A heat-resistant isayama orientalis engineering bacterium and a construction method and application thereof

By overexpressing the DnaK, DnaJ, and GrpE genes in *Issa mesasula*, the problem of low growth and fermentation efficiency of *Issa mesasula* under high temperature conditions was solved, achieving stable growth and fermentation under high temperature conditions and improving the safety and economy of the fermentation process.

CN122168435APending Publication Date: 2026-06-09KINGFA SCI & TECH CO LTD +2
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
KINGFA SCI & TECH CO LTD
Filing Date
2026-03-11
Publication Date
2026-06-09

AI Technical Summary

Technical Problem

The growth and fermentation efficiency of *Issa mesasura* is low under high temperature conditions, which limits its application under high temperature conditions. Existing improvement methods have long breeding cycles and the target traits are unstable.

Method used

Overexpression of DnaK, DnaJ, and GrpE genes in *Issa mesasura* was performed, and the heat resistance of the *Issa mesasura* was improved by designing and inserting related gene expression cassettes into the genome of *Issa mesasura*.

Benefits of technology

The engineered strains can grow and ferment stably at 40-45℃, improving the safety and economy of the fermentation process, reducing cooling energy consumption, reducing the risk of microbial contamination, and increasing the reaction rate.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122168435A_ABST
    Figure CN122168435A_ABST
Patent Text Reader

Abstract

The present application relates to a kind of heat-resistant isayama orientalis engineering bacteria and its construction method and application, belong to genetic engineering technical field.The heat-resistant isayama orientalis engineering bacteria uses isayama orientalis as starting strain, and overexpresses DnaK gene, DnaJ gene and GrpE gene.The present application integrates thermophilic bacteria molecular chaperone system in isayama orientalis, can improve the heat-resistant performance of isayama orientalis, and engineering bacteria can grow and ferment stably under high temperature condition, with high safety and economy.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, and relates to a heat-resistant engineered strain of *Issa mesasura*, its construction method, and its application. Background Technology

[0002] With the rapid development of synthetic biology and related technologies, the performance requirements for chassis strains are becoming increasingly stringent, including key characteristics such as tolerance to high osmotic pressure, high temperature, and acidic environments. In the field of microbial fermentation, temperature is one of the important factors affecting the fermentation process. Currently, industrial fermentation processes often need to be carried out at higher temperatures to increase the reaction rate, reduce contamination by other microorganisms, and lower cooling costs.

[0003] As an important industrial microorganism, *Isaccharomyces cerevisiae* possesses strong acid resistance and metabolic diversity, demonstrating broad application potential in various fields such as food fermentation, biofuel production, and organic acid synthesis. Its unique metabolic characteristics and fermentation performance make it one of the most favored strains in industrial production processes. However, in practical applications, *Isaccharomyces cerevisiae* faces numerous challenges, with heat resistance being particularly prominent. As industrial fermentation temperatures rise, the growth and fermentation efficiency of *Isaccharomyces cerevisiae* decreases significantly, severely limiting its application in high-temperature environments and consequently impacting the production efficiency and economic benefits of related industries.

[0004] Researchers have conducted extensive work to improve the heat resistance of *Isaporphyromonas orientalis*. Currently, commonly used strain improvement methods mainly rely on isolation and screening, and mutagenesis screening. For example, CN102268382A discloses a heat-resistant *Isaporphyromonas orientalis* strain, IPE100 (CGMCC No. 4927), isolated and screened from agricultural waste. This strain possesses the ability to perform ethanol fermentation at high temperatures, utilizing lignocellulose hydrolysates for high-temperature ethanol fermentation and sweet sorghum for high-temperature solid-state ethanol fermentation. While these methods improve the heat resistance of strains to some extent, they suffer from drawbacks such as long breeding cycles, instability of target traits, and difficulty in prediction.

[0005] In conclusion, the development of novel heat-resistant engineered strains of *Issa mesasura* is of great significance for the fermentation applications of *Issa mesasura*. Summary of the Invention

[0006] To address the shortcomings of existing technologies and practical needs, this invention provides a heat-resistant engineered strain of *Issa mesasura*, its construction method, and its application. This invention develops a heat-resistant engineered strain of *Issa mesasura* that can stably grow and ferment at higher temperatures, thereby improving the safety and economy of the fermentation process.

[0007] To achieve this objective, the present invention adopts the following technical solution: In a first aspect, the present invention provides a thermoresistant engineered strain of *Isabella orientalis*, wherein the thermoresistant engineered strain of *Isabella orientalis* is based on *Isabella orientalis* strain and overexpresses the DnaK gene, DnaJ gene and GrpE gene.

[0008] In this invention, it was found that integrating DnaK-DnaJ-GrpE into *Issa mesasura* can improve the heat resistance of *Issa mesasura*, enabling it to grow and ferment stably at 40-45℃, which is about 10℃ higher than the maximum tolerance temperature of the wild-type strain.

[0009] Preferably, the *Issa mesasura* comprises... Pichia kudriavzevii S9.

[0010] Preferably, the nucleic acid sequence of the DnaK gene includes the sequence shown in SEQ ID NO.1.

[0011] Preferably, the nucleic acid sequence of the DnaJ gene includes the sequence shown in SEQ ID NO.2.

[0012] Preferably, the nucleic acid sequence of the GrpE gene includes the sequence shown in SEQ ID NO.3.

[0013] SEQ ID NO.1:

[0014] SEQ ID NO.2:

[0015] SEQ ID NO.3: .

[0016] Preferably, the DnaK gene, DnaJ gene, and GrpE gene are inserted into the genome of *Issa mesasura* in the form of expression cassettes.

[0017] Preferably, the expression cassette of the DnaK gene includes the pTEF1 promoter, the DnaK gene, and the TCYC1 terminator.

[0018] Preferably, the expression cassette of the DnaJ gene includes the pPYK1 promoter, the DnaJ gene, and the TADH1 terminator.

[0019] Preferably, the GrpE gene expression cassette includes a pTDH3 promoter, the GrpE gene, and a TPGI1 terminator.

[0020] In this invention, a gene expression cassette was designed to achieve efficient expression in *Issa mesasura*.

[0021] Preferably, the nucleic acid sequence of the pTEF1 promoter includes the sequence shown in SEQ ID NO.4.

[0022] Preferably, the nucleic acid sequence of the TCYC1 terminator includes the sequence shown in SEQ ID NO.5.

[0023] Preferably, the nucleic acid sequence of the pPYK1 promoter includes the sequence shown in SEQ ID NO.6.

[0024] Preferably, the nucleic acid sequence of the TADH1 terminator includes the sequence shown in SEQ ID NO.7.

[0025] Preferably, the nucleic acid sequence of the pTDH3 promoter includes the sequence shown in SEQ ID NO.8.

[0026] Preferably, the nucleic acid sequence of the TPGI1 terminator includes the sequence shown in SEQ ID NO.9.

[0027] SEQ ID NO.4: 。

[0028] SEQ ID NO.5: GTGAGCTGATAGTTTCTTCTTTTACCCTTATATTTATTAAAATACTCTTAATAATATCCCATCTTACATATAACGAATTCCATTCTTGTCTTATATTCTTAATCATGTCCTAGAAATCAAACAAAAAAAAATGTTTATAATGATTTTTTTAGTGTTTTATACATTTTCTGTATAGAAGAAAAAAAAAGACTATTATTATACTTACATTGTAACACAATTGCAACGAGTGTAATTTTTAGGTTTTCGTTTTCCCCCTCACAGCTCGATTATTGTCAAATCACACGACAAGAAAACGTAAACTGTTATCTTTGGATCCTACGGCAACAGTGTGTGTGTTGTCAGTAACCTTGGGGGAGATGCTGATTCTGCTGATCCCATCGCCAGGTAAGTCTCTGGAATCAACTTTACGGAGTTCGTCGAAACTGTAATTCAAGACATTCACTTTGTACACGTAAATCTCACCGTTGTCTAAACCAATAACAAGCTTGAAATTACCTTCA。

[0029] SEQ ID NO.6:

[0030] SEQ ID NO.7: GTCTAGAGAGTGTATACCTCCCCGCTTTTGCTGCTACTAATTAATACCCACTATTAATTTCCTTCTATTACAAAACGCCTCTCAGACTCCCACACACACACTTACATATGTACACGCTCATACATACACTTATAAACATACATATATACGTCGACGATATAATTTTAATGTCAATAGTCATGAACATTTGAACTACTTTCCCGTTTCTCTATTTTCCGGTTTCTTTCCCAACCGTCTTTTGTCTTTCTTTCCACGTGGCTGACCCAACGTTTTCCATTCACAGAGTGCATTGTCTATTGTGGAAAAGCGGGGGTGAGATTTCCACAAAACCTGTACTTCTCACCTCCCCCCTCCTTAACCCCGGCCCAAGGGGGGGGGGTACGCGGCACTGTAGTTAAGGCCGTACGGAGATTTTCCCGGGTGTCGGCGTTTAGAGACACACACAATAGAGAGTTTTACTTGGAATACAATACACCCCCACTCTAATTGTGTGTTCATCT。

[0031] SEQ ID NO.8: 。

[0032] SEQ ID NO.9: TTAACGAAAGTTCCAAACTTTATTTATAATGTGTTTATGTTTGTATTTTAATCACTCTTTATGACCTATATATGAAGCTTTTAGCATTATCGCAGCAAGTATAAATGGATGCATGTAAATTCTATAGTTCATATAGTGCGATTTGGTGAATTTTTGAAATTTTGCTAATGGATAATATACTCTATATTTTAACACTGTGTTTACTGATGCCTCTTCCGAATTTCTTTCTTTCACCACTCAACCCATGAA AGGCAAGGAACACATACATCATGATTACAATAATATAGATATCGGGGTAACAATTACAGTTCCCAGAAGAAGGAAACAAAAACGTACAGGATCTACAAATAGTCAAAGCACTGGGTGGAAGAAATTGTTATGGCTCAAACAACCTTATGACGATAACTACACAGATTCGAGCTTCTTATCACAACTGAAACGAAATTCAACGGTTGTAAAGTACTCGTATGTAAAGCTAGTCAATGATTTTTCCATCATT.

[0033] Preferably, the insertion site includes nucleotides 503666 to 503685 of chromosome IV of *Issa mesasura*.

[0034] In this invention, gene insertion sites are identified, and gene expression is performed at specific sites to further increase gene expression levels.

[0035] In a second aspect, the present invention provides a method for constructing the thermoresistant engineered strain of *Issa mesasura* as described in the first aspect, the method comprising: Using *Issa mesasura* as the starting strain, the DnaK, DnaJ, and GrpE genes were overexpressed.

[0036] Preferably, the overexpression method includes: The DnaK, DnaJ, and GrpE gene expression cassettes were constructed and inserted into the genome of *Issa mesasura*.

[0037] In this invention, the corresponding gene modification strategy can be implemented using genetic engineering techniques commonly used in the art. For example, for gene expression cassette insertion, gene editing can be performed using the CRISPR-Cas9 system, wherein the nucleic acid sequence of the sgRNA of the CRISPR-Cas9 system includes the sequence shown in SEQ ID NO. 10, and the nucleic acid sequences of the homologous arms include the sequences shown in SEQ ID NO. 11 and SEQ ID NO. 12.

[0038] SEQ ID NO. 10: CCTGCTCCAAATGCACAGTG.

[0039] SEQ ID NO.11:

[0040] SEQ ID NO.12:

[0041] Thirdly, the present invention provides a biological agent comprising the thermostable *Issalonium orientalis* engineered strain described in the first aspect.

[0042] Fourthly, the present invention provides a biological fermentation method, the biological fermentation method comprising fermenting and culturing the thermostable Isaac's yeast engineered strain described in the first aspect.

[0043] Preferably, the fermentation culture temperature is 40~45℃.

[0044] In this invention, based on the developed heat-resistant engineered Saccharomyces orientalis, fermentation culture can be carried out at 40~45℃. High-temperature fermentation can improve the safety and economy of the fermentation process, significantly reduce cooling energy consumption, reduce the risk of microbial contamination, increase the reaction rate, and reduce production costs. It can be used for various fermentation production processes, such as ethanol production.

[0045] In this invention, commonly used culture media, culture methods, and product purification methods in the field can be selected according to actual needs.

[0046] Compared with the prior art, the present invention has at least the following beneficial effects: In this invention, genetic modification of *Issa mesasura* can improve its heat resistance. The engineered strain can grow and ferment stably under high temperature conditions, exhibiting high safety and economic efficiency. Attached Figure Description

[0047] Figure 1A Electrophoresis diagrams of promoters, terminators, homologous arms, and gene fragments for gene expression.

[0048] Figure 1B This is a PCR electrophoresis image of the DnaJ expression cassette, DnaK expression cassette, and GrpE expression cassette fusion.

[0049] Figure 2 This is a graph showing the fluorescence intensity results of fluorescent proteins expressed at different insertion sites.

[0050] Figure 3A Electrophoresis image for identifying positive transformants using primer pair JD-LF / JD-LR.

[0051] Figure 3B Electrophoresis image for identifying positive transformants using primer pair JD-RF / JD-RR.

[0052] Figure 4 The graph shows the concentration of fermentation products of engineered bacteria and wild bacteria at different temperatures.

[0053] Figure 5 This is a growth curve diagram of engineered bacteria and wild bacteria at different temperatures. Detailed Implementation

[0054] The technical solution of the present invention will be further described below with reference to the accompanying drawings and specific embodiments. However, the following examples are merely simplified examples of the present invention and do not represent or limit the scope of protection of the present invention. The scope of protection of the present invention is determined by the claims.

[0055] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased from legitimate channels.

[0056] In this invention, the starting strain (wild type) can be selected. Pichia kudriavzevii S9 was deposited on September 20, 2024, at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCC.No: 65148, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0057] The primer sequences are shown in Table 1.

[0058] Table 1 Example 1 This embodiment describes the construction of a gene expression cassette.

[0059] Based on the codon usage preferences of *Issa mesasula*, the codons for the DnaK, DnaJ, and GrpE genes were optimized and synthesized by a biosynthetic company. The nucleic acid sequences are shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively. Using overlap PCR, the optimized DnaK, DnaJ, and GrpE genes were ligated to their corresponding promoters and terminators to construct expression cassettes.

[0060] (1) Construction of TEF1-DnaK-CYC1 expression cassette Using the synthesized DnaK gene as a template, the DnaK fragment was amplified using primers DnaK-pTEF1-F / DnaK-TCYC1-R. Using the *Issa mesasura* genome as a template, the promoter pTEF1 and terminator TCYC1 fragments were amplified using primer pairs PTEF1-F / R and TCYC1-F / R. After purification and recovery of these three fragments, PCR fusion amplification was performed using a mixture of DnaK, pTEF1, and TCYC1 fragments in a 1:1:1 molar ratio as a template, along with primers PTEF1-F and TCYC1-R, to obtain the DnaK expression cassette, named TEF1-DnaK-CYC1.

[0061] (2) Construction of PYK1-DnaJ-ADH1 expression cassette Using the synthesized DnaJ gene as a template, the DnaJ fragment was amplified using primers DnaJ-pPYK1-F / DnaJ-TADH1-R. Using the *Issa mesasura* genome as a template, the promoter pPYK1 and terminator TADH1 fragments were amplified using primer pairs PPYK1-F / R and TADH1-F / R. After purification and recovery of the three fragments, a mixture of DnaJ, pPYK1, and TADH1 fragments in a 1:1:1 molar ratio was used as a template for PCR fusion amplification using primers PPYK1-F and TADH1-R to obtain the DnaJ expression cassette, named PYK1-DnaJ-ADH1.

[0062] (3) Construction of TDH3-GrpE-PGI1 expression cassette Using the synthesized GrpE gene as a template, the GrpE fragment was amplified using primers GrpE-pTDH3-F / GrpE-TPGI1-R. Using the *Issa mesasura* genome as a template, the promoter pTDH3 and terminator TPGI1 fragments were amplified using primer pairs PTDH3-F / R and TPGI1-F / R. After purification and recovery of the three fragments, GrpE, pTDH3, and TPGI1 fragments were mixed in a 1:1:1 molar ratio and used as a template for PCR fusion amplification using primers PTDH3-F and TPGI1-R to obtain the GrpE expression cassette, named TDH3-GrpE-PGI1.

[0063] (4) The homologous arms required for integration were amplified by two pairs of primers, IV12-LF / LR and IV12-RF / RR, and the homologous arm fragments IV12-L (SEQ ID NO.11) and IV12-R (SEQ ID NO.12).

[0064] The amplification system consisted of: 25 μL of 2×Phanta Max Buffer (Vazyme), 1 μL of dNTPs (10 mM each), 20 ng of DNA template, 2 μL of primers (10 μM each), 1 μL of Phanta Max Super-Fidelity DNA polymerase (Vazyme, 2.5 U / μL), and 20 μL of distilled water, for a total volume of 50 μL.

[0065] The amplification conditions were: 95℃ pre-denaturation for 3 min (1 cycle); 95℃ denaturation for 15 s, 56℃ annealing for 15 s, and 72℃ extension for 1 min (30 cycles); 72℃ extension for 5 min (1 cycle).

[0066] Electrophoresis results of each PCR product are as follows Figure 1A and Figure 1B As shown, Figure 1AThis diagram shows the promoter, homologous arms, terminator, and gene fragments. M represents the standard marker. Lane 1 is the IV12-L fragment, lane 2 is the pTEF1 fragment, lane 3 is the DnaK fragment, lane 4 is the TCYC1 fragment, lane 5 is the pPYK1 fragment, lane 6 is the DnaJ fragment, lane 7 is the TADH1 fragment, lane 8 is the pTDH3 fragment, lane 9 is the GrpE fragment, lane 10 is the TPGI1 fragment, and lane 11 is the IV12-R fragment. Figure 1B The images show the PCR results for each expression cassette fusion. M is the standard marker, lane 1 is the DnaJ expression cassette fusion fragment, lane 2 is the DnaK expression cassette fusion fragment, and lane 3 is the GrpE expression cassette fusion fragment. The results indicate that the size of each fragment is as expected, and all target fragments were correctly prepared.

[0067] Example 2 This embodiment describes the construction of engineered bacterial strains.

[0068] Fifteen distinct sites were selected from the genome (Table 2). The expression of peripheral genes at these sites was determined by measuring the fluorescence intensity of the strains after integrating a green fluorescent protein expression cassette at each site. Homologous arms of 1000 bp to the left and right of the target site were selected for peripheral gene integration.

[0069] Fluorescence intensity measurement = fluorescence value / OD 600 Value; Fluorescence measurement: Excitation wavelength: 480 nm; Emission wavelength: 520 nm.

[0070] Table 2 The results are as follows Figure 2 As shown, the IV-12 site exhibits the strongest relative fluorescence intensity, therefore this site was selected for the insertion and expression of the heat-resistant gene.

[0071] To insert the expression cassette constructed in Example 1 into nucleotide positions 503666-503685 (Ⅳ12) of chromosome IV of *Issa mesasura*, homologous arm fragments Ⅳ12-L (SEQ ID NO. 11) and Ⅳ12-R (SEQ ID NO. 12) were used for integration with the assistance of the CRISPR-Cas9 system, achieving precise integration of the target gene into a specific site in the *Issa mesasura* genome. The nucleic acid sequence of the sgRNA included the sequence shown in SEQ ID NO. 10. The gene editing plasmid (Ⅳ12-sgRNA) was constructed according to CN118910116A, and the target sequence of Ⅳ12 was: CCTGCTCCAAATGCACAGTG (SEQ ID NO. 39).

[0072] The IV12-sgRNA editing plasmid, fragments IV12-L and IV12-R, and three expression cassettes TEF1-DnaK-CYC1, PYK1-DnaJ-ADH1, and TDH3-GrpE-PGI1 were mixed and transformed into *Issa mesasula* at a molar ratio of 1:1:1 and a total concentration of 2 μg using the LiAc transformation method. The resulting transformed bacterial solution was plated onto YPD-NrsR plates containing 100 μg / mL norocin (brand: Solarbio; catalog number: N9210-100mg) and incubated upside down at 30°C for 3 days. The obtained positive transformants were verified by colony PCR using JD-LF / JD-LR and JD-RF / JD-RR primers. The two pairs of identification primers amplified the upstream and downstream portions of the integrated fragment after integration into the genome, respectively. If both pairs of primers amplified the correct size bands, it indicated that the strain's gene integration was correct.

[0073] The results are as follows Figure 3A and Figure 3B As shown, Figure 3A The results of identifying the bands for primer pair JD-LF / JD-LR are shown, where M is the standard marker and lanes 1-8 are transformants 1-8. Figure 3B The image shows the banding results for primer pair JD-RF / JD-RR, where M is the standard marker and lanes 1-8 are transformants 1-8. The results indicate that the strain's genes were correctly integrated, confirming it as an engineered bacterium.

[0074] Example 3 This embodiment involves a heat resistance test.

[0075] The growth curves of engineered strains and wild-type strains were determined at different temperatures (30-50℃), the specific growth rates were calculated, and the sugar consumption rate and product yield of the two strains under different conditions were compared.

[0076] Engineered and wild-type bacteria were inoculated into sterilized shake flasks containing 10 mL of YPD medium and cultured at 30°C and 200 rpm for 15 h. The bacterial culture was then analyzed by OD200. 600 A concentration of 0.1 was inoculated into multiple shake flasks containing 50 mL of YPD medium. Each flask was incubated at 30℃, 35℃, 40℃, 45℃, 50℃, and 200 rpm on a shaker. Samples were taken at 12 h, 24 h, 36 h, and 48 h to measure the OD of the bacterial culture. 600 (The sample was obtained by shaking the flask and mixing well, then taking 1 mL of bacterial solution and diluting it a certain factor to adjust the OD.) 600(Value between 0.3 and 0.65), fermented for 24 h, 1 mL of bacterial culture was centrifuged at 12000 rpm for 5 min, 100 μL of supernatant was taken and diluted 10 times with mobile phase (2.43 mM dilute sulfuric acid), and impurities were removed by filtration through a 0.22 μm filter membrane. The sugar content and ethanol yield were detected by high performance liquid chromatography.

[0077] Each experiment was repeated three times.

[0078] YPD liquid culture medium preparation: 5wt% glucose, 2wt% peptone, 1wt% yeast extract and the balance water, pH 7.0.

[0079] The high-performance liquid chromatography (HPLC) detection setup was as follows: The autosampler was set to autosample at a volume of 10 μL, the mobile phase flow rate was maintained at 0.6 mL / min, the column oven temperature was maintained at 40℃, and the analysis time was 25 min. The detector operating temperature was also set at 40℃. The mobile phase was 2.43 mM dilute sulfuric acid, and the chromatographic column was a Bio-Rad Aminex HPX-87H (300 × 7.8 mm).

[0080] Three of the eight engineered strains successfully validated in Implementation 2 (numbered HST1 to HST8) were selected (numbered HST1, HST6, and HST8) and compared with the wild-type strain during fermentation. The results are as follows: Figure 4 and Figure 5 As shown, under relatively high temperature (≥35℃) conditions, the fermentation performance of engineered bacteria is significantly higher than that of wild bacteria (WT), and strain HST6 exhibits the most stable fermentation under different temperature conditions.

[0081] In summary, this invention designs and constructs a heat-resistant engineered strain of *Issa mesasura*, which achieves significant heat resistance. The engineered strain can grow and ferment stably at 40-45℃. High-temperature fermentation can improve the reaction rate, reduce cooling energy consumption and the risk of microbial contamination, thereby improving the safety and economy of fermentation production.

[0082] The applicant declares that the above description is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention fall within the protection and disclosure scope of the present invention.

Claims

1. A heat-resistant engineered strain of *Issa mesasura*, characterized in that, The heat-resistant Isaac's yeast engineered strain uses Isaac's yeast as the starting strain and overexpresses the DnaK, DnaJ and GrpE genes.

2. The thermoresistant *Issa mesasura* engineered strain according to claim 1, characterized in that, The Oriental Isaac yeast includes Pichia kudriavzevii S9.

3. The thermoresistant *Issa mesasura* engineered strain according to claim 1 or 2, characterized in that, The nucleic acid sequence of the DnaK gene includes the sequence shown in SEQ ID NO.1; Preferably, the nucleic acid sequence of the DnaJ gene includes the sequence shown in SEQ ID NO.2; Preferably, the nucleic acid sequence of the GrpE gene includes the sequence shown in SEQ ID NO.

3.

4. The thermoresistant *Issa mesasura* engineered strain according to any one of claims 1-3, characterized in that, The DnaK, DnaJ, and GrpE genes were inserted into the genome of *Issa mesasura* in the form of expression cassettes. Preferably, the expression cassette of the DnaK gene includes the pTEF1 promoter, the DnaK gene, and the TCYC1 terminator; Preferably, the expression cassette of the DnaJ gene includes the pPYK1 promoter, the DnaJ gene, and the TADH1 terminator; Preferably, the GrpE gene expression cassette includes a pTDH3 promoter, the GrpE gene, and a TPGI1 terminator.

5. The thermoresistant *Issa mesasura* engineered strain according to claim 4, characterized in that, The nucleic acid sequence of the pTEF1 promoter includes the sequence shown in SEQ ID NO.4; Preferably, the nucleic acid sequence of the TCYC1 terminator includes the sequence shown in SEQ ID NO.5; Preferably, the nucleic acid sequence of the pPYK1 promoter includes the sequence shown in SEQ ID NO. 6; Preferably, the nucleic acid sequence of the TADH1 terminator includes the sequence shown in SEQ ID NO.7; Preferably, the nucleic acid sequence of the pTDH3 promoter includes the sequence shown in SEQ ID NO. 8; Preferably, the nucleic acid sequence of the TPGI1 terminator includes the sequence shown in SEQ ID NO.

9.

6. The thermoresistant *Issa mesasura* engineered strain according to claim 4 or 5, characterized in that, The insertion site includes nucleotides 503666 to 503685 of chromosome IV of *Issa mesasura*.

7. The method for constructing the thermoresistant engineered strain of *Issa mesasura* according to any one of claims 1-6, characterized in that, The construction method includes: Using *Issa mesasura* as the starting strain, the DnaK, DnaJ, and GrpE genes were overexpressed.

8. The method for constructing the thermoresistant engineered *Issa mesasura* strain according to claim 7, characterized in that, The overexpression method includes: The DnaK, DnaJ, and GrpE gene expression cassettes were constructed and inserted into the genome of *Issa mesasura*.

9. A biological agent, characterized in that, The biological agent includes the thermoresistant *Issa mesasura* strain as described in any one of claims 1-6.

10. A biological fermentation method, characterized in that, The bio-fermentation method includes fermenting and culturing the thermoresistant Isaac's yeast engineered strain as described in any one of claims 1-6.

Citation Information

Patent Citations

  • High temperature resistant Issatchenkia orientalis, application thereof and method for producing ethanol through fermentation

    CN102268382A