Non-coding RNA detection kit based on crisper / cas12a and reverse transcriptase and application
This non-coding RNA detection kit using CRISPR/CtCas12a and reverse transcriptase solves the problems of non-specific amplification, low sensitivity, and high cost in existing technologies, achieving high-sensitivity and low-cost non-coding RNA detection suitable for rapid detection of a variety of targets.
Patent Information
- Application Number
- CN202610259724.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-04
- Publication Date
- 2026-06-09
AI Technical Summary
Existing non-coding RNA detection technologies suffer from problems such as non-specific amplification, low sensitivity, and high cost of detection system reconstruction. In particular, the detection technology based on CRISPR-Cas12a has a sensitivity limited to the pM level in direct detection mode, requires a pre-amplification step which increases operational complexity and the risk of aerosol contamination, and cannot directly detect RNA.
A non-coding RNA detection kit based on CRISPR/CtCas12a and reverse transcriptase is used to achieve target-triggered signal autocatalytic amplification by using CtCas12a protein, scaffold RNA, ssDNA activator, RT-spacer and LNA-modified detection probe, thereby improving detection sensitivity. Furthermore, the kit can be adapted to different target detection needs by using replaceable ssDNA activator sequences, thereby reducing the cost of reconstructing the detection system.
It achieves highly sensitive detection of non-coding RNA, capable of detecting samples at amol/L within 60 minutes, avoiding aerosol contamination, reducing detection costs, and has a simple reaction system that can adapt to different target detection needs.
Smart Images

Figure CN122168726A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of gene detection technology, specifically relating to a non-coding RNA detection kit based on CRISPR / CtCas12a and reverse transcriptase and its application. Background Technology
[0002] Cancer is a major global health challenge, claiming countless lives each year and posing complex obstacles to its management. Due to its alarming mortality rate, there is an urgent need to strengthen prevention and early detection and diagnosis. Early detection can not only reduce invasive treatments but also improve the chances of successful recovery. Non-coding RNAs (ncRNAs) play important regulatory roles in cancer, possessing diverse structures and functions. Depending on the cancer type, they act as oncogenes or tumor suppressors, complexly regulating genetic and epigenetic processes. Research has revealed that ncRNAs intricately connect gene networks, influencing important protein effectors that determine cellular responses and fate. Therefore, dysregulation of ncRNAs is closely related to disease development, and abnormal expression levels can also lead to further disease progression, making them advantageous as diagnostic biomarkers.
[0003] Currently, pathology remains the gold standard for diagnosing malignant tumors, requiring invasive procedures such as surgical resection or biopsy to obtain tissue specimens for diagnosis. Compared to pathological histology, the detection of ncRNAs in bodily fluids is relatively minimally invasive, making ncRNAs highly suitable as biomarkers for early cancer diagnosis.
[0004] In terms of detection methods, reverse transcription-quantitative polymerase chain reaction (RT-qPCR) has become the gold standard tool for detecting non-coding RNAs (such as miRNAs). Unlike long RNAs (such as mRNAs), short miRNAs require a special RT process to incorporate extended sequences that facilitate PCR amplification and detection. To replace thermal cycling-based qPCR, which requires complex analytical procedures and instruments, many isothermal assay-coupled techniques have been developed to improve miRNA detection, including rolling circle amplification (RCA), exponential amplification reaction (EXPAR), loop-mediated isothermal amplification (LAMP), hybridization chain reaction (HCR), and catalytic hairpin assembly (CHA). Although these methods offer advantages such as simplicity and even instrument-free operation, they also have drawbacks that limit their widespread clinical application, such as the non-specific amplification and high background of EXPAR and LAMP, and the relatively slow kinetics and low sensitivity of HCR and CHA.
[0005] In recent years, CRISPR / Cas systems have demonstrated great potential in the field of molecular diagnostics due to their specific recognition capabilities. In particular, the CRISPR-Cas12a system exhibits non-specific cleavage activity (trans cleavage) after target recognition, providing a new approach for nucleic acid detection. However, existing CRISPR-Cas12a-based detection technologies still suffer from the following technical bottlenecks: 1) Limited sensitivity: In direct detection mode, the detection limit of Cas12a for DNA targets is only at the pM level; 2) Amplification dependence: Existing technologies (such as DETECTR) must rely on pre-amplification steps (RPA or PCR), which not only increases operational complexity but also raises the risk of aerosol contamination; 3) Poor compatibility with multiple target detection types: crRNA needs to be redesigned for different targets, resulting in high detection costs; 4) Inability to directly detect RNA, often requiring reverse transcription to convert RNA signals into DNA signals before DNA detection, increasing detection costs and complexity.
[0006] Therefore, developing a novel, pre-amplified non-coding RNA detection kit based on CRISPR / CtCas12a and reverse transcriptase has significant clinical application value. Summary of the Invention
[0007] The purpose of this invention is to provide a non-coding RNA detection kit and its application based on CRISPR / CtCas12a and reverse transcriptase. This kit addresses the problems of non-specific amplification, low sensitivity, and high cost of reconstructing detection systems in existing non-coding RNA detection technologies.
[0008] In a first aspect, the present invention provides a non-coding RNA detection kit based on CRISPR / CtCas12a and reverse transcriptase, comprising CtCas12a protein, scaffold RNA, ssDNA activator, RT-spacer, LNA-modified detection probe and reverse transcriptase; wherein the ssDNA activator is complementary to the non-coding RNA sequence to be tested, and the RT-spacer is complementary to the LNA-modified detection probe sequence.
[0009] In this invention, the inventors discovered that when using this non-coding RNA detection kit to detect the target non-coding RNA sequence, the CtCas12a protein cleaves the LNA-modified detection probe, releasing a 6-nt single-stranded DNA. This single-stranded DNA and the RT-spacer, under the action of reverse transcriptase, form a hybrid double strand, thereby reactivating the trans-cleavage activity of the CtCas12a protein, releasing a fluorescent signal, and achieving target-triggered signal autocatalytic amplification. Compared to existing technologies, this invention enhances cleavage specificity and improves detection sensitivity through LNA modification; furthermore, the replaceable ssDNA activator sequence can adapt to different target detection needs, reducing the cost of reconstructing the detection system.
[0010] In some implementations, the nucleotide sequence of the gene encoding the CtCas12a protein is shown in SEQ ID NO:1.
[0011] In some implementations, the nucleotide sequence of scaffold RNA is shown in SEQ ID NO:2.
[0012] In some implementations, the nucleotide sequence of the RT-spacer is shown in SEQ ID NO:3.
[0013] In some implementations, the nucleotide sequence of the LNA-modified detection probe is 5'-GAACGCTTAAC-3', and the first base G, the fourth base C, and the tenth base A in the sequence from 5' to 3' are modified with LNA; the 5' end of the detection probe is modified with a fluorescent group, and the 3' end is modified with a quenching group; the reverse transcriptase includes M-MLV reverse transcriptase.
[0014] In some embodiments, the fluorescent group includes FAM, and the quenching group includes BHQ1.
[0015] In some implementations, the non-coding RNA detection kit also includes reagents required for the reaction; wherein, the reagents required for the reaction include buffer, Mn 2+ At least one of L-proline and dNTP mixture.
[0016] In a second aspect, the present invention provides a method for detecting non-coding RNA using any of the above-mentioned non-coding RNA detection kits, comprising the following steps: mixing CtCas12a protein, scaffold RNA, ssDNA activator, RT-spacer and buffer and incubating the mixture, then adding an LNA-modified detection probe, reverse transcriptase, and Mn... 2+The mixture of L-proline and dNTPs was followed by a cleavage reaction. After the reaction, fluorescence detection was performed, and the non-coding RNA was detected based on the intensity of the fluorescence signal.
[0017] In some implementations, the concentration of CtCas12a protein is 1-3 μM, the concentration of scaffold RNA is 0.5-2 μM, the concentration of ssDNA activator is 400-600 nM, the concentration of RT-spacer is 400-600 nM, the concentration of LNA-modified detection probe is 0.5-2 μM, and the concentration of reverse transcriptase is 0.1-1 U / μL.
[0018] In a third aspect, the present invention provides the application of any of the above-described non-coding RNA detection kits or methods for detecting non-coding RNA in the detection of non-coding RNA.
[0019] The beneficial effects of this invention are as follows: Unlike existing technologies, the non-coding RNA detection kit provided by this invention, when detecting the target non-coding RNA sequence, involves the CtCas12a protein cleaving the LNA-modified detection probe and releasing a 6nt single-stranded DNA. This single-stranded DNA and the RT-spacer, under the action of reverse transcriptase, form a hybrid double strand, thereby reactivating the trans-cleavage activity of the CtCas12a protein and releasing a fluorescent signal, achieving target-triggered signal autocatalytic amplification. Compared to existing technologies, this invention enhances cleavage specificity and improves detection sensitivity through LNA modification; furthermore, the replaceable ssDNA activator sequence can adapt to different target detection requirements, reducing the cost of reconstructing the detection system; therefore, it has good application prospects in non-coding RNA detection. Attached Figure Description
[0020] Figure 1 This is a schematic diagram illustrating the working principle of the non-coding RNA detection kit based on CRISPR / CtCas12a and reverse transcriptase in this invention. Figure 2 This is an SDS-PAGE image of the CtCas12a protein in Example 1 of the present invention; Figure 3 The image shows a TBE-PAGE electrophoresis diagram of hybrid double strands synthesized by primers of different lengths during the reverse transcription process in Example 2 of this invention. In this diagram, L1 represents primers of different lengths, L2 represents primer + template, and L3 represents the product of primer + template + reverse transcriptase reaction. Figure 4 This is a graph showing the fluorescence intensity analysis results of the hybrid double-stranded primers synthesized with different lengths during the reverse transcription process in Example 2 of this invention to activate the cleavage activity of CtCas12a. Figure 5This is a graph showing the results of the analysis of the cleavage activity of ss 6nt under M-MLV and the cleavage activity of RT-20nt in Example 2 of the present invention. Figure 6 This is a TBE-PAGE electrophoresis image of CtCas12a cleaved LNA-p in Embodiment 2 of the present invention; Figure 7 This is a graph showing the fluorescence intensity detection and analysis results of LNA-p and DNA-p, and conventional Cas12a cleavage activity in Example 2 of the present invention; Figure 8 This is an analysis of the fluorescence intensity detection results of different molar ratios of CtCas12a protein and scaffold RNA in Example 3 of the present invention; Figure 9 This is an analysis of the fluorescence intensity detection results for reactions with different CtCas12a protein concentrations in Example 3 of the present invention; Figure 10 This is an analysis graph showing the fluorescence intensity detection results of reactions with different L-proline concentrations in Example 3 of the present invention; Figure 11 Different Mg in Example 3 of the present invention 2+ Analysis of fluorescence intensity detection results for concentration reaction; Figure 12 The graph shows the sensitivity detection results of two different targets using the non-coding RNA detection kit in Example 4 of this invention. The left graph shows the miRNA detection results, and the right graph shows the lncRNA detection results. Figure 13 The image shows the results of testing two actual samples using a non-coding RNA detection kit in Example 5 of this invention. (A) is a cultured cell sample, and (B) is a clinical tissue sample. Detailed Implementation
[0021] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.
[0022] Experimental methods not specifically described in the examples are generally performed according to conventional experimental methods in the field of molecular biology, including but not limited to those described in *Molecular Cloning: A Laboratory Manual* by M.R. Green and *Molecular Biology* by Robert F. Weaver, or according to the experimental methods recommended by the reagent kit and instrument manufacturers. Unless otherwise specified, all reagents and biological materials used in the examples are commercially available.
[0023] Currently, researchers have conducted in-depth research on the trans-cleavage activity of Cas12a, and its non-specific cleavage ability of single-stranded DNA has been widely used in the field of nucleic acid detection. However, CRISPR-Cas12a-based sensors (such as DETECTR and CDetection technologies) rely on pre-amplification steps (RPA or PCR), leading to increased operational steps and the risk of aerosol contamination. Furthermore, these sensors target only DNA molecules, resulting in limited target detection and long detection times. They also suffer from non-specific amplification, low sensitivity, and high system reconstruction costs.
[0024] To address the problems of non-specific amplification, low sensitivity, and high cost of detection system reconstruction in existing non-coding RNA detection technologies, this invention provides a non-coding RNA detection kit and its application based on CRISPR / CtCas12a and reverse transcriptase.
[0025] In a first aspect, the present invention provides a non-coding RNA detection kit based on CRISPR / CtCas12a and reverse transcriptase, comprising CtCas12a protein, scaffold RNA, ssDNA activator, RT-spacer, LNA-modified detection probe and reverse transcriptase; wherein the ssDNA activator is complementary to the non-coding RNA sequence to be tested, and the RT-spacer is complementary to the LNA-modified detection probe sequence.
[0026] In the non-coding RNA detection kit provided by this invention, when the target non-coding RNA sequence is detected using this kit, the CtCas12a protein cleaves the LNA-modified detection probe and releases a 6-nt single-stranded DNA. This single-stranded DNA and the RT-spacer form a hybrid double strand under the action of reverse transcriptase, thereby reactivating the trans-cleavage activity of the CtCas12a protein and releasing a fluorescent signal, achieving target-triggered signal autocatalytic amplification. Compared with existing technologies, this invention enhances cleavage specificity and improves detection sensitivity through LNA modification; furthermore, the replaceable ssDNA activator sequence can adapt to different target detection needs, reducing the cost of reconstructing the detection system.
[0027] In some implementations, the nucleotide sequence of the gene encoding the CtCas12a protein is shown in SEQ ID NO:1.
[0028] In this invention, the CtCas12a protein is selected because it has high recognition efficiency for the RNA target and has specific trans-cleavage activity.
[0029] In some implementations, the preparation method of CtCas12a protein includes the following steps: artificially synthesizing the CtCas12a gene (which contains 6 His markers at its C-terminus), constructing it on the prokaryotic expression vector pET-28a(+) to obtain the expression plasmid pET-28a-CtCas12a, transforming it into BL21(DE3) competent cells, and obtaining recombinant genetically engineered bacteria after screening; inducing expression in the recombinant genetically engineered bacteria to obtain a culture; and isolating the CtCas12a protein from the culture.
[0030] Understandably, the transformation of expression plasmid pET-28a-CtCas12a, the induction of recombinant genetically engineered bacteria, and the isolation of cultures are all conventional techniques in the existing technology.
[0031] In some implementations, the nucleotide sequence of scaffold RNA is shown in SEQ ID NO:2.
[0032] In some implementations, the nucleotide sequence of the RT-spacer is shown in SEQ ID NO:3.
[0033] In this invention, by selecting a specific RT-spacer, a 6nt single-stranded DNA released from an LNA-modified detection probe is formed into a hybrid double strand under the action of reverse transcriptase, thereby reactivating the trans-cleavage activity of the CtCas12a protein and releasing a fluorescent signal, thus achieving the detection of the target.
[0034] In some implementations, the nucleotide sequence of the LNA-modified detection probe is 5'-GAACGCTTAAC-3', and the first base G, the fourth base C, and the tenth base A in the sequence from 5' to 3' are modified with LNA; the 5' end of the detection probe is modified with a fluorescent group, and the 3' end is modified with a quenching group; the reverse transcriptase includes M-MLV reverse transcriptase.
[0035] In this invention, a detection probe modified with LNA is used. After being cleaved by CtCas12a protein, a 6nt single-stranded DNA is released. This single-stranded DNA and the RT-spacer form a hybrid double strand under the action of reverse transcriptase, which in turn reactivates the trans-cleavage activity of CtCas12a protein and releases a fluorescent signal. This achieves target-triggered signal autocatalytic amplification, thereby significantly improving the sensitivity for non-coding RNA detection.
[0036] In some embodiments, the fluorescent group includes FAM, and the quenching group includes BHQ1.
[0037] It is understandable that the types of fluorescent groups and quenching groups can be conventionally selected according to actual application needs, as long as efficient fluorescence detection is achieved. For example, in this invention, the fluorescent group preferably includes FAM, and the quenching group preferably includes BHQ1.
[0038] In some implementations, the non-coding RNA detection kit also includes reagents required for the reaction; wherein, the reagents required for the reaction include buffer, Mn 2+ At least one of L-proline and dNTP mixture.
[0039] It is understandable that the types of reagents required for the reaction can be conventionally selected according to actual needs, as long as the reaction can proceed efficiently. For example, in this invention, the reagents required for the reaction preferably include buffer solution and Mn. 2+ At least one of L-proline and dNTP mixture.
[0040] In a second aspect, the present invention provides a method for detecting non-coding RNA using any of the above-mentioned non-coding RNA detection kits, comprising the following steps: mixing CtCas12a protein, scaffold RNA, ssDNA activator, RT-spacer and buffer and incubating the mixture, then adding an LNA-modified detection probe, reverse transcriptase, and Mn... 2+ The mixture of L-proline and dNTPs was followed by a cleavage reaction. After the reaction, fluorescence detection was performed, and the non-coding RNA was detected based on the intensity of the fluorescence signal.
[0041] The detection method provided by this invention is simple and adopts a "one-pot" reaction system, which effectively avoids false positives caused by aerosol contamination. In addition, the detection method of this invention can detect amol / L non-coding RNA samples within 60 minutes and has the characteristics of fast response and low sensitivity.
[0042] In some embodiments, the concentration of CtCas12a protein is 1-3 μM, preferably 2 μM; the concentration of scaffold RNA is 0.5-2 μM, preferably 1 μM; the concentration of ssDNA activator is 400-600 nM, preferably 500 nM; the concentration of RT-spacer is 400-600 nM, preferably 500 nM; the concentration of LNA-modified detection probe is 0.5-2 μM, preferably 1 μM; and the concentration of reverse transcriptase is 0.1-1 U / μL, preferably 0.2 U / μL.
[0043] In some implementations, the buffer includes rCutSmart buffer, Mn 2+ The concentration of [unspecified substance] is 10-30 mM, preferably 20 mM; the concentration of L-proline is 50-150 mM, preferably 100 mM.
[0044] In a third aspect, the present invention provides the application of any of the above-described non-coding RNA detection kits or methods for detecting non-coding RNA in the detection of non-coding RNA.
[0045] The following are some specific embodiments. It should be noted that the embodiments described below are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention.
[0046] Please see Figure 1This diagram illustrates the working principle of the CRISPR / CtCas12a and reverse transcriptase-based non-coding RNA detection kit in this invention. Specifically, scaffold RNA, RT-spacer, ssDNA activator, CtCas12a protein, and buffer are first mixed and incubated to preassemble the scaffold RNA, ssDNA activator, RT-spacer, and CtCas12a protein into a ribonucleoprotein complex (RNP). Upon addition of the target, the cleavage activity of CtCas12a protein is activated, cleaving the LNA-modified detection probe (LNA-p) and releasing a 6nt single-stranded DNA. This single strand, along with the RT-spacer, synthesizes a hybrid double strand under the action of reverse transcriptase (M-MLV), which further activates the trans-cleavage activity of CtCas12a protein, releasing a fluorescent signal. This forms an autocatalytic cycle of "target recognition - primer cleavage - new activator generation - signal amplification," ultimately detecting the target nucleic acid by detecting the intensity of the fluorescent signal.
[0047] Example 1: Preparation of CtCas12a protein This embodiment provides a method for preparing CtCas12a protein.
[0048] Specifically, it includes the following steps: The CtCas12a gene, labeled with 6 His nucleotides at the C-terminus, was cloned into the pET-28a vector (+) to obtain the expression plasmid pET-28a-CtCas12a. This plasmid was then transformed into BL21(DE3) competent cells. After screening, E. coli BL21(DE3) containing the CtCas12a protein construct were obtained and grown in TB broth at 37°C until OD (Occurrence Discharge). 600 After reaching a pH of 0.6-0.8, CtCas12a protein expression was induced at 18°C for 16-18 hours with the addition of IPTG. The bacterial culture was collected and resuspended in 20 mM Tris-HCl buffer (pH 7.4, containing 500 mM NaCl), followed by sonication to disrupt the bacterial cell structure. The culture was then centrifuged at 10000 x g for 1 hour, and the supernatant was collected. The supernatant was filtered through a 0.22 μm filter, and the supernatant was fractionally bound to HisTrap HP (GE Healthcare) and eluted in a buffer with an imidazole gradient (20 mM Tris-HCl, pH 7.4, containing 500 mM NaCl). The protein was collected at the expected size. The protein was concentrated by ultrafiltration and quantified using a BCA protein assay kit. Finally, the protein was placed in 20 mM Tris-HCl (pH 7.4, containing 200 mM NaCl and 50% (v / v) glycerol) and frozen at 80°C for future use.
[0049] The nucleotide sequence of the CtCas12a gene, after codon optimization for E. coli, is shown below:
[0050] The purified CtCas12a protein was analyzed by SDS-PAGE, and the results are as follows: Figure 2 As shown.
[0051] from Figure 2 As can be seen, the size of the CtCas12a protein is consistent with the theoretical expectation, indicating that the CtCas12a protein was successfully expressed.
[0052] Example 2: Establishment of a non-coding RNA detection method based on CRISPR / CtCas12a and reverse transcriptase In this embodiment, the aim is to establish a non-coding RNA detection method based on CRISPR / CtCas12a and reverse transcriptase.
[0053] 2.1 Preliminary screening of RT-primer (single-stranded DNA released by LNA-modified detection probe) First, 11 single-stranded DNA sequences partially complementary to the RT-spacer sequence were designed, and the specific sequences are shown in Table 1 below.
[0054] Table 1 Sequence List
[0055] All of the above sequences were artificially synthesized. Furthermore, the ssDNA reporter was modified with the fluorescent group FAM at the 5' end and the quencher group BHQ1 at the 3' end.
[0056] 2.1.1 Test Method 1) Establish the reverse transcription reaction system: 0.5 ng RT-spacer, 20 pmol SS 5nt-SS 15nt, 2 μl 5×Reaction Buffer, 0.8 μl dNTP Mixture, 1 μl M-MLV (reverse transcriptase), and add enzyme-free water to 10 μl; react the above reaction system at 42℃ for 1 h.
[0057] 2) Establish the annealing system (to form local double strands): 4 μl of SS 5nt-SS 15nt, 4 μl of RT-spacer, and 2 μl of 5×Reaction Buffer; react the above reaction system at 95℃ for 5 min, and then gradually cool down to 25℃ for 10 min.
[0058] 3) After the reaction, add 2×TBE-PAGE electrophoresis loading buffer, incubate at 70℃ for 5 min, perform 20% TBE-PAGE electrophoresis, and stain with super RED nucleic acid dye in the dark for 15 min to verify whether a heterozygous double strand has been formed.
[0059] 4) Establish the cleavage reaction system: 1 μM CtCas12a protein, 500 nM scaffold RNA, 500 nM RT-spacer, ss 6nt, 0.2 μl dNTP mixture, 0.1 μl M-MLV or RT-20nt, 1 μM ssDNA reporter, and add enzyme-free water to a final volume of 10 μl; incubate the above reaction system at 37°C for 1 h. After the reaction, perform fluorescence detection.
[0060] 2.1.2 Test Results TBE-PAGE electrophoresis results are as follows: Figure 3 As shown, when the single-strand length is greater than 6nt, a 20bp hybrid double strand is efficiently formed by M-MLV and RT-spacer.
[0061] Fluorescence detection results as follows Figure 4 As shown, except for ss 5nt, ss 6nt-ss15nt all exhibit significant cleavage activity of CtCas12a under the action of M-MLV.
[0062] Further fluorescence detection results are as follows Figure 5 As shown, the cleavage activity of ss 6nt is comparable to that of the fully complementary chain RT-20nt.
[0063] 2.2 Design of LNA-p (LNA-modified detection probe) and identification of its cleavage activity Primers were designed using the ss 6nt primer and incorporated the Ct binding property of Cas12a to cleave the reporter. The specific design principle was based on a GC content between 40% and 60%. The primer design is as follows: LNA-p:5'-GAACGCTTAAC-3' (black bases indicate locked nucleic acid modification); DNA-p:5'-GAACGCTTAAC-3'; In the above primers, the 5' end is modified with the fluorescent group FAM, and the 3' end is modified with the quencher group BHQ1.
[0064] 2.2.1 Test Method 1) Synthesize DNA-p and LNA-p separately.
[0065] 2) Establish the cleavage system: 2 μM CtCas12a protein, 1 μM scaffold RNA, 500 nM RT-spacer, 500 nM activator (nucleotide sequence: TCAACATCAGTCTGATAAGCTA (SEQ ID NO:11)), 1 μl rCutSmart buffer, incubate at 37°C for 10 min; after incubation, add 1 μl LNA-p, 0.2 μl dNTP Mixture, 0.1 μl M-MLV, and 0.1 μl Mg 2+ Add 1 μl of L-proline, and finally add 1 μl of the target (its nucleotide sequence is as follows: UAGCUUAUCAGACUGAUGUUGA (SEQ ID NO:12)), and add enzyme-free water to a final volume of 10 μl; incubate the above reaction system at 37°C for 1 h.
[0066] 3) After the reaction, add the LNA-p cleavage reaction system to 2×TBE-PAGE electrophoresis loading buffer, incubate at 70℃ for 5 min, perform 20% TBE-PAGE electrophoresis, and stain with super RED nucleic acid dye in the dark for 15 min to verify whether the LNA-modified primers were successfully cleaved at the target site.
[0067] 2.2.2 Test Results TBE-PAGE electrophoresis results are as follows: Figure 6 As shown, LNA-p was successfully cleaved into 5-6 nt.
[0068] 2.3 Validation of the Detection Method's Principle 2.3.1 Constructing the reaction system 1) First, mix 2 μM CtCas12a protein, 1 μM scaffold RNA, 500 nM RT-spacer, 500 nM activator (consistent with 2.2.1), and 1 μl of 10X rCutSmart buffer; incubate at 37°C for 10 min. 2) After incubation, add 1 μl of LNA-p / DNA-p (LNA-free monochromatic probe), 0.2 μl of dNTP Mixture, 0.1 μl of M-MLV, and 1 μl of low-concentration target (1 nM, as in 2.2.1) to the system, and add enzyme-free water to a final volume of 10 μl; incubate the reaction at 37°C for 1 h. 3) After the reaction is complete, the above reaction system is subjected to fluorescence detection.
[0069] 2.3.1 Test Results Fluorescence detection results as follows Figure 7As shown, LNA-p, after LNA modification, is cleaved at specific sites to obtain RT-primer, ensuring the high efficiency of DNA-RNA hybrid strand synthesis by binding to reverse transcriptase in the cycle, effectively regulating the cleavage of CtCas12a protein, thereby overcoming the problems of undetectable at low concentrations and background interference from random DNA-p cleavage in the traditional Cas12a system; the results demonstrate that LNA-p and M-MLV work synergistically to achieve the effect of signal autocatalytic amplification.
[0070] Example 3: Optimization of reaction conditions in a non-coding RNA detection method based on CRISPR / CtCas12a and reverse transcriptase In this embodiment, the reaction conditions in the non-coding RNA detection method are optimized to determine the optimal detection system.
[0071] First, the target concentration was fixed at 1 nM (consistent with 2.2.1), and the optimal reaction conditions were screened according to the detection system constructed in Example 2. Specifically, the following steps were included: 1) Prepare reaction systems with CtCas12a protein and scaffold RNA molar ratios of 1:10, 1:4, 1:2, 1:1, and 2:1, respectively, and perform cleavage reactions. After reacting at 37°C for 1 hour, the fluorescence intensity of each reaction system is detected. The detection results are as follows: Figure 8 As shown.
[0072] from Figure 8 It can be seen that a molar ratio of 2:1 is more conducive to nucleic acid testing.
[0073] 2) Prepare cleavage reaction systems with final CtCas12a protein concentrations of 2 μM, 1 μM, 600 nM, 300 nM, and 100 nM at a molar ratio of 2:1. After reacting at 37℃ for 1 h, the fluorescence intensity of each reaction system was detected. The detection results are as follows: Figure 9 As shown.
[0074] from Figure 9 As can be seen, a final CtCas12a protein concentration of 2 μM is more conducive to nucleic acid detection.
[0075] 3) Prepare cleavage reaction systems with additional L-proline at final concentrations of 200 mM, 100 mM, 50 mM, 25 mM, and 10 mM, respectively. After reacting at 37°C for 1 h, the fluorescence intensity of each reaction system was detected. The detection results are as follows: Figure 10 As shown.
[0076] from Figure 10 As can be seen, a final L-proline concentration of 100 mM is more conducive to nucleic acid detection.
[0077] 4) Prepare separate configurations with additional Mg.2+ The cleavage reaction systems with final concentrations of 40 mM, 20 mM, 10 mM, 5 mM, and 1 mM were reacted at 37°C for 1 h. The fluorescence intensity of each reaction system was then measured, and the results are as follows: Figure 11 As shown.
[0078] from Figure 11 It can be seen from this that Mg 2+ A final concentration of 20mM is more conducive to nucleic acid detection.
[0079] Example 4: Sensitivity detection of a non-coding RNA detection kit based on CRISPR / CtCas12a and reverse transcriptase In this embodiment, the sensitivity of the non-coding RNA detection kit is tested to determine the performance of the non-coding RNA detection kit.
[0080] Specifically, the miRNA sample to be tested (its nucleotide sequence is as follows: UAGCUUAUCAGACUGAUGUUGA (SEQ ID NO:13), and the corresponding activator is as follows: TCAACATCAGTCTGATAAGCTA (SEQ ID NO:14)) and Lnc.RNAHULC (its nucleotide sequence is as follows: AUGGGGGUGAACUCAUGAUGGAAUUGGAGCCUUUACAAGGGAAUGAAGAGACAAGAGCUCUCUUUAUGCCACGUGAGGAUACAGCAAGGCCCCAAUCUG (SEQ ID NO:15), and the corresponding activator is as follows: GAGAGGCTCTTGTCTCTTCATT (SEQ ID NO:16)) were successively diluted to 1 nmol / L, 1 pmol / L, 1 fmol / L, 10 amol / L, and 0.5 amol / L for sensitivity testing.
[0081] The optimal final concentrations of CtCas12a protein and scaffold RNA, as screened in Example 3, were 2 μM and 1 μM, respectively, with Mg... 2+ The final concentration was 20 mM, and the final concentration of L-proline was 100 mM. Target concentrations of 1 nmol / L, 1 pmol / L, 1 fmol / L, 10 amol / L, and 0.5 amol / L were used, with enzyme-free water as a negative control. CtCas12a cleavage was performed, and fluorescence signals at different concentrations were detected. The results are as follows: Figure 12 As shown.
[0082] from Figure 12 As can be seen, the non-coding RNA detection kit provided by this invention has a low detection limit for miRNA and Lnc.RNAHULC.
[0083] Example 5: Detection of real samples using a non-coding RNA detection method based on CRISPR / CtCas12a and reverse transcriptase. 5.1 HepG2 cell resuscitation and passage 5.1.1 Cell resuscitation 1) Preheat the water bath to 37°C, warm the culture medium to room temperature or 37°C, and set the centrifuge speed accordingly; 2) Remove the cells from the liquid nitrogen tank. If there is no liquid nitrogen in the tube, pinch the cap and immerse the frozen part of the cells in a water bath and shake it quickly. Stop the water bath when the cells melt into ice cubes the size of rice grains. The melting process should not exceed 2 minutes. 3) Centrifuge the frozen tubes directly at a centrifugal force of about 150g (about 900rpm) for 2 minutes. The specific speed may vary depending on the centrifuge. 4) After centrifugation, discard the supernatant, slowly add preheated culture medium to the cryovial, gently resuspend the cells, then seed them into a culture flask, mix gently, and place in an incubator. 5) Observe cell adhesion 24 hours after resuscitation.
[0084] 5.1.2 Cell passage 1) Prepare the necessary culture medium (DMEM medium), trypsin, PBS, centrifuge tubes, culture flasks, and sterile pipette tips, etc., and preheat the reagents in advance; 2) Remove the culture medium from the culture flask, add 5 mL of PBS to rinse 1-2 times to remove residual culture medium; 3) After absorbing as much of the rinsed PBS as possible, add 1 mL of trypsin, shake to evenly cover the bottom of the bottle with trypsin, and place in an incubator at 37°C for digestion. 4) During digestion, take the culture flask out every 1 minute to observe. Under the microscope, you can see that the cells have obviously shrunk. When some cells start to detach from the culture flask by gently tapping it, immediately add 3-4 mL of serum-containing culture medium to stop the digestion. Blow off the adherent cells (be careful to control the force of blowing gently and do not blow too many times to avoid mechanical damage). 5) Transfer the cell suspension to a centrifuge tube and centrifuge at 1000 rpm for 3 min to collect the cells; 6) Add an appropriate amount of fresh culture medium to the new culture flask; 7) After centrifugation, discard the supernatant, add an appropriate amount of fresh culture medium, gently resuspend and disperse the cells, and evenly inoculate the cell suspension into the culture flask. Mix well using the cross method or figure-eight method, and then place it in the incubator to continue culturing. Note that the culture flask cap should be ventilated.
[0085] 5.2 HEK293T cell resuscitation and passage 5.2.1 Cell resuscitation 1) Remove the cryovials from liquid nitrogen or a -80°C freezer container and immerse them directly in 37°C warm water, shaking them occasionally to thaw them as quickly as possible; 2) Remove the cryovial from the 37°C water bath, open the cap in the laminar flow hood, aspirate the cell suspension with a pipette tip, add it to a 15ml centrifuge tube (3ml of complete cell culture medium has been added to the centrifuge tube beforehand), and gently tap to mix. 3) Centrifuge at 1000 rpm for 5 minutes; 4) Discard the supernatant, gently tap to resuspend the cells, add cell culture medium containing 10% FBS, gently tap to resuspend the cells, adjust the cell density, inoculate into culture dishes, and incubate at 37°C. 5) Change the culture medium the next day and continue culturing.
[0086] 5.2.2 Cell passage 1) Remove the cell culture dish (60mm) from the CO2 incubator after the cells have grown into a monolayer, and aspirate the culture medium from the bottle in a laminar flow hood; 2) Add 2 ml of 1×PBS, gently rotate the culture dish to wash the cells, and discard the 1×PBS. 3) Add 0.5 ml of trypsin and let stand for 3-5 minutes; 4) During the static period, observe the digested cells under an inverted microscope. If the cells become round and no longer connect with each other, immediately add 2 times the volume of complete culture medium (containing serum) to the laminar flow hood. Add 1 ml of complete culture medium this time, pipette, and prepare a cell suspension. 5) Aspirate the cell suspension and place it in a 15ml centrifuge tube. Centrifuge at 1000rpm for 5min. 6) Discard the digestive fluid and gently tap the bottom of the centrifuge tube to resuspend the cells initially; 7) Add 1.5 ml of complete culture medium to the cells and mix well by pipetting. 8) Take out two new 60mm culture dishes, add 2.5ml of complete culture medium to each, and add 2.5ml of complete culture medium to the original digestion dish as well, and label them; 9) Add 0.5 ml of cell suspension from the centrifuge tube to each of the three culture dishes in a quincunx pattern; 10) Blow the cells several times with the pipette tip and incubate them in a carbon dioxide incubator.
[0087] 5.3 Extraction and Detection of Total Cell RNA Total RNA was extracted from HepG2 and HEK293T cell samples using RNAiso from Takara. Next, 1 μL of RNA solution was mixed with the detection reaction components in a 10 μL reaction volume, including a final concentration of 1X NEB rCutSmartbuffer, 2 μM CtCas12a protein, 1 μM scaffold RNA, 500 nM RT-spacer, 500 nM activator (its nucleotide sequence is as follows: same as SEQ ID NO:16, and the corresponding target RNA nucleotide sequence is as follows: same as SEQ ID NO:15), and 20 mM mg. 2+ 100 mM L-proline, 1 μM LNA-P, and 0.2 U / μL M-MLV were used. Measurements were taken at 37°C for 1 h at five-minute intervals using a LineGene 9600 Plus real-time PCR system.
[0088] 5.4 Extraction and Detection of Total RNA from Human Tissue Samples Colorectal cancer tissue and adjacent normal tissue were collected, flash-frozen in liquid nitrogen, and then placed in RNA preservation solution. miRNA was extracted from clinical tissue samples using the miRcute kit from TIANGEN (Beijing, China). Next, 1 μl of miRNA solution was mixed with the detection reaction components in a 10 μL reaction volume, including 1X NEB rCutSmart buffer, 2 μM tCas12a protein, 1 μM scaffold RNA, 500 nM RT-spacer, 500 nM activator (its nucleotide sequence is as follows: same as SEQ ID NO:14, and the corresponding target RNA nucleotide sequence is as follows: same as SEQ ID NO:13), and 20 mM Mg... 2+ 100 mL M-proline, 1 μM LNA-p, and 0.2 U / μL M-MLV were used. Measurements were taken at 37°C for 1 h at five-minute intervals using a LineGene 9600 Plus real-time PCR system.
[0089] The above fluorescence detection results are as follows Figure 13 As shown in the figure, the detection kit provided by the present invention can be used for the detection of non-coding RNA samples.
[0090] In summary, when the non-coding RNA detection kit provided by this invention detects the non-coding RNA sequence to be tested, the CtCas12a protein cleaves the LNA-modified detection probe and releases a 6nt single-stranded DNA. This single-stranded DNA and the RT-spacer form a hybrid double strand under the action of reverse transcriptase, thereby reactivating the trans-cleavage activity of the CtCas12a protein, releasing a fluorescent signal, and realizing target-triggered signal autocatalytic amplification.
[0091] It should be noted that all the above embodiments belong to the same inventive concept, and the descriptions of each embodiment have different focuses. Where the description in a particular embodiment is not detailed, please refer to the description in other embodiments.
[0092] The embodiments described above are merely illustrative of implementation methods of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.
Claims
1. A non-coding RNA detection kit based on CRISPR / CtCas12a and reverse transcriptase, characterized in that, It includes CtCas12a protein, scaffold RNA, ssDNA activator, RT-spacer, LNA-modified detection probe, and reverse transcriptase; The ssDNA activator is complementary to the non-coding RNA sequence to be tested, and the RT-spacer is complementary to the LNA-modified detection probe sequence.
2. The non-coding RNA detection kit according to claim 1, characterized in that, The nucleotide sequence of the gene encoding the CtCas12a protein is shown in SEQ ID NO:
1.
3. The non-coding RNA detection kit according to claim 1, characterized in that, The nucleotide sequence of the scaffold RNA is shown in SEQ ID NO:
2.
4. The non-coding RNA detection kit according to claim 1, characterized in that, The nucleotide sequence of the RT-spacer is shown in SEQ ID NO:
3.
5. The non-coding RNA detection kit according to claim 1, characterized in that, The nucleotide sequence of the LNA-modified detection probe is 5'-GAACGCTTAAC-3', and the first base G, the fourth base C, and the tenth base A in the 5'-3' sequence of the detection probe are modified with LNA. The detection probe is modified with a fluorescent group at its 5' end and a quenching group at its 3' end; The reverse transcriptase includes M-MLV reverse transcriptase.
6. The non-coding RNA detection kit according to claim 5, characterized in that, The fluorescent group includes FAM, and the quenching group includes BHQ1.
7. The non-coding RNA detection kit according to claim 1, characterized in that, The non-coding RNA detection kit also includes reagents required for the reaction; The reagents required for the reaction include buffer solution and Mn. 2+ At least one of L-proline and dNTP mixture.
8. A method for detecting non-coding RNA using the non-coding RNA detection kit according to any one of claims 1-7, characterized in that, Includes the following steps: CtCas12a protein, scaffold RNA, ssDNA activator, RT-spacer, and buffer were mixed and incubated. Then, LNA-modified detection probe, reverse transcriptase, and Mn were added. 2+ The mixture of L-proline and dNTPs was followed by a cleavage reaction. After the reaction, fluorescence detection was performed, and the non-coding RNA was detected based on the intensity of the fluorescence signal.
9. The detection method according to claim 8, characterized in that, The concentration of the CtCas12a protein is 1-3 μM, the concentration of the scaffold RNA is 0.5-2 μM, the concentration of the ssDNA activator is 400-600 nM, the concentration of the RT-spacer is 400-600 nM, the concentration of the LNA-modified detection probe is 0.5-2 μM, and the concentration of the reverse transcriptase is 0.1-1 U / μL.
10. The application of the non-coding RNA detection kit according to any one of claims 1-7 or the non-coding RNA detection method according to any one of claims 8-9 in the detection of non-coding RNA.