selected from mice containing one or more of the following humanized genes: CD3E, CD3D, CD3G, KIT, KITLG, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, and CTLA4. The resulting humanized mice simultaneously contain the humanized SIGLEC6 gene and modifications of the humanized CD3E, CD3D, CD3G, KIT, KITLG, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, or CTLA4 genes.

[0093] Method 2: Based on SIGLEC6 gene-humanized mice, dual-humanized or multi-humanized mouse models are obtained by using isolated mouse ES embryonic stem cells and gene recombination targeting technology.

[0094] Method 3: Mating homozygous or heterozygous humanized mice with other gene-modified mice and screening their offspring. According to Mendelian inheritance, there is a certain probability of obtaining multi-gene mice with humanized SIGLEC6 gene and other gene modifications. Mating heterozygotes with each other can produce homozygotes with two or more gene modifications.

[0095] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details of the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solutions of the present invention, and these simple modifications all fall within the protection scope of the present invention. Furthermore, it should be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. To avoid unnecessary repetition, the present invention will not describe the various possible combinations separately. In addition, various different embodiments of the present invention can also be arbitrarily combined, as long as they do not violate the spirit of the present invention, they should also be considered as the content disclosed by the present invention.

Claims

1. A method for producing a genetically modified nonhuman animal, comprising modifying the genome of the nonhuman animal to contain an exogenous polynucleotide sequence encoding a human or chimeric sialic acid-binding Ig-like lectin 6 (SIGLEC6) protein.

2. The method according to claim 1, wherein the human or chimeric SIGLEC6 protein has at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity with the amino acid sequence (SEQ ID NO: 1) of the human SIGLEC6 protein; preferably, wherein the exogenous polynucleotide sequence encodes the human SIGLEC6 protein; preferably, wherein the amino acid sequence of the human SIGLEC6 protein is SEQ ID NO:

1.

3. The method according to claim 1 or 2, wherein the exogenous polynucleotide sequence comprises all or part of exons 1 to 8 of the human SIGLEC6 gene; preferably, wherein the exogenous polynucleotide sequence has at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity with the polynucleotide sequence shown at positions 51517511-51552070 of the gene accession number NC_000019.10; preferably, wherein the exogenous polynucleotide sequence is the polynucleotide sequence shown at positions 51517511-51552070 of the gene accession number NC_000019.

10.

4. The method according to any one of claims 1-3, wherein the exogenous polynucleotide sequence is inserted into an endogenous safety site in the genome of the non-human animal, preferably, the endogenous safety site is the ROSA26 gene site or the Hipp11 gene site, more preferably, the endogenous safety site is the Hipp11 gene site.

5. The method according to any one of claims 1-4, wherein the exogenous polynucleotide sequence is regulated by an exogenous regulatory element, preferably, the exogenous regulatory element is the human SIGLEC6 promoter, 5'UTR and / or 3'UTR; preferably, wherein the exogenous regulatory element comprises at least 50 bp or at least 308 bp of continuous nucleotides downstream of the 3'UTR of the exon of the human SIGLEC6 gene; preferably, wherein the exogenous regulatory element comprises at least 50 bp or at least 20400 bp of continuous nucleotides upstream of the 5'UTR of the exon of the human SIGLEC6 gene.

6. The method according to any one of claims 1-5, wherein the exogenous polynucleotide sequence replaces the endogenous SIGLEC6 gene of a non-human animal.

7. The method according to claim 6, wherein the exogenous polynucleotide sequence is regulated by endogenous regulatory elements of non-human animals.

8. The method according to any one of claims 1-7, wherein the genome of the non-human animal further comprises a second exogenous polynucleotide sequence encoding a second human or chimeric protein; preferably, wherein the second human or chimeric protein is selected from CD3E, CD3D, CD3G, KIT, KITLG, LAG3, 4-1BB, CD40, TIGIT, CD27, CD28, B7H3, OX40, PD-1, PD-L1, and CTLA4.

9. The method according to any one of claims 1-8, wherein the non-human animal is a mammal, preferably a monkey or a rodent, and more preferably a mouse or a rat.

10. A non-human animal cell, the genome of which contains an exogenous polynucleotide sequence encoding a human or chimeric SIGLEC6 protein.

11. The non-human animal cell according to claim 10, wherein the human or chimeric SIGLEC6 protein has at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity with the amino acid sequence (SEQ ID NO: 1) of the human SIGLEC6 protein; preferably, wherein the exogenous polynucleotide sequence encodes the human SIGLEC6 protein; more preferably, wherein the amino acid sequence of the human SIGLEC6 protein is SEQ ID NO:

1.

12. The non-human animal cell of claim 10, wherein the exogenous polynucleotide sequence comprises all or part of exons 1 to 8 of the human SIGLEC6 gene; preferably, wherein the exogenous polynucleotide sequence has at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity with the polynucleotide sequence shown at positions 51517511-51552070 of the gene accession number NC_000019.10; more preferably, wherein the exogenous polynucleotide sequence is the polynucleotide sequence shown at positions 51517511-51552070 of the gene accession number NC_000019.

10.

13. The non-human animal cell according to any one of claims 10-12, wherein the exogenous polynucleotide sequence is inserted into an endogenous safety site in the genome of the non-human animal; preferably, the endogenous safety site is the ROSA26 gene site or the Hipp11 gene site; more preferably, the endogenous safety site is the Hipp11 gene site.

14. The non-human animal cell according to claim 13, wherein the exogenous polynucleotide sequence is regulated by an exogenous regulatory element; preferably, the exogenous regulatory element is the human SIGLEC6 promoter, 5'UTR, and / or 3'UTR; more preferably, wherein the exogenous regulatory element comprises at least 50 bp or at least 308 bp of continuous nucleotides downstream of the 3'UTR of the exon of the human SIGLEC6 gene; even more preferably, wherein the exogenous regulatory element comprises at least 50 bp or at least 20400 bp of continuous nucleotides upstream of the 5'UTR of the exon of the human SIGLEC6 gene.

15. A non-human animal genome, said non-human animal genome comprising an exogenous polynucleotide sequence encoding a human or chimeric SIGLEC6 protein.

16. The non-human animal genome according to claim 15, wherein the human or chimeric SIGLEC6 protein has at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity with the amino acid sequence (SEQ ID NO: 1) of the human SIGLEC6 protein; preferably, wherein the exogenous polynucleotide sequence encodes the human SIGLEC6 protein; more preferably, wherein the amino acid sequence of the human SIGLEC6 protein is SEQ ID NO:

1.

17. The non-human animal genome of claim 15, wherein the exogenous polynucleotide sequence comprises all or part of exons 1 to 8 of the human SIGLEC6 gene; preferably, wherein the exogenous polynucleotide sequence has at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity with the polynucleotide sequence shown at positions 51517511-51552070 of the gene accession number NC_000019.10; more preferably, wherein the exogenous polynucleotide sequence is the polynucleotide sequence shown at positions 51517511-51552070 of the gene accession number NC_000019.

10.

18. The non-human animal genome according to any one of claims 15-17, wherein the exogenous polynucleotide sequence is inserted into an endogenous safety site in the genome of the non-human animal; preferably, the endogenous safety site is the ROSA26 gene site or the Hipp11 gene site; more preferably, the endogenous safety site is the Hipp11 gene site.

19. The non-human animal genome according to claim 18, wherein the exogenous polynucleotide sequence is regulated by an exogenous regulatory element; preferably, the exogenous regulatory element is the human SIGLEC6 promoter, 5'UTR, and / or 3'UTR; more preferably, wherein the exogenous regulatory element comprises at least 50 bp or at least 308 bp of continuous nucleotides downstream of the 3'UTR of the exon of the human SIGLEC6 gene; even more preferably, wherein the exogenous regulatory element comprises at least 50 bp or at least 20400 bp of continuous nucleotides upstream of the 5'UTR of the exon of the human SIGLEC6 gene.

20. A method for determining the efficacy of a human SIGLEC6-targeted therapeutic agent in treating a disease, the method comprising: 1) Administering the targeted human SIGLEC6 therapeutic agent to a non-human animal produced by the method according to any one of claims 1-9, wherein the non-human animal has the disease; and 2) Evaluate the therapeutic effect of the therapeutic agent on the disease.

21. The method according to claim 20, wherein the disease is cancer; preferably, the cancer is a solid tumor or a hematologic malignancy; more preferably, the solid tumor is colorectal cancer, bladder cancer, head and neck cancer, liver cancer or lung cancer; and even more preferably, the hematologic malignancy is chronic lymphocytic leukemia and acute myeloid leukemia.

22. The method of claim 21, wherein the non-human animal comprises tumor cells injected into the non-human animal; preferably, wherein the evaluation includes measuring the tumor volume in the non-human animal.

23. The method of claim 20, wherein the disease is an immune disease; preferably, the immune disease is an allergy, chronic urticaria, atopic dermatitis, osteoarthritis, asthma, rheumatoid arthritis, multiple sclerosis, psoriasis, chronic obstructive pulmonary disease, or inflammatory bowel disease (IBD).

24. The method according to any one of claims 22-23, wherein the human SIGLEC6-targeting therapeutic agent is an antibody or peptide drug; preferably, the human SIGLEC6-targeting therapeutic agent is an anti-human SIGLEC6 antibody.

25. The method of claim 20, further comprising administering a second therapeutic agent to the non-human animal; preferably, the non-human animal further comprises an exogenous polynucleotide sequence encoding human or chimeric PD-1, human or chimeric PD-L1 and / or human or chimeric CTLA4, and wherein the second therapeutic agent is an anti-human PD-1 antibody, an anti-human PD-L1 antibody or an anti-human CTLA4 antibody.

Images