A method for screening anti-ethivirus b drugs

By constructing an EGFP cleavage site mutant plasmid and an NS2B/NS3-mCherry expression plasmid targeting the main protease NS3pro of Japanese encephalitis virus, and co-transfecting cells to screen for anti-Japanese encephalitis virus drugs, this method solves the problem of the lack of effective drugs in existing technologies and achieves an efficient and safe drug screening process.

CN122168710APending Publication Date: 2026-06-09KUNMING UNIV OF SCI & TECH
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
KUNMING UNIV OF SCI & TECH
Filing Date
2026-03-19
Publication Date
2026-06-09

AI Technical Summary

Technical Problem

Currently, there are no effective drugs to treat Japanese encephalitis virus, existing vaccines are costly and have side effects, and the high morbidity and mortality rate of Japanese encephalitis virus necessitates new treatment methods.

Method used

A drug screening platform targeting the major protease NS3pro of Japanese encephalitis virus was constructed. By introducing the NS3pro cleavage site KR↓GG into enhanced green fluorescent protein EGFP, an NS3 protein activity reporter plasmid pCMV-EGFP-β8KRGGβ9 was constructed and co-transfected into cells with NS2B/NS3-mCherry expression plasmid. Antiviral drugs were screened by changes in fluorescence intensity.

Benefits of technology

This method enables high-throughput, safe, and reliable screening of drugs against Japanese encephalitis virus, significantly saving time and costs. The fluorescence intensity directly reflects the inhibitory effect of the drugs, avoiding the risks associated with using live viruses.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122168710A_ABST
    Figure CN122168710A_ABST
Patent Text Reader

Abstract

This invention discloses a method for screening drugs against Japanese encephalitis virus, which uses the main protease NS3 of Japanese encephalitis virus. pro The activity reporter plasmid and the main protease NS3 of Japanese encephalitis virus pro Expression plasmids were used to screen for drugs against Japanese encephalitis virus; NS3 pro Active reporter plasmids and NS3 pro The expression plasmid was co-transfected into HEK-293T cells. The fluorescence intensity of green fluorescent protein (EGFP) was detected using an inverted fluorescence microscope and a multi-functional microplate reader to predict NS3. pro The activity of NS3, the main protease of JEV, can be used to screen for its activity. pro The purpose of this invention is to screen anti-JEV compounds using active reporter plasmids. The inhibitory effect of the compounds can be observed more intuitively and easily by utilizing fluorescence intensity, providing a powerful tool for screening broad-spectrum anti-JEV compounds.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of drug screening technology, specifically relating to a method utilizing the main protease NS3 of Japanese encephalitis virus. pro A method for screening inhibitors against Japanese encephalitis virus for drug targets. Background Technology

[0002] Japanese encephalitis virus (JEV) is the pathogen behind Japanese encephalitis (JE), a potentially serious brain infection transmitted through mosquito bites. JE is predominantly found in the Asia-Pacific region and has the potential to spread globally with higher morbidity and mortality rates. Efforts have been made to identify and select various target molecules crucial to the progression of JE, but to date, no licensed antiviral drugs have been available. From a preventative perspective, several licensed JE vaccines are available, but various factors, namely their high cost and varying side effects, limit their global use. With an average of 67,000 cases of JE occurring annually, there is an urgent need to find a suitable antiviral drug to treat patients in the acute phase, as currently only supportive care can alleviate the infection.

[0003] NS3 is a conserved protein with a capacity of 69 kDa, consisting of two domains: C helicase domain at the end and N The NS3 protein contains a serine protease domain responsible for multi-protein cleavage. Normal function of NS3 requires viral NS2B as a cofactor. NS2B is a 14 kDa protein composed of 130 amino acids, possessing both hydrophobic and hydrophilic domains, the latter playing a crucial role in NS3 activation. NS2B / NS3 protease activity leads to cleavage of the viral polypeptide chain at the capsid (internal), NS2A / NS2B, NS2B / NS3, and NS3 / NS4A sites. The NS2B / NS3 protease recognizes and cleaves a highly conserved two-basic-amino acid motif in Japanese encephalitis virus (JEV), consisting of two basic residues (KR, RR, RK, or occasionally QR) at the classic P2 and P1 positions before the cleavage site, followed by a small amino acid (G, S, or A) at the P1′ position. The JEV NS2B / NS3 protease is essential for the viral life cycle and is therefore an ideal drug target; utilizing the NS2B / NS3 protease is one of the main antiviral strategies employed by researchers.

[0004] Enhanced green fluorescent protein (EGFP) has a molecular weight of approximately 27 kDa and is a single-chain polypeptide composed of 240 amino acids. It is excited at 488 nm and emitted at 507 nm. Chemically stable, it is widely used as a fluorescent label in biomedical research. Its secondary structure consists of 11 β-chains and a central α-helix; it only emits fluorescence when its structure is intact.

[0005] Hoechst staining solution is suitable for staining the nuclei of live cells. A very bright blue fluorescent staining of the nucleus can be observed under a fluorescence microscope after only 10 minutes of staining. Its maximum excitation wavelength is 346 nm, and its maximum emission wavelength is 460 nm. When Hoechst binds to double-stranded DNA, the maximum excitation wavelength is 350 nm, and the maximum emission wavelength is 461 nm. Due to its spectral characteristics, Hoechst is suitable for use in multicolor experiments with fluorescent groups such as green (FITC, GFP) and red (rhodamine, mCherry). Summary of the Invention

[0006] This invention provides a method based on the main protease NS3 of Japanese encephalitis virus. pro A drug screening platform targeting NS3 was constructed, including the NS3 protein expression plasmids p-JEV-NS2B / NS3-mCherry and NS3. pro The active reporter plasmid pCMV-EGFP-β8KRGGβ9; the NS3 protein active reporter plasmid introduces the motif KR↓GG, consisting of four amino acids (Lys(K), Arg(R), Gly(G), and Gly(G)) between lines 8 and 9 of the EGFP β chain. KR↓GG represents the NS3 protein. pro Identifiable cut sites (↓ indicates cut sites). NS3 pro The expression plasmid was constructed by using NS2B and NS3 as a complex protein; the main protease of Japanese encephalitis virus is NS3. pro The nucleotide sequence of the expression plasmid is shown in SEQ ID NO:1, and the main protease NS3 of Japanese encephalitis virus is also present. pro The nucleotide sequence of the active reporter plasmid is shown in SEQ ID NO:2.

[0007] The active reporter plasmid pCMV-EGFP-β8KRGGβ9 introduces the cleavage motif KR↓GG between the β8 and β9 chains of EGFP. This mutant, when transfected into HEK-293T cells, exhibits decreased fluorescence intensity compared to wild-type EGFP. When infected with the Japanese encephalitis virus major protease NS3... proAfter cleavage, the fluorescence intensity significantly weakened. Therefore, the green fluorescence intensity of this EGFP mutant can indicate the main protease NS3 of Japanese encephalitis virus. pro The activity, namely the green fluorescence intensity and NS3 pro The activity is inversely proportional to the activity.

[0008] Another objective of this invention is to address the aforementioned Japanese encephalitis virus major protease NS3. pro The report plasmid was used in screening drugs against Japanese encephalitis virus.

[0009] The present invention achieves its objective through the following technical solutions: 1. NS3, the main protease of Japanese encephalitis virus pro Construction of active reporter plasmids (1) Using pCMV-EGFP-c-flag plasmid as a template, amplification was performed using upstream primer p-β8KRGGβ9-F: caacatcgaggacaagagaggcggcagcgtgcagctcgccgacca; and downstream primer p-β8KRGGβ9-R: agctgcacgctgccgcctctcttgtcctcgatgttgtggcggatc. (2) Use of amplification products Dpn I. Treatment: Remove plasmids that have not produced mutations, and recover the DNA using an agarose gel DNA recovery kit. Dpn I. Processed plasmid DNA; (3) Transform the plasmid DNA into competent DH5α cells, pick single clones, extract the plasmid and sequence it to verify that the plasmid construction was successful. Then, use an endotoxin-free plasmid extraction kit to extract the plasmid pCMV-EGFP-β8KRGGβ9.

[0010] 2. NS3, the main protease of Japanese encephalitis virus. pro Construction of expression plasmids (1) The NS2b / NS3 gene of JEV was amplified in its entirety. A 14 bp overlapping sequence from the p-mCherry vector was introduced into the 5' end of the upstream primer and a 17 bp overlapping sequence from the p-mCherry vector was introduced into the 5' end of the downstream primer. The PCR product was 2284 bp. (2) Reverse PCR amplification of pEGFPN3-mCherry was performed. A 20 bp base sequence from the NS2B / NS3 gene was introduced into the 5' end of the upstream primer and a 16 bp overlapping sequence from the NS2B / NS3 gene was introduced into the 5' end of the downstream primer. The PCR product was 4756 bp. (3) The PCR products of steps (1) and (2) were linked by seamless cloning technology. The positive clone was subjected to bacterial PCR and sequenced to verify that it was correct. Then, the plasmid p-JEV-NS2B / NS3-mCherry was obtained by using an endotoxin-free plasmid extraction kit.

[0011] 3. Utilize NS3 pro The active reporter plasmid and expression plasmid were co-transfected into 293T cells and used for inhibitor screening. (1) Set up separate transfection groups, i.e., transfect the same quality of NS3. pro Active reporter plasmid; co-transfected group according to NS3 pro Active reporter plasmids and NS3 pro The expression plasmids were co-transfected into 293T cells at a mass ratio of 1:6; the co-transfected cells served as the control group, and the cells after co-transfection were added to the drug to be screened as the experimental group. (2) The day before transfection, the density was 1.5 × 10⁻⁶. 5 Seed HEK-293T cells / mL into 24-well plates, add 500 μL of cell suspension to each well; (3) After the cells adhered to the wall, transfection was performed according to the different treatment groups. The transfection was performed according to the instructions of Lipofectamine™ 3000 transfection reagent. (4) After transfection, the expression of green fluorescence was observed using an inverted fluorescence microscope, and the relative fluorescence intensity (the ratio of EGFP to Hoechst fluorescence intensity) was detected using a multi-functional microplate reader. If the relative fluorescence intensity in the experimental group was higher than that in the control group, the drug to be screened was determined to be NS3. pro Inhibitors.

[0012] Advantages and technical effects of the present invention: 1. This invention involves inserting the Japanese encephalitis virus major protease NS3 into the β chain of EGFP. pro The cleavage site KR↓GG (↓ indicates the cleavage site) was used to construct an EGFP mutant (i.e., a reporter plasmid). After transfection of cells with the mutant, the fluorescence intensity was weakened or showed no significant change compared to the wild type. When infected with the main protease NS3 of Japanese encephalitis virus... pro After cleavage, the fluorescence intensity significantly weakened. The green fluorescence intensity of this reporter plasmid can indicate the NS3 major protease of Japanese encephalitis virus. pro The activity of NS3 is used to screen drugs against Japanese encephalitis virus. If a compound has antiviral activity, it is compared with a control group (no drug added, with NS3). pro Compared to the cutting group, the experimental group (with added drug and NS3) pro The green fluorescence intensity of (present) is higher; 2. This invention achieves NS3 through a sub-replication reporter plasmid. proDrug screening revealed that subreplicates, lacking some viral proteins, cannot replicate into complete viral particles, but can replicate autonomously and therefore do not possess infectivity or transmissibility. 3. Compared with the method of using live virus for antiviral drug screening, the method of the present invention can intuitively reflect the drug's inhibitory effect through fluorescence intensity, enabling high-throughput screening of anti-Japanese encephalitis virus drugs, significantly saving the time and cost of screening anti-Japanese encephalitis virus drugs, and is safe and reliable. Attached Figure Description

[0013] Figure 1 This is an electrophoresis image of the PCR amplification results of plasmid pCMV-EGFP-β8KRGGβ9 bacterial culture. Lane 1 is the DL 2000 DNA marker, and lanes 2-8 are EGFP gene fragments. Figure 2 These are the sequencing results of the pCMV-EGFP-β8KRGGβ9 plasmid; Figure 3 This is a PCR electrophoresis result of the NS2B / NS3 gene in the bacterial culture of plasmid p-JEV-NS2B / NS3-mCherry. Lane 1 is the DL 5000 DNA marker, and the other lanes are the NS2B / NS3 gene bands obtained by bacterial culture amplification. Figure 4 Sequencing results for p-JEV3-NS2b / NS3-mCherry plasmid; Figure 5 A shows the comparison of EGFP fluorescence intensity observed under a fluorescence microscope after 293T cells were transfected with plasmids pCMV-EGFP-β8KRGGβ9 and pCMV-EGFP-c-flag; Figure 5 B shows the fluorescence expression of the fusion protein NS2B / NS3-mCherry observed under a fluorescence microscope after transfection of 293T cells with plasmid p-JEV-NS2B / NS3-mCherry. Figure 6 The results are experimental findings after transfecting JEV-infected 293T cells with the active reporter plasmid pCMV-EGFP-β8KRGGβ9. Figure A shows the results observed under an inverted fluorescence microscope, and Figure B shows the relative fluorescence intensity results detected by a microplate reader after collecting the cells observed in Figure A. Figure 7 The results are from the experiment after co-transfecting 293T cells with the active reporter plasmid pCMV-EGFP-β8KRGGβ9 and p-JEV-NS2B / NS3-mCherry. Figure A shows the results observed under an inverted fluorescence microscope, and Figure B shows the cell collection after the observation in Figure A, and the relative fluorescence intensity results detected by an enzyme-linked immunosorbent assay (ELISA) reader. Figure 8This is the result of using the active reporter plasmid pCMV-EGFP-β8KRGGβ9 to screen for drugs against Japanese encephalitis virus. Detailed Implementation

[0014] The present invention will be further described below with reference to the accompanying drawings and examples. However, the scope of protection of the present invention is not limited to the contents described. Unless otherwise specified, the methods in this embodiment shall be operated in accordance with conventional methods, and the reagents used shall be conventional reagents or reagents prepared in accordance with conventional methods unless otherwise specified.

[0015] Example 1: JEV major protease NS3 pro Construction of active reporter plasmids (1) Using the pCMV-EGFP-c-Flag plasmid (constructed according to the method in 2024103843760) as a template, the upstream primer p-β8KRGGβ9-F (caacatcgaggacaagagaggcggcagcgtgcagctcgccgacca) and the downstream primer p-β8KRGGβ9-R (agctgcacgctgccgcctctcttgtcctcgatgttgtggcggatc) were used for amplification. The amplification system was: 2 mL of p-β8KRGGβ9-F, 2 mL of p-β8KRGGβ9-R, 20 ng of pCMV-EGFP-c-Flag plasmid, 25 mL of 2×Phanta Flash Master Mix, and ddH2O to make up to 50 mL. The amplification conditions were: 98℃ for 30 s; 98℃ for 10 s, 72℃ 5 s, 72℃ for 25 s, 30 cycles; 72℃ for 1 min, to introduce the amino acid motif KR↓GG into the β chain between 8 and 9 of EGFP. The amplified products were processed using Takara. Dpn Ⅰ. React in a metal bath at 37℃ for 1 h. The system is: 19 mL PCR product plus 1 mL Dpn Ⅰ, to remove plasmids that have not produced mutations.

[0016] (2) The DNA product was transformed into Escherichia coli DH5α, incubated on ice for 30 min, then transferred to a 42℃ water bath for 90 s heat shock, then placed on ice for 5 min, and then the volume was increased to 1 mL with liquid LB medium. The mixture was then placed on a shaker at 37℃ and 200 rpm for 1 h. Finally, the culture medium was removed, centrifuged at 4000 rpm for 5 min, 900 mL of medium in the centrifuge tube was discarded, and the cells were resuspended in the remaining medium. The cell suspension was spread on solid LB medium containing ampicillin and cultured overnight at 37℃.

[0017] (3) After overnight culture for 12 h, single clones were picked and cultured in a constant temperature shaker at 37℃ and 200 rpm for 4 h. After culture, bacterial PCR was performed using specific primers ju-krgg-F (acgtccaggagcgcaccatc) and ju-krgg-F (agcgaggaagcggaagagcg) and the electrophoresis results are as follows. Figure 1 As shown in the figure. Then, the bacterial culture was expanded, and plasmids were extracted using the OMEGA endotoxin-free plasmid extraction kit and sequenced for verification. The sequencing results are shown in the figure. Figure 2 As shown, sequencing results confirmed that the amino acid motif KR↓GG was successfully introduced into the β chain between 8 and 9 of EGFP, resulting in the pCMV-EGFP-β8KRGGβ9 plasmid.

[0018] like Figure 5 As shown in Figure A, after transfecting 293T cells with plasmids pCMV-EGFP-β8KRGGβ9 and pCMV-EGFP-c-flag (i.e., wild-type EGFP), the fluorescence intensity of EGFP was observed under a fluorescence microscope. The comparison results showed that the fluorescence intensity of the mutant was somewhat reduced compared to wild-type EGFP, but it could still produce a strong fluorescence signal.

[0019] Example 2: JEV major protease NS3 pro Construction of expression plasmids (1) Download JEV major protease NS3 from NCBI pro The encoding DNA sequence (GenBank: OR872521.1) was analyzed using SnapGene 6.0 to identify restriction sites and design specific primers (upstream primer NS2B / NS3-F: gatccatcgccaccatggggtggccagccaccgagttcctc, downstream primer NS2B / NS3-R: tcgcccttgctcaccattctcttgcccgctgcaaaatccttaaac). A 14 bp overlapping sequence from the p-mCherry vector was introduced into the 5' end of the upstream primer, and a 17 bp overlapping sequence from the p-mCherry vector was introduced into the 5' end of the downstream primer. The PCR product was 2284 bp. (2) RNA was extracted from JEVs using the OMEGA EZNA Total RNA Kit I, following the instructions in the kit's manual. (3) Using RNA as a template, reverse transcription was performed using TAKARA One Step PrimeScript™ RTPCR Ki to obtain cDNA. The procedure was performed according to the kit instructions. (4) Using cDNA as a template, the NS2B / NS3 protein gene fragment was amplified using 2×Phanta Flash Master Mix and primers NS2B / NS3-F and NS2B / NS3-R. The amplification system was: 2 mL NS2B / NS3-F, 2 mL NS2B / NS3-R, 4 mL cDNA, 25 mL 2×Phanta Flash Master Mix, and 17 mL ddH2O. The amplification conditions were: 98℃ for 30 s; 98℃ for 10 s, 63℃ for 5 s, and 72℃ for 15 s, for 32 cycles; and 72℃ for 1 min. The target fragment was recovered using an OMEGA agarose gel DNA recovery kit. (5) The plasmid p-mCherry was linearized by reverse PCR. A 20 bp overlapping sequence from NS2B / NS3 was introduced into the 5' end of the upstream primer, and a 16 bp overlapping sequence from the NS2B / NS3 gene was introduced into the 5' end of the downstream primer. The PCR product was 4756 bp. The linearized p-mCherry fragment was obtained using 2×Phanta Flash Master Mix via mCherry-NS2B / NS3-F (tcgcccttgctcaccattctcttgcccgctgcaaaatccttaaac) and P-MCS-NS2B / NS3-R (tggctggccaccccatggtggcgatggatcccgggcccgcggtaccgtcgactg). The amplification system was: 2 mL mCherry-NS2B / NS3-F, 2 mL P-MCS-NS2B / NS3-R, 20 ng DNA, 25 mL 2×Phanta Flash Master Mix, and ddH2O. 20 mL; Amplification conditions: 98℃ for 30 s; 98℃ for 10 s, 66℃ for 5 s, 72℃ for 25 s, 32 cycles; 72℃ for 1 min; The target fragment was recovered using the OMEGA agarose gel DNA recovery kit; (6) Using a seamless cloning technique with 2×Master Assembly mix, NS2B / NS3 was ligated into the p-mCherry vector; (7) The ligation product was transformed into Escherichia coli DH5α, incubated on ice for 30 min, then transferred to a 42℃ water bath for 90 s heat shock, then placed on ice for 5 min, and then the volume was increased to 1 mL with liquid LB medium. The mixture was then placed on a shaker at 37℃ and 200 rpm for 1 h. Finally, the culture medium was removed, centrifuged at 4000 rpm for 5 min, 900 mL of medium in the centrifuge tube was discarded, and the cells were resuspended with the remaining medium. The cell suspension was spread on solid LB medium containing ampicillin and cultured overnight at 37℃. (8) After overnight culture, single clones were picked and cultured in a constant temperature shaker at 37℃ and 200rpm for 4h. Colony PCR was performed using primers (NS2B / NS3-F: gatccatcgccaccatggggtggccagccaccgagttcctc, NS2B / NS3-R: tcgcccttgctcaccattctcttgcccgctgcaaaatccttaaac). Figure 3 The electrophoresis results initially confirmed that NS2B / NS3 was successfully ligated into the vector. Then, the bacterial culture was expanded, and the plasmid was extracted using the OMEGA endotoxin-free plasmid extraction kit and sequenced for verification. The sequencing results confirmed that NS2B / NS3 was successfully cloned into p-mCherry, resulting in the p-JEV3-NS2B / NS3-mCherry plasmid. The sequencing results are shown below. Figure 4 As shown; NS2B / NS3 encodes a fusion protein with mCherry. The plasmid p-JEV-NS2b / NS3-mCherry was transfected into 293T cells. Red fluorescence of mCherry was observed using an inverted fluorescence microscope. The results showed that the NS2B / NS3-mCherry fusion protein correctly expressed red fluorescence (e.g., ...). Figure 5 As shown in B).

[0020] Example 3: Feasibility of using JEV-infected cells and transfected expression plasmids to verify the activity reporter plasmid (1) The day before the experiment, the well-grown 293T cells were cultured at a density of 1.5 × 10⁻⁶. 5 Cells / mL were seeded into 12-well plates, and validation was performed under two scenarios: one was that JEVs were first seeded at 100 TCID50. 50293T cells were infected, and 12 h after infection, 0.3 μg of the active reporter plasmid pCMV-EGFP-β8KRGGβ9 was transfected. After 6 h, the culture medium was changed to DMEM containing 5% FBS, and the cells were cultured at 37℃ in a 5% CO2 incubator for 48 h to detect EGFP fluorescence. In another group, when the confluence of 293T cells was about 70%, the plasmids p-NS2B / NS3-mCherry and pCMV-EGFP-β8KRGGβ9 (1.4 μg / well, the mass ratio of p-JEV-NS2B / NS3-mCherry to pCMV-EGFP-β8KRGGβ9 was 6:1) were co-transfected. After 6 h of transfection, the culture medium was changed to DMEM containing 5% FBS, and the cells were cultured at 37℃ in a 5% CO2 incubator for 48 h to detect EGFP fluorescence. (2) The transfection system and process used in step (1) are as follows: ① Prepare transfection reagents (amount added to each well): Reagent A: 50 μL Opti-MEM + corresponding plasmid mass (as described in step 1) + 2 μL p3000, Reagent B: 50 μL Opti-MEM + 1.5 μL lip3000; ② After preparing reagents A and B, incubate at room temperature for 5 min, mix solutions A and B, and incubate at room temperature for 15 min; ③ Add the mixture to the cell culture medium, 100 μL per well; (3) After incubation for 48 h, discard the culture medium and wash twice with PBS; (4) Use Hoechst staining solution to stain the cell nuclei for 15 min, and wash with PBS 3 times after staining, and let stand for 3 min each time; (5) Observe the EGFP fluorescence expression using an inverted fluorescence microscope, collect cells and use an enzyme-linked immunosorbent assay (ELISA) reader to detect the fluorescence intensity of EGFP and Hoechst, and calculate the relative fluorescence intensity (EGFP / Hoechst).

[0021] See results Figure 6 As shown, fluorescence expression was observed 48 h after transfection using an inverted fluorescence microscope. When pCMV-EGFP-β8KRGGβ9 was transfected into JEV-infected cells, NS3... pro The cleavage site in plasmid pCMV-EGFP-β8KRGGβ9 EGFP is identified, resulting in a decrease in EGFP fluorescence intensity.

[0022] In addition, such as Figure 7 As shown, co-transferring plasmids p-JEV-NS2B / NS3-mCherry and pCMV-EGFP-β8KRGGβ9 to 293T cells also yielded results consistent with those described above. Further investigation of NS3 will follow. pro The reporter plasmid and expression plasmid were co-transfected into 293T cells with JEV NS3.pro To assess the feasibility of a target drug screening system.

[0023] Example 4: via NS3 pro The report plasmid and expression plasmid were co-transfected into 293T cells to validate JEV NS3. pro Feasibility of target drug screening system (1) Co-transfection was used as the control group, and co-transfection was followed by the addition of the drug to be screened as the experimental group; (2) Cell culture, using 293T cells from the second generation as experimental cells; (3) The cells were plated one day before transfection at a density of 1.5 × 10⁻⁶. 5 Plating cells / mL into plates; (4) When the cells have grown to 70% and are fully adhered, perform cell transfection. The transfection system is as follows: reagent A is mixed with pure Opti-MEM (25 μL / well) and Lipofectamine. TM 3000 Reagent (0.75 μL / well); Add Opti-MEM (25 μL / well), P3000™ Reagent (1 μL / well), co-transfected plasmid p-NS2B / NS3-mCherry and plasmid pCMV-EGFP-β8-KRGGβ9 (700 ng / well, p-JEV-NS2B / NS3-mCherry to pCMV-EGFP-β8-KRGGβ9 mass ratio of 6:1) to reagent B respectively. After standing for 15 min, add the mixture of A and B to the cell culture medium at a volume of 50 μL per well. Change the medium after 6 h. (5) The control group only needed to change the medium, while the experimental group was treated by changing the medium containing the inhibitor ZINC03129319 (2 μM) every 6 hours. (6) The fluorescence intensity was detected by an inverted fluorescence microscope and a multi-functional microplate reader after 48 hours; (7) Wash the cells twice with PBS, stain the cell nuclei with Hoechst, wash with PBS three times after staining for 15 min, and let stand for 3 min each time. (8) Place the cell plate in an inverted fluorescence microscope to observe the fluorescence intensity, and collect the cells to detect the relative fluorescence intensity (EGFP / Hoechst) using an enzyme-linked immunosorbent assay (ELISA) reader.

[0024] The results are as follows Figure 8 As shown, the fluorescence intensity detection results 48 hours after transfection were observed using an inverted fluorescence microscope. When pCMV-EGFP-β8KRGGβ9 and p-JEV-NS2B / NS3-mCherry were co-transfected, NS3... proThe cleavage site in plasmid pCMV-EGFP-β8KRGGβ9 EGFP was successfully identified, leading to a decrease in EGFP fluorescence intensity. When the inhibitor ZINC03129319 was added, it successfully inhibited NS3. pro The expression, at this time NS3 pro The cleavage effect on EGFP is weakened, and the fluorescence intensity of EGFP is enhanced.

[0025] The above experimental results indicate that the main JEV protease NS3 of this invention pro The reporter plasmid has the potential to screen anti-JEV drugs.

Claims

1. A method for screening drugs against Japanese encephalitis virus, characterized in that: Using the main protease NS3 of Japanese encephalitis virus pro The activity reporter plasmid and the main protease NS3 of Japanese encephalitis virus pro Expression plasmids were used to screen for drugs against Japanese encephalitis virus; The main protease NS3 of the Japanese encephalitis virus pro The nucleotide sequence of the expression plasmid p-JEV-NS2B / NS3-mCherry is shown in SEQ ID NO:

1. NS3 is the major protease of Japanese encephalitis virus. pro The nucleotide sequence of the active reporter plasmid pCMV-EGFP-β8KRGGβ9 is shown in SEQ ID NO:

2.

2. The method for screening anti-Japanese encephalitis virus drugs according to claim 1, characterized in that: HEK-293T cells co-transfected with plasmids served as the control group. Cells co-transfected with plasmids were added to the drug to be screened as the experimental group. If the relative fluorescence intensity in the experimental group was higher than that in the control group, the drug to be screened was determined to be an anti-Japanese encephalitis virus drug.