Preparation and application of a universal mRNA vaccine for H5N1 influenza

Abstract

This invention discloses the preparation and application of a universal mRNA vaccine for H5N1 influenza. The mRNA vaccine contains mRNA molecule 1 and mRNA molecule 2; mRNA molecule 1 encodes the H5m protein; mRNA molecule 2 encodes the N1m protein; the H5m protein is the protein shown in SEQ ID NO:1; the N1m protein is the protein shown in SEQ ID NO:2. The universal mRNA vaccine for H5N1 influenza prepared by this invention possesses broad-spectrum protection, rapid iteration, and low-cost mass production characteristics. It can efficiently express native conformational proteins in host cells, not only covering the main variation spectrum of the H5N1 virus, but also overcoming the broad-spectrum limitations of traditional vaccines by activating cross-neutralizing antibodies and polyclonal T-cell immunity. This invention provides key technical support for addressing the continuous evolution and potential pandemic of H5N1.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to the preparation and application of a universal mRNA vaccine for H5N1 influenza. Background Technology

[0002] The highly pathogenic avian influenza virus H5N1 has become a major threat to global public health security due to its high mortality rate (approximately 50%-60%), risk of cross-species transmission, and rapid evolution. Since its first infection in humans in 1997, H5N1 has caused nearly a thousand human infections, with a mortality rate far exceeding that of seasonal influenza. Surveillance data from 2024 showed that the novel D1.1 genotype strain was widely circulating in mammals (such as cows and pigs), and its mammalian adaptive mutations in the HA protein significantly enhanced the virus's ability to infect the human respiratory tract. More seriously, the accelerated cross-host transmission of the H5N1 virus between birds and mammals increases the risk of genetic recombination, potentially giving rise to new strains with both high mortality and human-to-human transmission capabilities. The existing prevention and control system has significant shortcomings: 1. Insufficient broad-spectrum protection: Traditional chicken embryo inactivated vaccines rely on a single viral strain HA antigen, with cross-protective efficacy of less than 30% against rapidly mutating H5N1 strains (such as 2.3.4.4b), and cannot cover high-frequency mutation regions, thus failing to effectively activate immune responses in the elderly and immunocompromised populations; 2. Delayed production response: Traditional vaccine production cycles are as long as 6 months, making it difficult to cope with the rapid spread of newly emerging variant strains; 3. Limited immune response: While existing mRNA vaccines can rapidly encode HA antigens, they only target a single conformational epitope of the circulating strain, failing to activate cross-neutralizing antibodies against heterologous strains and polyclonal T-cell immunity. Therefore, there is an urgent need to develop a broad-spectrum and highly effective H5N1 influenza vaccine.

[0003] Novel vaccine technologies based on the Mosaic antigen design strategy offer a breakthrough in addressing the high variability of influenza viruses. This technology involves constructing homologous protein libraries and conducting multiple rounds of recombination comparisons to screen for representative recombinant antigens covering the maximum variation spectrum of short peptides (9-12 amino acids) in natural proteins. By excluding non-natural and rare "k-mers," these antigens maximize the retention of key conserved epitopes, significantly enhancing the vaccine's cross-neutralizing ability against heterologous strains. While the Mosaic strategy has demonstrated broad-spectrum potential in HIV vaccine development, its application in influenza is limited by bottlenecks such as low recombinant protein expression efficiency and insufficient immunogenicity. For example, mammalian cell expression systems are costly and have limited protein folding efficiency, making it difficult to scale up the production of Mosaic-designed recombinant protein influenza vaccines; simultaneously, single-protein antigens cannot simultaneously activate high-titer neutralizing antibodies and durable T-cell immune responses.

[0004] Meanwhile, mRNA vaccine technology has rapidly developed due to its successful application in the COVID-19 pandemic. Compared with traditional vaccines, mRNA technology has three core advantages: First, it can complete the rational design and optimization of antigen-coding sequences within weeks, rapidly responding to viral mutations; second, mRNA delivered via lipid nanoparticles (LNPs) can efficiently express natural conformational antigens in host cells, accurately presenting key conformational epitopes; and third, it can flexibly encode multiple sets of conserved epitopes through the co-delivery of multivalent mRNAs, overcoming the antigen capacity limitations of traditional vaccines. However, existing influenza mRNA vaccines mostly focus on the hemagglutinin (HA) antigen of a single circulating strain. Although they can induce strain-specific immunity, their broad-spectrum protection against highly variable viruses such as H5N1 remains insufficient. Summary of the Invention

[0005] The purpose of this invention is to provide a universal mRNA vaccine for H5N1 influenza and its application.

[0006] To achieve the above objectives, the present invention first provides a universal mRNA vaccine for H5N1 influenza.

[0007] The universal mRNA vaccine for H5N1 influenza provided by this invention contains mRNA molecule 1 and mRNA molecule 2;

[0008] The mRNA molecule 1 contains an mRNA sequence encoding the H5m protein: The mRNA molecule 2 contains an mRNA sequence encoding the N1m protein: The H5m protein is any one of the following (A1)-A4): A1) The amino acid sequence is that of the protein shown in SEQ ID NO:1; A2) A fusion protein with the same function obtained by attaching a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID NO:1; A3) Proteins with the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO:1. A4) Proteins that have 80% or more of the same amino acid sequence as SEQ ID NO:1 and have the same function; The N1m protein is any one of the following B1)-B4): B1) The amino acid sequence is that of the protein shown in SEQ ID NO:2; B2) A fusion protein with the same function obtained by attaching a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID NO:2; B3) Proteins with the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO:2. B4) is a protein that has 80% or more of the same amino acid sequence as the one shown in SEQ ID NO:2 and has the same function.

[0009] In the proteins described in A2) or B2) above, the tag refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The tag includes, but is not limited to: GST (glutathione thiotransferase) tag protein, His6 tag protein (His-tag), MBP (maltose-binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomer red fluorescent protein), or AviTag tag protein.

[0010] In the protein described in A3) or B3) above, the substitution and / or deletion and / or addition of one or more amino acid residues is no more than 10 or 9 or 8 or 7 or 6 or 5 or 4 or 3 or 2 or 1 amino acid residues.

[0011] In the proteins described in A4) or B4) above, the identity refers to the identity of the amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences, the identity value (%) can then be obtained. The identity includes amino acid sequences that have 80% or higher, or 85% or higher, or 90% or higher, or 91% or higher, or 92% or higher, or 93% or higher, or 94% or higher, or 95% or higher, or 96% or higher, or 97% or higher, or 98% or higher, or 99% or higher identity with the amino acid sequences shown in SEQ ID NO:1 or SEQ ID NO:2 of the present invention.

[0012] The proteins described in A1), A2), A3), A4), B1), B2), B3), or B4) above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0013] Furthermore, the gene sequence encoding the H5m protein is any one of the following: E1) The DNA molecule shown in positions 86-1789 of SEQ ID NO:3; The nucleotide sequence defined by E2) has 75% or more identity with E1) and is a DNA molecule encoding the H5m protein.

[0014] The gene sequence encoding the N1m protein is any one of the following: F1) The DNA molecule shown in positions 86-1495 of SEQ ID NO:4; The nucleotide sequence defined by F2) has 75% or more identity with F1) and is a DNA molecule encoding the N1m protein.

[0015] Those skilled in the art can readily mutate the nucleotide sequences encoding the H5m or N1m protein of this invention using known methods, such as directed evolution and point mutation. Artificially modified nucleotides having 75% or higher identity with the H5m or N1m nucleotide sequences of this invention, provided they encode the H5m or N1m protein and have the same function, are derived from and equivalent to the sequences of this invention. This identity refers to sequence similarity to natural or artificial nucleic acid sequences, including nucleotide sequences having 75% or higher, 80% or higher, 85% or higher, 90% or higher, or 95% or higher identity with the nucleotide sequences encoding the amino acid sequences shown in SEQ ID NO:1 or SEQ ID NO:2 of this invention. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0016] Furthermore, the mRNA molecule 1 comprises, from the 5' end to the 3' end, a 5' cap structure, a 5' UTR sequence, an mRNA sequence encoding the H5m protein, a kozak sequence, a 3' UTR sequence, and a PolyA sequence, in sequence. The mRNA molecule 2 includes, from the 5' end to the 3' end, a 5' cap structure, a 5' UTR sequence, an mRNA sequence encoding the N1m protein, a kozak sequence, a 3' UTR sequence, and a PolyA sequence.

[0017] In some implementations, the 5' end cap structure is a Cap1 structure.

[0018] In some implementations, the 5'UTR sequence is as shown in bits 1-50 of SEQ ID NO:7.

[0019] In some implementations, the 3'UTR sequence is as shown in bits 1776-1885 of SEQ ID NO:7.

[0020] In some implementations, the PolyA sequence is shown as bits 1886-2007 of SEQ ID NO:7.

[0021] In some embodiments, the full sequence of the mRNA molecule 1 is shown in SEQ ID NO:7.

[0022] In some embodiments, the full sequence of the mRNA molecule 2 is shown in SEQ ID NO:8.

[0023] Furthermore, the H5N1 influenza mRNA vaccine contains mRNA molecule 1 encapsulated in liposome nanoparticles and mRNA molecule 2 encapsulated in liposome nanoparticles.

[0024] In some embodiments, the liposome nanoparticles comprise ionized lipids, cofactor lipids, cholesterol, and PEG lipids.

[0025] In some embodiments, the mass ratio of mRNA molecule 1 to mRNA molecule 2 in the H5N1 influenza mRNA vaccine is 1:1.

[0026] To achieve the above objectives, the present invention also provides any of the following substances: M1) protein, wherein the protein is the H5m protein or the N1m protein described above; M2) is a nucleic acid molecule that encodes the protein described in M1; M3) contains an expression cassette containing the nucleic acid molecule described in M2; M4) A recombinant vector containing the nucleic acid molecule described in M2) or the expression cassette described in M3); M5) A recombinant microorganism containing the nucleic acid molecule described in M2), the expression cassette described in M3), or the recombinant vector described in M4; M6) A set of mRNA molecules, wherein the set of mRNA molecules includes the above-mentioned mRNA molecule 1 and the above-mentioned mRNA molecule 2; M7) Liposome nanoparticles loaded with the set of mRNA molecules described in M6); M8) mRNA molecule, wherein the mRNA molecule is either mRNA molecule 1 or mRNA molecule 2 described above; M9) Liposome nanoparticles loaded with the mRNA molecules described in M8); M10) H5N1 influenza virus infection prevention and treatment preparation, wherein the effective active ingredient of the H5N1 influenza virus infection prevention and treatment preparation contains the complete set of mRNA molecules described in M6) or the liposome nanoparticles described in M7) or the mRNA molecules described in M8) or the liposome nanoparticles described in M9).

[0027] In the above M2), the nucleic acid molecule can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.

[0028] In some embodiments, the nucleic acid molecule is a DNA molecule that is SEQ ID NO:3 at positions 86-1789 or has 75% or more identity with positions 86-1789 of SEQ ID NO:3 and encodes the H5m protein.

[0029] In some embodiments, the nucleic acid molecule is a DNA molecule that is SEQ ID NO:4 at positions 86-1495 or has 75% or more identity with positions 86-1495 of SEQ ID NO:4 and encodes the N1m protein.

[0030] In the above M3), the expression cassette refers to DNA capable of expressing the H5m protein or N1m protein in a host cell. This DNA may include not only a promoter to initiate transcription of the H5m protein or N1m protein, but also a terminator to terminate transcription of the H5m protein or N1m protein. In some embodiments, the expression cassette may further include an enhancer sequence.

[0031] In the above M4), the vector can be a plasmid, granule, bacteriophage, or viral vector. The recombinant vector can be a vector containing the above-mentioned nucleic acid molecule or expression cassette constructed using existing expression vectors. In some embodiments, the recombinant vector is a vector obtained by ligating the DNA molecule shown in SEQ ID NO:3 or SEQ ID NO:4 into the pUC57-Kan vector.

[0032] In the above M5), the cell can be a prokaryotic cell or a eukaryotic cell.

[0033] In the above M7), the delivery system can be any system known to those skilled in the art for the purpose of mRNA molecule delivery, including but not limited to lipid nanoparticle delivery systems, virus-like particle delivery systems, polymer-based delivery systems, peptide-based delivery systems, etc. In some embodiments, the delivery system is a lipid nanoparticle delivery system.

[0034] When preparing the H5N1 influenza universal mRNA vaccine, diluents, solubilizers, buffers, pH adjusters, and other excipients, such as physiological saline, may also be added.

[0035] The H5N1 influenza universal mRNA vaccine can be administered by injection, including subcutaneous injection, intravenous injection, intramuscular injection and intracavitary injection, or by respiratory administration, including nasal spray and oral inhalation.

[0036] When using the universal mRNA vaccine for the prevention and / or treatment of H5N1 influenza virus infection, the subject is given an effective amount of the universal mRNA vaccine for the H5N1 influenza virus.

[0037] To achieve the above objectives, the present invention provides any of the following applications: N1) The use of any of the substances described in M1)-M9) above in the preparation of the above-mentioned universal mRNA vaccine for H5N1 influenza; N2) The use of the above-mentioned universal mRNA vaccine for H5N1 influenza or the above-mentioned substances in the preparation of products for the treatment and / or prevention of H5N1 influenza virus infection; N3) The use of the above-mentioned universal mRNA vaccine for H5N1 influenza or the above-mentioned substances in the preparation of products for neutralizing H5N1 influenza virus; N4) The application of the above-mentioned universal mRNA vaccine for H5N1 influenza or the above-mentioned substances in the preparation of H5N1 influenza virus antibodies.

[0038] The H5N1 influenza virus mentioned above may be at least one of the following strains: A / Environment / Hubei / 950 / 2013, A / Jiangsu / NJ210 / 2023, A / American wigeon / South Carolina / 22-000345, A / Hubei / 29578 / 2016, A / Fujian-Sanyuan / 21099 / 2017, A / Guangdong / 18sf020 / 2018, A / Hunan / 09911 / 2021, A / Sichuan / 06681 / 2021, A / Astrakhan / 3212 / 2020, A / Anhui / 01 / 2005.

[0039] Any of the products mentioned above may be vaccines or drugs.

[0040] This invention provides a universal mRNA vaccine for H5N1 influenza based on a Mosaic antigen design strategy and its preparation method, overcoming existing technological bottlenecks through the following innovations: 1. Mosaic-HA antigen design: Using computer-aided algorithms, highly conserved epitopes (such as fusion peptide regions and stem regions) and frequently variable regions (such as antigenic determinants) of the H5N1 virus HA and NA proteins are screened. Chimeric HA antigen sequences are constructed through multiple rounds of recombination and alignment, covering more than 90% of the "k-mer" short peptide profiles of circulating strains, maximizing cross-protection potential; 2. Efficient mRNA delivery: The optimized mosaic HA antigen coding sequence is encapsulated into an mRNA vaccine using lipid nanoparticles (LNPs), utilizing direct expression of natural conformational antigens in host cells, preserving key conformational epitopes, and avoiding the folding defects of traditional protein vaccines; 3. Multidimensional immune activation: Through the presentation of multiple epitopes of the mosaic HA antigen, B cell responses against conserved regions (broad-spectrum neutralizing antibodies) and variable regions (strain-specific antibodies) are simultaneously activated, and CD4+ targeting multiple domains of the HA protein is induced. + / CD8 + 4. Rapid iteration capability: Based on the modular design of the mRNA platform, the integration of new variant antigen sequences and vaccine updates can be completed within 4-6 weeks, which is significantly better than the 6-month production cycle of traditional vaccines.

[0041] This invention utilizes computer-aided design to screen highly conserved epitopes and frequently mutated regions of the H5N1 virus, designing a broad-spectrum antigen based on a Mosaic strategy. The antigen is then rapidly encoded and delivered using an mRNA platform. The resulting universal mRNA vaccine for H5N1 influenza achieves efficient expression of natural conformation proteins within host cells. This not only covers the major mutation spectrum of the H5N1 virus but also overcomes the broad-spectrum limitations of traditional vaccines by activating cross-neutralizing antibodies and polyclonal T-cell immunity, providing crucial technical support for addressing the ongoing evolution and potential pandemic of H5N1.

[0042] The beneficial effects of this invention are as follows: The universal H5N1 influenza vaccine developed by integrating the Mosaic antigen design strategy with mRNA technology exhibits significant advantages. Specifically, these advantages are: First, in terms of broad-spectrum protection, the chimeric HA antigen broadly covers the T lymphocyte epitopes of the H5N1 influenza virus HA and NA proteins, and animal experiments show that it has cross-protective efficacy against candidate vaccine strains of branches 2.3.4.4b, 2.3.4.4d, and 2.3.4.4h. Second, in terms of production efficiency, mRNA technology shortens the vaccine development cycle to 4-6 weeks and eliminates the need for chicken embryo culture or complex protein purification processes, enabling rapid response to emerging variants. Furthermore, the LNP delivery system ensures the natural conformational expression of the antigen, avoiding the folding defects of traditional recombinant proteins. In summary, the universal H5N1 influenza mRNA vaccine prepared by this invention combines broad-spectrum protection, rapid iteration, and low-cost mass production, providing a breakthrough solution for controlling the cross-species transmission and potential pandemic of the H5N1 virus. Attached Figure Description

[0043] Figure 1 This is an electrophoretic identification image of the original recombinant plasmid and the plasmid after enzyme digestion. In the image, 1 represents the Vietnam-HA plasmid, 2 represents the Vietnam-HA plasmid digestion product, 3 represents the Vietnam-NA plasmid, 4 represents the Vietnam-NA plasmid digestion product, 5 represents the H5m plasmid, 6 represents the H5m plasmid digestion product, 7 represents the N1m plasmid, 8 represents the N1m plasmid digestion product, 9 represents the 5Kb marker, and 10 represents the 10Kb marker.

[0044] Figure 2 Electrophoretic identification of the polyA tail retention of recombinant plasmids. In the image, 1 represents the Vietnam-HA plasmid, 2 represents the Vietnam-NA plasmid, 3 represents the H5m plasmid, 4 represents the N1m plasmid, 5 represents the negative control, and 6 represents the 5Kb marker.

[0045] Figure 3 Electrophoretic identification diagram of mRNA prepared by in vitro transcription. In the diagram, 1 represents the Vietnam-HA plasmid, 2 represents the Vietnam-NA plasmid, 3 represents the H5m plasmid, 4 represents the N1m plasmid, and 5 represents the mRNA ladder.

[0046] Figure 4 The content of mRNA and dsRNA prepared by in vitro transcription.

[0047] Figure 5 This is a safety assessment of mice immunized with an mRNA vaccine.

[0048] Figure 6 This is the result of detecting hemagglutination inhibition antibodies in mouse serum.

[0049] Figure 7 This shows the detection results of trace neutralizing antibodies in mouse serum.

[0050] Figure 8 This describes the secretion of cytokines by T lymphocytes in the spleen of mice. Detailed Implementation

[0051] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0052] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0053] The strains A / Environment / Hubei / 950 / 2013 in the following examples have the following GISAID IDs: A / Environment / Hubei / 950 / 2013 (EPI_ISL_180754), A / Jiangsu / NJ210 / 2023 (EPI_ISL_17075759), A / Americanwigeon / South Carolina / 22-000345 (EPI_ISL_18133029), A / Hubei / 29578 / 2016 (EPI_ISL_256213), and A / Fujian-Sanyuan / 21099 / 2017 (EPI_ISL_180754). The IDs of ISL_304404, A / Guangdong / 18sf020 / 2018 in GISAID are EPI_ISL_337274, A / Hunan / 09911 / 2021 in GISAID is EPI_ISL_4568643, and A / Astrakhan / 3212 / 2020 in GISAID is EPI_ISL_1038924.

[0054] The strain A / Sichuan / 06681 / 2021 used in the following examples is described in the literature " ao C, Xu J, Lan Y,et al. Five independent cases of human infection with avian influenza H5N6—Sichuan Province, China, 2021[J]. China CDC Weekly, 2021, 3(36): 751."

[0055] The strain A / Anhui / 01 / 2005 in the following examples is described in the literature “Shu Y, Yu H, Li D. Lethalavian influenza A (H5N1) infection in a pregnant woman in Anhui Province, China[J]. New England journal of medicine, 2006, 354(13): 1421-1422.” (DOI:10.1056 / nejmc053524).

[0056] Example 1: Obtaining the mosaic sequence I. Design, optimization, and screening of mosaic sequences 1. Download the amino acid sequences of all H5N1 HA and NA amino acids using the GISAID and NCBI databases. There are 18,792 HA amino acid sequences and 19,615 NA amino acid sequences.

[0057] 2. Using computer algorithms and software, repetitive sequences and sequences with poor sequencing quality were removed, resulting in 5284 HA amino acid sequences and 5582 NA amino acid sequences.

[0058] 3. Upload the processed amino acid sequence in FAS format to the Mosaic Vaccine Designer program, and set the following parameters: Cocktail Size to "1" to obtain one mosaic sequence for the next step; Epitope Length to "9" to obtain a wider coverage of CD8. +Mosaic sequences of T (Cytotoxic T lymphocytes, CTL) cell epitopes were obtained. A threshold of "3" was set to reduce the number of rare epitopes that occur infrequently in natural epitopes. After processing with a genetic algorithm, a series of short peptide assemblies consisting of 9 amino acids were finally obtained. Subsequently, the genetic algorithm was used to optimize each population sequentially, generating new recombinants and calculating their antigenic epitope coverage. After antigenic epitope prediction, genetic evolution analysis, and spatial conformation analysis, two optimal molecular amino acid sequences were finally obtained, named H5m protein and N1m protein, respectively. The amino acid sequence of H5m protein is shown in SEQ ID NO:1, and the amino acid sequence of N1m protein is shown in SEQ ID NO:2.

[0059] II. Synthesis of Mosaic Sequences Based on mammalian codon optimization, the coding gene sequences for H5m and N1m were obtained through gene synthesis technology. The coding gene sequence for the H5m protein is shown in positions 86-1789 of SEQ ID NO:3, and the coding gene sequence for the N1m protein is shown in positions 86-1495 of SEQ ID NO:4.

[0060] In addition, the HA and NA proteins of the WHO-recommended H5N1 vaccine candidate strain A / duck / Vietnam / NCVD-1584 / 2012 were synthesized as contrast antigens and named Vietnam-HA protein and Vietnam-NA protein, respectively. The coding gene sequence of the Vietnam-HA protein is shown in positions 86-1780 of SEQ ID NO:5, and the coding gene sequence of the Vietnam-NA protein is shown in positions 86-1435 of SEQ ID NO:6.

[0061] Example 2: Preparation of H5N1 mRNA vaccine I. Construction of Recombinant Plasmids 1. Add the following sequences before the 5' end of the coding genes for H5m, N1m, Vietnam-HA, and Vietnam-NA proteins, respectively: TAATACGACTCACTATAAGG GGCAAATAATAGAAATAATAATTATTAACACAATTAAACACAACGTAACC The sequence CTCGAGGCCGCCACC consists of the following sequences: positions 1-20 are the T7 Promoter sequence, positions 21-70 are the 5' UTR sequence, positions 71-76 are the XhoI restriction site, and positions 77-85 are the kozak sequence. Furthermore, the following sequence is appended to the 3' end of the genes encoding the H5m, N1m, Vietnam-HA, and Vietnam-NA proteins: ACGCGT GCTGGAGCCTCGGTGGCCTAGCTTCTTGCCCCTTGGGCCTCCCCC CAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGAGTGGGCGGCAAA ...

[0062] 2. The T7-5'UTR-kozak-H5m-3'UTR-PolyA (SEQ ID NO:3), T7-5'UTR-kozak-N1m-3'UTR-PolyA (SEQ ID NO:4), T7-5'UTR-kozak-Vietnam-HA-3'UTR-PolyA (SEQ ID NO:5), and T7-5'UTR-kozak-Vietnam-NA-3'UTR-PolyA (SEQ ID NO:6) from step 1 were respectively ligated into the pUC57-Kan vector (the nucleotide sequence of the pUC57-Kan vector is as shown in SEQ ID NO:6). As shown in NO:9, ligation products were obtained. After transformation and identification of stable supercompetent cells (Beyotime, D1077), recombinant plasmids H5m containing T7-5'UTR-kozak-H5m-3'UTR-PolyA, N1m containing T7-5'UTR-kozak-N1m-3'UTR-PolyA, Vietnam-HA containing T7-5'UTR-kozak-Vietnam-HA-3'UTR-PolyA, and Vietnam-NA containing T7-5'UTR-kozak-Vietnam-NA-3'UTR-PolyA were obtained.

[0063] 3. The recombinant plasmids obtained in step 2 were digested with BspQⅠ to prepare linearized plasmids. The original plasmids and the digested linearized plasmids were then simultaneously detected by nucleic acid gel electrophoresis. The results are shown below. Figure 1 As shown.

[0064] 4. The polyA tail retention of the recombinant plasmid obtained in step 2 was verified by PCR using primers (forward primer: cggtggcctagcttcttg; reverse primer: ctcactgcccgctttcca). The results are as follows: Figure 2 As shown.

[0065] II. In vitro transcription 1. Purify the linearized template obtained in step 3 using DNA magnetic beads. The specific steps are as follows: After equilibrating the magnetic beads to room temperature and inverting to mix, add 250 μL of the magnetic bead solution to 500 μL of DNA sample (linearized template). Gently pipette 10 times to mix thoroughly. Incubate at room temperature for 10 min, then place the sample on a magnetic rack. Remove the supernatant after 10 min. Add 1 mL of freshly prepared 80% ethanol to rinse the magnetic beads, incubate at room temperature for 30 sec, and then remove the supernatant. Repeat the rinsing once, remove the supernatant, and dry the magnetic beads at room temperature for about 10 min. Add 300 μL of nuclease-free water, mix thoroughly by pipetting, let stand at room temperature for 2 min, then place on a magnetic rack for 5 min. After the solution becomes clear, transfer the supernatant to a new centrifuge tube, detect the concentration of the purified linearized template, and store in aliquots at -20℃.

[0066] 2. Following the matching directions shown in Table 1, the purified template obtained in step 1 was added with the respective reagents for in vitro transcription (IVT). After reacting at 37°C for 4.5 h, 4 μL of DNase I was added and reacted at 37°C for another 1 h to obtain IVT-mRNA.

[0067] The in vitro transcription system was as follows: T7 RNA Polymerase (VAZYME, DD4101-PC-01) 8 μl, Transcriberation Buffer (10x) (SYNTHGENE, 10302) 8 μl, Pyrophosphatase (VAZYME, DD4103-PC-01) 4 μl, RNase Inhibitor (VAZYME, DD4102-PA-01) 4 μl, 1N-Me-Pseudo-UTP·3Na (VAZYME, DD4114-PA-01) 6.5 μl, ATP·3Na (HONGENE biotech, R1331) 6.5 μl, CTP·3Na (VAZYME, DD4107-PA-01) 6.5 μl, GTP·3Na (VAZYME, DD4108-PA-01) 6.5 μl, Cap Analogs (SYNTHGENE, CAP-3111) 9 μl, linearized plasmid 3.5 µL, RNase-free ddH2O (Servicebio, G4700-500ML) 98.5 µL.

[0068] Linearized recombinant plasmid H5m was transcribed in vitro to obtain H5m mRNA, which consists of a 5' cap structure, a 5' UTR sequence, a kozak sequence, an mRNA sequence encoding the H5m protein, a 3' UTR sequence, and a PolyA sequence.

[0069] Linearized recombinant plasmid N1m was transcribed in vitro to obtain N1m mRNA, which consists of a 5' cap structure, a 5' UTR sequence, a kozak sequence, an mRNA sequence encoding the N1m protein, a 3' UTR sequence, and a PolyA sequence.

[0070] The linearized recombinant plasmid Vietnam-HA was transcribed in vitro to obtain Vietnam-HA mRNA, which consists of a 5' cap structure, a 5' UTR sequence, a kozak sequence, an mRNA sequence encoding the Vietnam-HA protein, a 3' UTR sequence, and a PolyA sequence.

[0071] The linearized recombinant plasmid Vietnam-NA was transcribed in vitro to obtain Vietnam-NA mRNA, which consists of a 5' cap structure, a 5' UTR sequence, a kozak sequence, an mRNA sequence encoding the Vietnam-NA protein, a 3' UTR sequence, and a PolyA sequence.

[0072] 3. Purify the IVT-mRNAs obtained in step 2 using RNA magnetic beads. The specific steps are as follows: After equilibrating the magnetic beads to room temperature and inverting to mix, add 288 μL of the magnetic bead solution to the RNA sample and gently pipette 10 times to mix thoroughly. Incubate at room temperature for 10 min, then place the sample on a magnetic rack and remove the supernatant after 10 min. Add 1 mL of freshly prepared 80% ethanol to rinse the magnetic beads, incubate at room temperature for 30 sec, and remove the supernatant. Repeat the rinsing once, remove the supernatant, and dry the magnetic beads at room temperature for about 10 min. Add 300 μL of nuclease-free water, mix thoroughly by pipetting, let stand at room temperature for 2 min, then place on a magnetic rack for 5 min. After the solution becomes clear, transfer the supernatant to a new centrifuge tube, detect the concentration of the purified IVT-mRNA, and store in aliquots at -80℃.

[0073] 4. Nucleic acid gel electrophoresis was used to verify the quality of the purified IVT-mRNA obtained in step 3. The results are as follows: Figure 3 As shown.

[0074] 5. The purified IVT-mRNA obtained in step 3 was used to detect dsRNA content. The specific steps are as follows: First, add the test sample and standard (100 μL / well) to the pretreated microplate and incubate at 500 rpm for 1 hour at room temperature; discard the solution and wash the microplate 5 times with 1×Wash Buffer (250 μL / well) and blot dry; then add biotin-labeled antibody (100 μL / well), incubate at 500 rpm for 1 hour at room temperature, and wash and blot dry again; then add SA-HRP complex (100 μL / well), incubate at 500 rpm for 30 minutes at room temperature, and wash and blot dry; then add TMB substrate (100 μL / well), and incubate in the dark for 30 minutes for color development; finally, add stop solution (50 μL / well), and immediately measure the OD450 nm / 650 nm absorbance after stopping the reaction. The dsRNA content is as follows: Figure 4 As shown.

[0075] III. Preparation of LNP-mRNA Complex 1. Solution preparation Ionizable lipids (E12-1), DSPC, cholesterol (Chol), and DMG-PEG2000 were dissolved in anhydrous ethanol at a molar ratio of 50:10:38.5:1.5 to obtain a lipid solution, which served as the organic phase. Simultaneously, mRNA was dissolved in 100 mM PBS buffer (pH 5.0) to obtain an mRNA solution, which served as the aqueous phase.

[0076] 2. LNP preparation The lipid solution and mRNA solution obtained in step 1 were mixed at a flow rate ratio of 1:3 using a microfluidic device to obtain the initial LNP formulation. The mass ratio of ionizable lipids to mRNA was controlled at 10:1, and the total flow rate was 60 mL / min.

[0077] 3. Ultrafiltration The initial LNP formulation was subjected to equal-volume ultrafiltration in a 10mM Tris-HCl buffer (pH 7.4) containing 8% sucrose to complete solvent replacement, yielding the LNP-mRNA drug. The ultrafiltration process parameters were as follows: membrane pore size 100 kDa, ultrafiltration pressure ≤0.2 MPa.

[0078] Using the above methods, corresponding LNP-mRNA drugs were prepared using different mRNAs.

[0079] The lipid solution and the H5m mRNA solution are mixed to form the LNP-mRNA complex H5m.

[0080] The lipid solution and the N1m mRNA solution are mixed to form the LNP-mRNA complex N1m.

[0081] The lipid solution was mixed with the Vietnam-HA mRNA solution to form the LNP-mRNA complex Vietnam-HA.

[0082] The lipid solution was mixed with the Vietnam-NA mRNA solution to form the LNP-mRNA complex Vietnam-NA.

[0083] The lipid solution was mixed with PBS buffer to form the LNP blank group.

[0084] IV. Detection of LNP-mRNA complex 1. Encapsulation efficiency test The mRNA content and encapsulation efficiency of the samples were detected using the Quant-iT™ RiboGreen™ kit (ThermoFisher; R11491), and the results are shown in Table 1.

[0085] 2. Particle size and polydispersity index (PDI) detection The particle size and particle size index (PDI) of the prepared LNP-mRNA were determined using a Malvern laser particle size analyzer. Freshly prepared LNP-mRNA was diluted 10-fold with pure water, and its particle size and PDI were measured using a Malvern laser particle size analyzer. Each sample was measured in triplicate at a temperature of 25℃. The results are shown in Table 1.

[0086] Table 1

[0087] After all indicators passed the tests, the LNP-mRNA complex was aliquoted and temporarily stored at 4℃.

[0088] V. Preparation of H5N1 mRNA Vaccine The mRNA content in the LNP-mRNA complex after LNP encapsulation was detected using the RiboGreen method. The LNP-mRNA complex H5m and LNP-mRNA complex N1m were uniformly mixed at a mass ratio of 1:1 to obtain the H5N1 mRNA vaccine (referred to as mH5N1 vaccine). The LNP-mRNA complex Vietnam-HA and LNP-mRNA complex Vietnam-NA were uniformly mixed at a mass ratio of 1:1 to obtain the Vietnam mRNA vaccine (referred to as Vietnam vaccine).

[0089] Example 3: Detection of the Immunization Efficacy of H5N1 mRNA Vaccine I. Grouping and Immunization Forty 6-8 week old female BALB / c mice (Drug Safety Evaluation Center, Institute of Medical Biology, Chinese Academy of Medical Sciences) were randomly divided into 8 groups. Each group of mice was injected intramuscularly with mH5N1 vaccine at 0 and 3 weeks of age, respectively. Each injection consisted of 80 μL of PBS buffer (pH 7.4) containing 5 μg of mH5N1 vaccine. At the same time, the group injected with an equal amount of Vietnam vaccine served as the immunization control group, and the group injected with PBS buffer (pH 7.4) or LNP blank served as the blank control group.

[0090] II. Vaccine Safety Testing Mice were immunized for the first and second time at weeks 0 and 3, respectively, and their body temperature and weight were recorded for 6 consecutive days to assess vaccine safety. Results are as follows: Figure 5 As shown.

[0091] The results showed that, compared with the PBS group, the LNP, mH5N1 and Vietnam vaccine groups all experienced transient fluctuations in body temperature and weight loss after the initial immunization, which returned to normal on the 2nd and 3rd days after immunization, respectively. After the booster immunization, the fluctuations in body temperature and weight were smaller and the recovery was faster. No other pathological features were observed, indicating that the vaccines were safe.

[0092] III. Hemagglutination inhibition (HAI) test Blood was collected from mice 5 weeks after immunization. After standing overnight at 4°C, serum was obtained by centrifugation at 3000 rpm for 10 min, aliquoted and stored at -80°C for later use. Four-unit antigens (4 HAU) were prepared for strains A / Environment / Hubei / 950 / 2013, A / Jiangsu / NJ210 / 2023, A / American wigeon / South Carolina / 22-000345, A / Hubei / 29578 / 2016, A / Fujian-Sanyuan / 21099 / 2017, A / Guangdong / 18sf020 / 2018, A / Hunan / 09911 / 2021, A / Sichuan / 06681 / 2021, A / Astrakhan / 3212 / 2020, and A / Anhui / 01 / 2005 (all strains were from the National Influenza Center of China). The specific preparation method is as follows: The above viruses were serially diluted, and 50 μL was added to each well of a 96-well V-type microplate, followed by 50 μL of... A 1% chicken erythrocyte suspension was gently shaken and allowed to stand at room temperature for 30 min. The sedimentation pattern of the erythrocytes was observed. The hemagglutination titer of the virus was determined by the highest dilution showing complete agglutination. The HA titer was then divided by 8 to obtain the dilution of 4 hemagglutination units (4 HAU). The virus was diluted according to this ratio, and the hemagglutination test was repeated for verification. If agglutination occurred only in the first 4 wells, it indicated that each 50 μL of virus contained 8 agglutination units (i.e., 4 hemagglutination units in 25 μL). Hemagglutination inhibition was detected in RDE-treated mouse serum using 1% chicken erythrocytes. The RDE-treated serum was serially diluted twofold (1:10 to 1:1280), and 25 μL was added to each well of a 96-well V-type microplate. 25 μL of the above-mentioned 4 HAU virus antigen was added to each well, gently vortexed, and incubated at room temperature for 1 h. 50 μL of 1% chicken erythrocyte suspension was added to each well, gently shaken, and incubated at room temperature for 30 min. The erythrocyte sedimentation pattern was observed, and the reciprocal of the highest serum dilution that completely inhibited agglutination was taken as the HAI titer. Results are as follows: Figure 6 As shown.

[0093] The results showed that, at week 5 post-immunization, the serum of mice immunized with mH5N1 showed some cross-protective effect against all WHO-recommended H5N1 influenza virus candidate vaccine strains (8 / 10), while mice immunized with Vietnam only showed some cross-protective effect against some candidate vaccine strains (4 / 10). At the same time, mice immunized with mH5N1 produced higher levels of hemagglutination inhibitory antibodies against multiple candidate vaccine strains.

[0094] IV. Detection of trace neutralizing antibodies (MN) Blood was collected from mice 5 weeks post-immunization. After standing overnight at 4°C, serum was obtained by centrifugation at 3000 rpm for 10 min, aliquoted, and stored at -80°C for later use. Influenza virus strains A / Jiangsu / NJ210 / 2023, A / American wigeon / SouthCarolina / 22-000345, A / Hubei / 29578 / 2016, A / Fujian-Sanyuan / 21099 / 2017, A / Guangdong / 18sf020 / 2018, A / Hunan / 09911 / 2021, A / Sichuan / 06681 / 2021, A / Astrakhan / 3212 / 2020, and A / Anhui / 01 / 2005 (all strains were obtained from the National Influenza Center of China) were serially diluted 10-fold (10... -1 Up to 10 -8 Each dilution was inoculated into 96-well MDCK cells (from the National Influenza Center of China) and cultured at 37°C and 5% CO2 for 72 h. The supernatant was collected and 50 μL of 1% chicken erythrocyte suspension was added to determine the hemagglutination titer. The Reed-Muench method was used to determine the median infectious dose (TCID50). RDE-treated mouse serum was mixed with an equal volume of 100 TCID50 virus solution and incubated at 37°C for 1 h. The mixture was then inoculated into 96-well MDCK cells and incubated at 37°C for 1 h for adsorption. The culture medium was then replaced with maintenance medium containing TPCK-trypsin and cultured at 37°C and 5% CO2 for 72 h. The supernatant was then added to 50 μL of 1% chicken erythrocyte suspension and incubated at room temperature for 30 min. The hemagglutination reaction was observed, and the highest serum dilution that completely inhibited hemagglutination was taken as the neutralizing titer. The results are as follows: Figure 7 As shown.

[0095] The results showed that at week 5 post-immunization, mice immunized with mH5N1 and Vietnam vaccines produced cross-reactive neutralizing antibodies against some candidate vaccine strains (7 / 9), and mice immunized with mH5N1 produced higher titers of neutralizing antibodies against some candidate vaccine strains.

[0096] V. Detection of cytokines secreted by T lymphocyte clusters Mice were sacrificed 5 weeks post-immunization and transferred to a sterile environment after immersion in 75% ethanol. Single-cell suspensions were prepared from mouse spleens. Cells were stimulated with inactivated and purified A / Anhui / 01 / 2005 virus for 2 h, followed by BFA inhibition for 10 h. Cells were stained with Live / Dead, CD3, CD4, and CD8 dyes for 30 min, fixed, and ruptured before IFN-γ staining for 30 min. T lymphocyte cytokine secretion was detected by flow cytometry. Results are as follows: Figure 8 As shown.

[0097] The results showed that in the 5th week after immunization, mice immunized with mH5N1 and Vietnam vaccines were able to secrete large amounts of IFN-γ, and there was a significant difference compared with the PBS group or LNP group (P<0.01), indicating that after injection of mH5N1 vaccine, the CTL pathway of cellular immunity was mainly activated in mice.

[0098] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. A universal mRNA vaccine for H5N1 influenza, characterized in that: The universal mRNA vaccine for H5N1 influenza contains mRNA molecule 1 and mRNA molecule 2; The mRNA molecule 1 contains an mRNA sequence encoding the H5m protein: The mRNA molecule 2 contains an mRNA sequence encoding the N1m protein: The H5m protein is any one of the following (A1)-A4): A1) The amino acid sequence is that of the protein shown in SEQ ID NO:1; A2) A fusion protein with the same function obtained by attaching a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID NO:1; A3) Proteins with the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO:

1. A4) Proteins that have 80% or more of the same amino acid sequence as SEQ ID NO:1 and have the same function; The N1m protein is any one of the following B1)-B4): B1) The amino acid sequence is that of the protein shown in SEQ ID NO:2; B2) A fusion protein with the same function obtained by attaching a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID NO:2; B3) Proteins with the same function obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID NO:

2. B4) is a protein that has 80% or more of the same amino acid sequence as the one shown in SEQ ID NO:2 and has the same function.

2. The universal mRNA vaccine for H5N1 influenza according to claim 1, characterized in that: The gene sequence encoding the H5m protein is any one of the following: E1) The DNA molecule shown in positions 86-1789 of SEQ ID NO:3; The nucleotide sequence defined by E2) has 75% or more identity with E1) and is a DNA molecule encoding the H5m protein.

3. The universal mRNA vaccine for H5N1 influenza according to claim 1 or 2, characterized in that: The gene sequence encoding the N1m protein is any one of the following: F1) The DNA molecule shown in positions 86-1495 of SEQ ID NO:4; The nucleotide sequence defined by F2) has 75% or more identity with F1) and is a DNA molecule encoding the N1m protein.

4. The universal mRNA vaccine for H5N1 influenza according to any one of claims 1-3, characterized in that: The mRNA molecule 1 includes, from the 5' end to the 3' end, a 5' cap structure, a 5' UTR sequence, an mRNA sequence encoding the H5m protein, a kozak sequence, a 3' UTR sequence, and a PolyA sequence. The mRNA molecule 2 includes, from the 5' end to the 3' end, a 5' cap structure, a 5' UTR sequence, an mRNA sequence encoding the N1m protein, a kozak sequence, a 3' UTR sequence, and a PolyA sequence.

5. The universal mRNA vaccine for H5N1 influenza according to any one of claims 1-4, characterized in that: The full sequence of mRNA molecule 1 is shown in SEQ ID NO:7; The full sequence of mRNA molecule 2 is shown in SEQ ID NO:

8.

6. The universal mRNA vaccine for H5N1 influenza according to any one of claims 1-5, characterized in that: The H5N1 influenza mRNA vaccine contains mRNA molecule 1 encapsulated in liposome nanoparticles and mRNA molecule 2 encapsulated in liposome nanoparticles.

7. The universal mRNA vaccine for H5N1 influenza according to any one of claims 1-6, characterized in that: The liposome nanoparticles contain ionized lipids, cofactor lipids, cholesterol, and PEG lipids.

8. The universal mRNA vaccine for H5N1 influenza according to any one of claims 1-7, characterized in that: The mass ratio of mRNA molecule 1 to mRNA molecule 2 in the H5N1 influenza mRNA vaccine is 1:

1.

9. Any of the following substances: M1) protein, wherein the protein is the H5m protein as described in any one of claims 1-8 or the N1m protein as described in any one of claims 1-8; M2) is a nucleic acid molecule that encodes the protein described in M1; M3) contains an expression cassette containing the nucleic acid molecule described in M2; M4) A recombinant vector containing the nucleic acid molecule described in M2) or the expression cassette described in M3); M5) A recombinant microorganism containing the nucleic acid molecule described in M2), the expression cassette described in M3), or the recombinant vector described in M4; M6) A set of mRNA molecules, wherein the set of mRNA molecules includes mRNA molecule 1 as described in any one of claims 1-8 and mRNA molecule 2 as described in any one of claims 1-8; M7) Liposome nanoparticles loaded with the set of mRNA molecules described in M6); M8) mRNA molecule, wherein the mRNA molecule is mRNA molecule 1 as described in any one of claims 1-8 or mRNA molecule 2 as described in any one of claims 1-8; M9) Liposome nanoparticles loaded with the mRNA molecules described in M8); M10) H5N1 influenza virus infection prevention and treatment preparation, wherein the effective active ingredient of the H5N1 influenza virus infection prevention and treatment preparation contains the complete set of mRNA molecules described in M6) or the liposome nanoparticles described in M7) or the mRNA molecules described in M8) or the liposome nanoparticles described in M9).

10. Any of the following applications: N1) The use of any of the substances described in claims 9 (M1)-M9) in the preparation of any of the universal mRNA vaccines for H5N1 influenza according to claims 1-8; N2) The use of the universal mRNA vaccine for H5N1 influenza according to any one of claims 1-8 or the substance according to claim 9 in the preparation of products for the treatment and / or prevention of H5N1 influenza virus infection; N3) The use of the universal mRNA vaccine for H5N1 influenza according to any one of claims 1-8 or the substance according to claim 9 in the preparation of a product for neutralizing H5N1 influenza virus; N4) The use of the universal mRNA vaccine for H5N1 influenza according to any one of claims 1-8 or the substance according to claim 9 in the preparation of H5N1 influenza virus antibodies.

Images