Rigid-response fluorescence polarization biosensor for detecting aflatoxin b1 and application thereof

By combining aptamer-complementary double-stranded complex, rolling circle amplification, and CRISPR/Cas12a detection system, and utilizing fluorescence polarization to output signals, the high cost and interference problems of AFB1 detection in existing technologies are solved, achieving food safety detection with high sensitivity and stability.

CN122168728APending Publication Date: 2026-06-09JIAXING UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610430655.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-02
Publication Date
2026-06-09

AI Technical Summary

Technical Problem

Existing AFB1 detection methods rely on expensive instruments and complex sample pretreatment. Furthermore, the fluorophore-quencher reporter probes suffer from photobleaching and quenching efficiency fluctuations, affecting the robustness and sensitivity of the detection, especially in complex food matrices where interference is severe.

Method used

The system employs a combination of target recognition unit, signal amplification unit, signal conversion unit, and signal output unit, including an aptamer-complementary double-stranded complex that specifically recognizes AFB1, a rolling circle amplification reaction system, a CRISPR/Cas12a detection system, and a conformation-restricted depolarization reporter, and achieves signal output through fluorescence polarization.

Benefits of technology

It achieves AFB1 detection with high sensitivity, strong anti-interference ability, and simple operation. The detection limit can be as low as 0.00113 ng/mL, with a wide linear range, and is suitable for rapid detection in complex food matrices.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122168728A_ABST
    Figure CN122168728A_ABST
Patent Text Reader

Abstract

The application discloses a rigid response fluorescence polarization biosensor for detecting AFB1 and application. The rigid response fluorescence polarization biosensor comprises a target recognition unit, the target recognition unit comprises an aptamer-complementary chain double-stranded complex which specifically recognizes AFB1; a signal amplification unit, the signal amplification unit comprises a rolling circle amplification reaction system; a signal conversion unit, the signal conversion unit comprises a CRISPR / Cas12a detection system; and a signal output unit, the signal output unit comprises a conformational restriction depolarization reporter, and the conformational restriction depolarization reporter is a single-stranded DNA / double-stranded DNA complex structure. The application realizes quantitative detection of AFB1 by using FP value change, has the advantages of low detection limit, strong specificity, strong anti-matrix interference capacity, simple operation and the like, and can be widely applied to rapid and high-sensitivity detection of AFB1 in complex samples such as grains, foods and feed.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biosensing and food safety detection technology, specifically relating to a rigid-response fluorescent polarization biosensor for detecting AFB1 and its application. Background Technology

[0002] Aflatoxin B1 (AFB1) is the most toxic member of the aflatoxin family and is widely recognized as one of the most toxic natural fungal toxins. Primarily produced by *Aspergillus flavus* and *Aspergillus parasiticus*, it exhibits strong hepatotoxicity, mutagenicity, and neurodevelopmental toxicity, and is classified as a Group 1 human carcinogen by the International Agency for Research on Cancer (IARC). AFB1 is widely found in agricultural products and foods, including nuts, grains, forage crops, spices, and even tea, posing a significant threat to global food safety and public health. Contamination can occur at multiple stages from pre-harvest growth to post-harvest storage, especially under warm, humid conditions conducive to fungal growth.

[0003] Traditional instrumental analytical methods, such as high-performance liquid chromatography (HPLC), liquid chromatography-tandem mass spectrometry (LC-MS / MS), and immunoaffinity techniques, offer excellent sensitivity and reliability. However, these methods rely on expensive instruments, costly reagents, specialized technicians, and time-consuming sample pretreatment, limiting their application in routine monitoring and field screening. These limitations underscore the necessity of developing rapid, cost-effective, and highly sensitive analytical platforms for detecting trace amounts of AFB1 in complex food matrices.

[0004] The emergence of aptamer technology has provided a new avenue for molecular recognition of small molecule toxins like AFB1. As single-stranded oligonucleotides obtained through SELEX screening, aptamers possess high affinity and specificity, excellent chemical stability, ease of functionalization, and compatibility with nucleic acid amplification reactions. Aptamers targeting AFB1 have been extensively studied and have driven the development of various nucleic acid-based detection methods, including hybridization sensors, aptamer-cDNA competition platforms, and fluorescence strategies for signal amplification. In particular, combining aptamer-based nucleic acid amplification with the trans-cleavage activity of CRISPR / Cas12a has become an effective method to improve detection sensitivity. The common procedure relies on target-induced amplicon activation of CRISPR / Cas12a, which then cleaves the fluorescent-quencher reporter probe to generate a detectable signal. Despite these advantages, two challenges remain. First, most CRISPR / Cas12a detections rely on fluorescence-on readout methods, which are susceptible to matrix effects, autofluorescence, and nonspecific optical interference, particularly in complex food samples. Secondly, the fluorescent-quencher reporter probes used in traditional CRISPR assays often suffer from photobleaching, fluctuating quenching efficiency, and limited quantitative stability. These drawbacks collectively affect the robustness of the analysis and hinder the development of reliable CRISPR sensing platforms for food safety monitoring.

[0005] In contrast, fluorescence polarization offers a fundamentally different signal transduction mode. Fluorescence polarization reflects the rotational correlation time of the fluorophore, producing high polarization values ​​when the fluorophore is confined to a large or rigid structure, and low polarization values ​​when it rotates freely as small fragments. Because fluorescence polarization is independent of changes in fluorescence intensity, it is resistant to interference from variations in light source intensity, photobleaching, and autofluorescence. Furthermore, fluorescence polarization is a ratiometric parameter derived from parallel and perpendicular emission components, making it largely independent of fluorophore concentration, optical path variations, and moderate background fluorescence. This makes fluorescence polarization an attractive alternative reading method for nuclease-driven detection, as it directly reports changes in rotational state rather than relying on fluorescence intensity. This is particularly advantageous for systems undergoing structural transformations, such as enzyme cleavage which transforms rigid, high-molecular-weight probes into short, freely rotating fragments, resulting in a significant decrease in polarization values ​​and enabling homogeneous, wash-free detection. Despite these advantages, fluorescence polarization-based CRISPR biosensors remain underdeveloped, partly due to the lack of rigorously designed polarization reporters with well-defined rotational rigidity and strong, binary depolarization contrast between the intact and cleaved states. Therefore, creating such a conformationally responsive reporter is crucial for fully realizing the potential of fluorescence polarization as a robust and interference-resistant signal transduction mechanism in CRISPR detection strategies. Consequently, there is an urgent need to develop a novel AFB1 detection method that is highly resistant to interference, highly sensitive, easy to operate, and applicable to complex matrices. Summary of the Invention

[0006] The main objective of this invention is to provide a rigid-response fluorescent polarization biosensor for detecting AFB1 and its application, thereby overcoming the shortcomings of the prior art.

[0007] To achieve the aforementioned objectives, the technical solution adopted by this invention includes:

[0008] This invention provides a rigid-response fluorescent polarization biosensor for detecting AFB1, comprising:

[0009] The target recognition unit includes an aptamer-complementary double-stranded complex that specifically recognizes AFB1, the aptamer-complementary double-stranded complex being formed by hybridization of an aptamer with cDNA;

[0010] The signal amplification unit includes a rolling circle amplification reaction system, which includes a lock-lock probe for rolling circle amplification and rolling circle amplification reaction reagents.

[0011] A signal conversion unit, the signal conversion unit including a CRISPR / Cas12a detection system, the CRISPR / Cas12a detection system including LbCas12a protein and crRNA;

[0012] And a signal output unit, the signal output unit including a conformational restriction depolarization reporter, the conformational restriction depolarization reporter being a single-stranded DNA / double-stranded DNA complex structure, the conformational restriction depolarization reporter being formed by annealing single-stranded DNA and double-stranded DNA.

[0013] The present invention also provides the application of the aforementioned rigid-response fluorescent polarization biosensor for detecting AFB1 in the detection of AFB1 or in the preparation of a kit for detecting AFB1.

[0014] This invention also provides a kit for detecting AFB1, comprising: the aforementioned rigid-response fluorescent polarization biosensor for detecting AFB1.

[0015] This invention also provides a method for detecting AFB1 using the aforementioned rigid-response fluorescence polarization biosensor for detecting AFB1, comprising:

[0016] (1) The aptamer-complementary double-stranded complex was immobilized on the surface of magnetic beads by biotin-streptavidin interaction and then mixed with the sample to be tested for incubation.

[0017] (2) The product obtained from incubation was separated by magnetic separation technology to obtain the supernatant;

[0018] (3) The supernatant is mixed with the rolling ring amplification reaction system to obtain the RCA amplification product;

[0019] (4) The RCA amplification product is mixed with the CRISPR / Cas12a detection system and conformation restriction depolarization reporter to obtain the test product;

[0020] (5) Construct a standard curve of the decrease in fluorescence polarization value of AFB1 versus AFB1 concentration, detect the fluorescence polarization value of the test product, and achieve quantitative detection of AFB1 in the test sample by comparing the standard curve.

[0021] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0022] (1) Extremely high anti-interference capability: Fluorescence polarization (FP) is used as the signal readout method. FP is a function of the rotation rate of the fluorescent group, which is a ratiometric measurement and is not directly affected by the absolute fluorescence intensity and photobleaching. Therefore, it can effectively resist interference such as autofluorescence and scattered light in complex sample matrices, and significantly improve the stability and reliability of detection;

[0023] (2) Extremely high sensitivity: Combining the strong amplification ability of RCA and the enzymatic amplification effect of CRISPR / Cas12a, the detection limit can be as low as 0.00113 ng / mL, and the linear range is as wide as 0.003-300 ng / mL, which is superior to many existing reported methods;

[0024] (3) Excellent specificity: The aptamer ensures the first layer of specificity for target recognition, and the crRNA-guided Cas12a recognition provides the second layer of specificity, which can effectively distinguish AFB1 and its structural analogs (such as AFB2, AFG1, AFG2) from other irrelevant toxins.

[0025] (4) Simple operation and good universality: This method integrates separation and detection, and the operation process is relatively simple. It has shown excellent recovery rate (91.94%-100.20%) and precision (RSD < 6%) in the detection of actual samples (rice, wheat, corn, peanuts, tea), which proves its great potential in practical applications. Attached Figure Description

[0026] To more clearly illustrate the technical solutions in the embodiments of this application or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0027] Figure 1 This is a schematic diagram illustrating the working principle of a rigid-response fluorescent polarization biosensor based on RCA-CRISPR / Cas12a for detecting AFB1, provided in a typical embodiment of the present invention.

[0028] Figure 2 This is a typical embodiment of the present invention, showing the fluorescence response signal induced by RCA-CRISPR / Cas12a with and without AFB1.

[0029] Figure 3A This is a typical embodiment of the present invention, showing the FP response signal with and without AFB1;

[0030] Figure 3B This is a gel electrophoresis characterization image of the RCA reaction provided in a typical embodiment of the present invention;

[0031] Figure 4A This is a typical embodiment of the present invention, showing the FP signal diagrams of different reactive components (af).

[0032] Figure 4BThis is a schematic diagram of the stepwise reaction of different reaction components (af) provided in a typical embodiment of the present invention;

[0033] Figures 5A-5D These are comparison images of the FP signals of fluorescence polarization sensors based on four reporter molecules—ssDNA II', ssDNAII, CRD-Reporter', and CRD-Reporter—with and without AFB1, provided in a typical embodiment of the present invention.

[0034] Figure 6 This is a gel electrophoresis image of two reporter molecules, CRD-Reporter' and CRD-Reporter, before and after trans-cleavage by Cas12a-crRNA, provided in a typical embodiment of the present invention;

[0035] Figures 7A-7B This is a graph showing the accuracy and repeatability measurement of a fluorescence polarization sensor provided in a typical embodiment of the present invention;

[0036] Figures 8A-8D These are FP signal diagrams of a fluorescence polarization sensor provided in a typical embodiment of the present invention in a T4 DNA ligase system, a Phi29 DNA polymerase system, a Cas12a-crRNA system, and a complete sensing system.

[0037] Figures 9A-9D This is a typical embodiment of the present invention, showing the optimized concentration of cDNA in a fluorescence polarization sensor, the optimized time of the RCA reaction, the optimized concentration of the CRD-Reporter, and the optimized cleavage time of CRISPR / Cas12a.

[0038] Figures 10A-10D This is a sensitivity measurement graph, linear range, and standard curve graph of a fluorescence polarization sensor provided in a typical embodiment of the present invention;

[0039] Figures 11A-11B This is a specific analysis and measurement diagram of a fluorescence polarization sensor provided in a typical embodiment of the present invention;

[0040] Figures 12A-12C This is a schematic diagram of a fluorescence polarization sensor provided in a typical embodiment of the present invention for actual sample spiking detection, along with its corresponding FP signal diagram and ΔFP diagram. Detailed Implementation

[0041] In view of the deficiencies of the prior art, the inventors of this invention, through long-term research and extensive practice, have proposed the technical solution of this invention. Its core design concept is to organically integrate the high specificity recognition of aptamers, the efficient signal amplification of rolling circle amplification (RCA), the enzymatic signal conversion of CRISPR / Cas12a, and an innovative conformationally restricted depolarization reporter (CRD-Reporter) to achieve accurate quantification of AFB1 by measuring changes in FP value.

[0042] The technical solution of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0043] Specifically, as one aspect of the technical solution of this invention, a rigid-response fluorescence polarization biosensor for detecting AFB1 includes:

[0044] The target recognition unit includes an aptamer-complementary double-stranded complex that specifically recognizes AFB1, the aptamer-complementary double-stranded complex being formed by hybridization of an aptamer with cDNA;

[0045] The signal amplification unit includes a rolling circle amplification reaction system, which includes a lock-lock probe for rolling circle amplification and rolling circle amplification reaction reagents.

[0046] A signal conversion unit, the signal conversion unit including a CRISPR / Cas12a detection system, the CRISPR / Cas12a detection system including LbCas12a protein and crRNA;

[0047] And a signal output unit, the signal output unit including a conformational restriction depolarization reporter, the conformational restriction depolarization reporter being a single-stranded DNA / double-stranded DNA complex structure, the conformational restriction depolarization reporter being formed by annealing single-stranded DNA and double-stranded DNA.

[0048] In some preferred embodiments, the aptamer has a sequence as shown in SEQ ID NO. 1.

[0049] In some preferred embodiments, the cDNA has a sequence as shown in SEQ ID NO. 2.

[0050] In some preferred embodiments, the locking probe has a sequence as shown in SEQ ID NO. 3.

[0051] In some preferred embodiments, the crRNA has a sequence as shown in SEQ ID NO. 4.

[0052] In some preferred embodiments, the single-stranded DNA has a sequence as shown in SEQ ID NO. 5.

[0053] In some preferred embodiments, the double-stranded DNA has a sequence as shown in SEQ ID NO. 6.

[0054] In some preferred embodiments, the fluorescent group in the conformationally restricted depolarized reporter is located on the inner strand of the double-stranded DNA, so that the fluorescent group can be effectively released after Cas12a cleavage.

[0055] In some preferred embodiments, the aptamer-complementary double-stranded complex is immobilized on the surface of the magnetic beads via biotin-streptavidin interaction.

[0056] In some preferred embodiments, the rolling circle amplification reaction reagent includes T4 DNA ligase, phi29 DNA polymerase, and dNTPs.

[0057] In some preferred embodiments, the rigid-response fluorescent polarization biosensor for detecting AFB1 includes:

[0058] (1) Target recognition unit: contains an aptamer that specifically recognizes AFB1 and its partial complementary strand (cDNA). Preferably, the aptamer is immobilized on the surface of streptavidin-modified magnetic beads (SAV-MBs) via biotin-streptavidin interaction and hybridizes with cDNA to form an easily separable aptamer-cDNA-MBs complex.

[0059] (2) Signal amplification unit: contains a lock probe (PP) for rolling circle amplification (RCA) and RCA reaction reagents (such as T4 DNA ligase, phi29 DNA polymerase, and dNTPs). The released cDNA can act as a primer to mediate PP circularization and initiate RCA, generating a long DNA amplicon containing multiple Cas12a recognition sites.

[0060] (3) Signal transduction unit: contains LbCas12a protein and crRNA. RCA amplicons can efficiently activate the trans-cleavage activity of the Cas12a-crRNA complex.

[0061] (4) Signal output unit: a conformationally restricted depolarizing reporter (CRD-Reporter). This reporter is a carefully designed rigid double-stranded DNA structure, one strand of which is labeled with a fluorescent group (such as FAM), preferably inside the double strand. This rigid structure effectively restricts the free rotation of the fluorescent group, thereby providing a high and stable initial FP signal.

[0062] Another aspect of the present invention provides the application of the aforementioned rigid-response fluorescent polarization biosensor for detecting AFB1 in the detection of AFB1 or in the preparation of a kit for detecting AFB1.

[0063] Another aspect of the present invention provides a kit for detecting AFB1, comprising: the aforementioned rigid-response fluorescent polarization biosensor for detecting AFB1.

[0064] Another aspect of the present invention provides a method for detecting AFB1 using the aforementioned rigid-response fluorescence polarization biosensor for detecting AFB1, comprising:

[0065] (1) The aptamer-complementary double-stranded complex was immobilized on the surface of magnetic beads by biotin-streptavidin interaction and then mixed with the sample to be tested for incubation.

[0066] (2) The product obtained from incubation was separated by magnetic separation technology to obtain the supernatant;

[0067] (3) The supernatant is mixed with the rolling ring amplification reaction system to obtain the RCA amplification product;

[0068] (4) The RCA amplification product is mixed with the CRISPR / Cas12a detection system and conformation restriction depolarization reporter to obtain the test product;

[0069] (5) Construct a standard curve of the decrease in fluorescence polarization value of AFB1 versus AFB1 concentration, detect the fluorescence polarization value of the test product, and achieve quantitative detection of AFB1 in the test sample by comparing the standard curve.

[0070] In some preferred embodiments, the method specifically includes: providing a series of standard AFB1 samples with different concentrations, using the same steps (1)-(4) to obtain a series of test products, comparing the fluorescence polarization values ​​of the series of test products with the corresponding standard AFB1 samples, thereby constructing a standard curve of fluorescence polarization value decrease ΔFP versus AFB1 concentration.

[0071] In some preferred embodiments, the sample to be tested includes a complex food matrix, which includes any one or more combinations of rice, wheat, corn, peanuts, and tea.

[0072] In some preferred embodiments, the method for detecting AFB1 using the aforementioned rigid-response fluorescent polarization biosensor includes:

[0073] (1) Target recognition and cDNA release: The sample to be tested was incubated with the aptamer-cDNA-MBs complex. When AFB1 is present, its high affinity binding to the aptamer causes a conformational change in the aptamer, forcing the complementary cDNA strand to be released from the complex into the solution.

[0074] As a preferred embodiment, the method for preparing the aptamer / cDNA-MBs complex includes:

[0075] First, aptamer / cDNA duplexes were prepared. The aptamer and cDNA were diluted in buffer I (10 mM Tris-HCl, 1 mM EDTA, 1 M NaCl, 0.01–0.2% Tween-20; pH 7.5, 25°C). A 20 μL mixture was formed by combining 10 μL of aptamer (10 μM) with 10 μL of cDNA (5 μM) and denatured at 95°C for 10 min, then allowed to cool naturally to room temperature to promote duplex formation. The prepared aptamer / cDNA duplexes were stored at -20°C for long-term use.

[0076] Subsequently, after magnetic separation with 20 μL of SAV-MBs, the mixture was incubated with 20 μL of the above-mentioned aptamer / cDNA double strands and 80 μL of buffer I by vortexing at room temperature for 30 minutes, followed by magnetic separation to obtain the aptamer / cDNA-MBs complex. Store at 4°C until use.

[0077] (2) cDNA separation: The aptamer-magnetic bead complex (aptamer / AFB1-MBs) that binds to AFB1 is removed by magnetic separation technology, and the supernatant containing the released cDNA is collected.

[0078] Preferably, the method for isolating cDNA from the supernatant includes:

[0079] The aptamer / cDNA-MBs complex was mixed with 100 μL of different concentrations of AFB1 (0.003, 0.03, 0.3, 3, 30, 150, 300 ng / mL) and incubated at room temperature for 30 minutes. After magnetic separation, the supernatant containing the released cDNA was collected and stored at -20°C.

[0080] (3) Lock-probe circularization and rolling circle amplification (RCA): The cDNA in the supernatant was mixed with a lock-probe (PP). The cDNA was used as a primer to hybridize with the PP, and under the action of T4 DNA ligase, the PP was guided to form a closed circular DNA template. Subsequently, in the presence of phi29 DNA polymerase and dNTPs, the circularized PP was used as a template for the RCA reaction to generate long single-stranded DNA amplicon containing a large number of tandem repeat sequences. These amplicon contain multiple Cas12a protein specific recognition sites (PAM sequences).

[0081] As a preferred method, the preparation method of the RCA product includes:

[0082] The 25 μL RCA reaction solution was assembled from: 10 μL cDNA supernatant, 5 μL padlock probe (PP, 5 μM), 2.5 μL 10× T4 buffer, 2.5 μL 10× phi29 buffer, 3 μL dNTPs (25 mM), 1 μL T4 DNA ligase (8 U / μL), and 1 μL phi29 DNA polymerase (4 U / μL). The reaction was carried out at 37 °C for 60 min to generate abundant RCA amplicon, followed by heating at 80 °C for 10 min to terminate enzyme activity.

[0083] (4) CRISPR / Cas12a activation and CRD-Reporter cleavage: The RCA amplification product was mixed with Cas12a protein, crRNA, and CRD-Reporter. The RCA amplicon binds to the crRNA, activating the trans-cleavage activity of the Cas12a-crRNA complex. The activated Cas12a randomly cleaves single-stranded DNA in the system, including the exposed single-stranded loop regions in the CRD-Reporter.

[0084] Preferably, a method for activating the trans-cleavage activity of the Cas12a-crRNA complex includes:

[0085] 1 μL of RCA product was mixed with 2 μL of NEBuffer r2.1, 13 μL of DEPC-treated water, 1 μL of Cas12a (1 μM), 1 μL of crRNA (1 μM), and 2 μL of 25 nM FAM-labeled CRD-Reporter. The mixture was incubated at 37°C for 50 min to activate the transduction activity of the CRISPR / Cas12a system and used directly for FP measurements.

[0086] As a preferred method, the measurement of FP includes:

[0087] 20 μL of the cleavage product was mixed with 500 μL of polarization buffer (1 M Tris-HCl, 1 M NaCl, and 1 M MgCl2; pH 8.0 at 25°C) and FP was measured using a Sentry300 series fluorescence polarimeter (Ellie Ltd., USA).

[0088] (5) Signal Detection and Quantification: The cleavage process disrupts the rigid double-stranded structure of the CRD-Reporter, especially when the fluorophore is located internally. The double-stranded fragment containing the fluorophore partially dissociates, releasing small, freely rotating fluorophore fragments. The fluorescence polarization (FP) value of the reaction system is measured. Due to the significant increase in the rotational speed of the fluorophore, the FP value drops sharply from its initial high value. The magnitude of the FP value decrease (ΔFP) is proportional to the concentration of AFB1 in the sample, and quantitative detection can be achieved using a standard curve.

[0089] In some preferred embodiments, the method for spiked detection of AFB1 in complex food matrices includes:

[0090] First, rice, wheat, corn, peanuts, and tea samples (white tea, black tea, and green tea) were ground into a homogeneous powder and freeze-dried to remove residual moisture. To prepare spiked samples, 5 mL of AFB1 standard solution (1500, 30, or 0.3 ng / mL) was added to 5.0 g of homogenized powder and thoroughly mixed. The samples were equilibrated overnight at 4°C to ensure sufficient interaction between AFB1 and the food matrix before extraction. Extraction was performed according to the Chinese National Food Safety Standard (GB 5009.22-2016). Each equilibrated sample was extracted with 20 mL of methanol / water (7:3, v / v) by vortexing for 20 min. After centrifugation at 6000 rpm for 10 min, the supernatant was collected, corresponding to AFB1 concentrations of 375, 7.5, and 0.075 ng / mL in the extract solutions, respectively. Subsequently, 100 μL of the extract was gently incubated with an aptamer cDNA-MB system by rotation for 30 min, followed by magnetic separation to obtain a supernatant containing released cDNA. Subsequently, 10 μL of the supernatant was injected into the RCA reaction mixture, resulting in AFB1 concentrations of 150, 3, and 0.03 ng / mL, which were used for CRISPR / Cas12a activation and FP analysis, using the standard AFB1 detection procedure described above.

[0091] This invention utilizes the change in FP value to achieve quantitative detection of AFB1, which has the advantages of low detection limit (as low as 0.00113 ng / mL), high specificity, strong resistance to matrix interference, and simple operation. It can be widely used for rapid and highly sensitive detection of AFB1 in complex samples such as grains, food, and feed.

[0092] The technical solution of the present invention will be further described in detail below with reference to several preferred embodiments and accompanying drawings. This embodiment is implemented on the premise of the technical solution of the invention, and provides detailed implementation methods and specific operation processes. However, the protection scope of the present invention is not limited to the following embodiments.

[0093] Unless otherwise specified, the experimental materials used in the examples below can be purchased from conventional biochemical reagent companies.

[0094] All HPLC-purified DNA sequences (Table S1) were synthesized and quantified by Sangon Biotechnology Co., Ltd. (Shanghai, China). AFB1, AFB2, and microcystin (MC-LR) were obtained by Shanghai Yuanye Biotechnology Co., Ltd. AFG1 and AFG2 were obtained by Pribon (Qingdao Pribon Biotechnology Engineering Co., Ltd.). Ochratoxin A (OTA) was obtained by Kejie (Shenzhen Kejie Industrial Development Co., Ltd.). Scimitotoxin (STX) and okadaic acid (OA) were purchased from Pribon (Qingdao Pribon Biotechnology Engineering Co., Ltd.). Enzymes and their corresponding buffers, including T4 DNA ligase with 10×T4 buffer (50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP, 10 mM DTT, pH 7.5 at 25°C), Phi29 DNA polymerase with 10×Phi29 buffer (50 mM Tris-HCl, 10 mM MgCl2, 10 mM (NH4)2SO4, 4 mM DTT, pH 7.5 at 25°C), and EnGen® Lba Cas12a (Cpf1) containing NEBuffer™ r2.1 (50 mM NaCl, obtained from Beijing, China, 10 mM Tris-HCl, 10 mM MgCl2, 100 μg / mL recombinant albumin, pH 7.9 at 25°C) and EnGen lbaCas12a diluent (500 mM NaCl, 20 mM NaOAc, 0.1 mM EDTA, 0.1 mM HCl, 10 mM MgCl2, 10 mM (NH4)2SO4, 4 mM DTT, pH 7.5 at 25°C). TCEP, 50% glycerol, pH 6 at 25°C. Other reagents included Buffer I (10 mM trihydrochloride, 1 mM EDTA, 1 M NaCl, 0.01–0.2% Tween-20, pH 7.5 at 25°C), dNTP mixtures (100 mM each of dATP, dTTP, dCTP, and dGTP), TEMED, 30% acrylamide / bisacrylamide (29:1), 1×TBE buffer (89 mM triborate, 2 mM EDTA, pH 8.2–8.4), 6×DNA loading buffer, 4S GelRed (10,000×), and DNA markers (25–500 base pairs), all from Sangon Biotech. Streptavidin-coated magnetic beads (SAV-MBs) were purchased from Biolinkedin (Shanghai Lingyin Biotechnology Co., Ltd.). The ultrapure water with a resistivity of 18.2 MΩ / cm used throughout the experiment was obtained from the Milli-A10 system (Mil-lipore).

[0095] Instruments and Meters

[0096] Electrophoresis (FP) measurements and data recording were performed using a Sentry300 series fluorescence polarimeter (Ellie Ltd., USA) and SentryTools™ software. Electrophoresis results were analyzed using the GelDoc Go gel imaging system and Image Lab analysis software (Bio-Rad Laboratories, Inc.). Fluorescence spectra were measured using an F97 Pro fluorescence spectrophotometer (Shanghai Lingguang Technology Co., Ltd.).

[0097] The sequences used in this invention are shown in Table 1:

[0098] Table 1 Sequence List

[0099] Serial Number name Sequence (5'-3') SEQ. ID NO.1 Aptamer AAAAAAAAAGTTGGGCACGTGTTGTCTCTCTGTGTCTCGTGCCCTTCGCTAGGCCCACA SEQ. ID NO. 2 cDNA <![CDATA[ CGAGCGGAGAAGGGCACGAG ]]> SEQ ID NO. 3 Padlock probe (PP) <![CDATA[ / PHO / TCTCCGCTCG AACCAACCAACTTTCTCAACATCAGTCTGATAAGCCCAATTACACTAA CTCGTGCCCT ]]> SEQ ID NO. 4 crRNA UAAUUUCUACUAAGUGUAGAUUCAACAUCAGUCUGAUAAGC SEQ ID NO. 5 ssDNA I <![CDATA[ TCAACATCA TTTATTT GTCTGATAAGCTA ]]> SEQ. ID NO. 6 ssDNA II <![CDATA[ TAGCTTATCAGACT / FAM / GATGTTGA ]]> SEQ. ID NO. 7 ssDNA II′ <![CDATA[ / FAM / TAGCTTATCAGACTGATGTTGA ]]> SEQ ID NO. 8 ssDNA III GCTTATCAGACTGATGTTGA SEQ ID NO. 9 FQ-Reporter / FAM / ctctcATTTTTAgagag / BHQ1

[0100] Example 1

[0101] This embodiment provides a fluorescence polarization biosensor for AFB1 detection. The sensor systematically integrates aptamer-based molecular recognition, programmable RCA, and CRISPR / Cas12a activation, combined with a CRD-Reporter.

[0102] Specifically: such as Figure 1As shown, the biotin-labeled AFB1 aptamer (SEQ. ID NO. 1) first hybridizes with cDNA (SEQ. ID NO. 2) to form a double strand, and then is immobilized on SAV-MBs via specific biotin-streptavidin binding. In the absence of AFB1, the cDNA remains tightly paired with the bead-bound aptamer. Upon target recognition, AFB1 triggers a conformational rearrangement of the aptamer, resulting in the displacement and release of the cDNA into solution (i.e., aptamer replacement). Subsequent magnetic separation removes the aptamer / AFB1-MB complex, thereby isolating the released cDNA for downstream amplification. The released cDNA then hybridizes with PP (SEQ. ID NO. 3), enabling T4 DNA ligase to catalyze its circularization into a closed DNA template. Subsequently, Phi29 DNA polymerase initiates RCA, producing long single-stranded DNA ligands composed of multiple tandem Cas12a target sequences. These amplified RCA products then activate the Cas12a-crRNA complex (Cas12a activation), resulting in significant transcleavage activity. Meanwhile, the CRD-Reporter is rationally designed as a rigidly constrained, FAM-labeled duplex structure, in which the fluorophore is embedded within a spatially constrained double-stranded framework, significantly limiting its rotational freedom and generating a stable and inherently high FP baseline signal. Upon target-induced activation of Cas12a, side branch cleavage occurs within the reporter sequence, disrupting the integrity of the double-stranded structure and releasing a short oligonucleotide fragment with significantly enhanced rotational mobility, leading to a significant and quantifiable decrease in FP (FP reduction). Through this cascade reaction—including aptamer-triggered cDNA release and magnetic purification to RCA amplification, Cas12a activation, and rigidly dependent FP depolarization—this platform enables highly sensitive and selective AFB1 detection.

[0103] Specifically, the fluorescence polarization biosensor for detecting AFB1 includes:

[0104] 1) Target recognition unit: Contains an aptamer that specifically recognizes AFB1 and its partially complementary strand (cDNA). Preferably, the aptamer is immobilized on the surface of streptavidin-modified magnetic beads (SAV-MBs) via biotin-streptavidin interaction and hybridizes with cDNA to form an easily separable aptamer-cDNA-MBs complex.

[0105] 2) Signal amplification unit: Contains a lock probe (PP) for rolling circle amplification (RCA) and RCA reaction reagents (such as T4 DNA ligase, phi29 DNA polymerase, and dNTPs). The released cDNA can act as a primer to mediate PP circularization and initiate RCA, generating a long DNA amplicon containing multiple Cas12a recognition sites.

[0106] 3) Signal transduction unit: Contains LbCas12a protein and crRNA (SEQ. ID NO. 4). The RCA amplicon can efficiently activate the trans-cleavage activity of the Cas12a-crRNA complex.

[0107] 4) Signal output unit: a conformationally restricted depolarizing reporter (CRD-Reporter). This reporter is a carefully designed rigid double-stranded DNA structure, one strand of which is labeled with a FAM fluorescent group (formed by annealing of SEQ. ID NO. 5 and SEQ. ID NO. 6), preferably with the fluorescent group labeled inside the double strand. This rigid structure effectively restricts the free rotation of the fluorescent group, thereby providing a high and stable initial FP signal.

[0108] Specifically, the method for constructing this fluorescence polarization biosensor includes the following steps:

[0109] 1) Target recognition and cDNA release: The sample to be tested is incubated with the aptamer / cDNA-MBs complex. When AFB1 is present, its high affinity binding to the aptamer causes a conformational change in the aptamer, forcing the complementary cDNA strand to be released from the complex into the solution.

[0110] In some preferred embodiments, the method for preparing the aptamer / cDNA-MBs complex includes:

[0111] First, aptamer / cDNA duplexes were prepared. The aptamer and cDNA were diluted in buffer I (10 mM Tris-HCl, 1 mM EDTA, 1 M NaCl, 0.01–0.2% Tween-20; pH 7.5, 25°C). A 20 μL mixture was formed by combining 10 μL of aptamer (10 μM) with 10 μL of cDNA (5 μM) and denatured at 95°C for 10 min, then allowed to cool naturally to room temperature to promote duplex formation. The prepared aptamer / cDNA duplexes were stored at -20°C for long-term use.

[0112] Subsequently, after magnetic separation with 20 μL of SAV-MBs, the mixture was incubated with 20 μL of the above-mentioned aptamer / cDNA double strands and 80 μL of buffer I by vortexing at room temperature for 30 minutes, followed by magnetic separation to obtain the aptamer / cDNA-MBs complex. Store at 4°C until use.

[0113] 2) cDNA separation: The aptamer-magnetic bead complex (aptamer / AFB1-MBs) that binds to AFB1 is removed using magnetic separation technology, and the supernatant containing the released cDNA is collected.

[0114] In some preferred embodiments, the method for isolating cDNA from the supernatant includes:

[0115] The aptamer / cDNA-MBs complex was mixed with 100 μL of different concentrations of AFB1 (0.003, 0.03, 0.3, 3, 30, 150, 300 ng / mL) and incubated at room temperature for 30 minutes. After magnetic separation, the supernatant containing the released cDNA was collected and stored at -20°C.

[0116] 3) Lock-lock probe circularization and rolling circle amplification (RCA): The cDNA in the supernatant is mixed with PP. The cDNA is used as a primer to hybridize with PP, and under the action of T4 DNA ligase, PP is guided to form a closed circular DNA template. Subsequently, in the presence of phi29 DNA polymerase and dNTPs, the circularized PP is used as a template for the RCA reaction to generate long single-stranded DNA amplicon containing a large number of tandem repeat sequences. These amplicon contain multiple Cas12a protein-specific recognition sites (PAM sequences).

[0117] In some preferred embodiments, the method for preparing the RCA product includes:

[0118] The 25 μL RCA reaction solution was assembled from: 10 μL cDNA supernatant, 5 μL padlock probe (PP, 5 μM), 2.5 μL 10× T4 buffer, 2.5 μL 10× phi29 buffer, 3 μL dNTPs (25 mM), 1 μL T4 DNA ligase (8 U / μL), and 1 μL phi29 DNA polymerase (4 U / μL). The reaction was carried out at 37 °C for 60 min to generate abundant RCA amplicon, followed by heating at 80 °C for 10 min to terminate enzyme activity.

[0119] 4) CRISPR / Cas12a activation and CRD-Reporter cleavage: The RCA amplification product is mixed with Cas12a protein, crRNA, and CRD-Reporter. The RCA amplicon binds to the crRNA, activating the trans-cleavage activity of the Cas12a-crRNA complex. The activated Cas12a randomly cleaves single-stranded DNA in the system, including the exposed single-stranded circular regions in the CRD-Reporter.

[0120] In some preferred embodiments, a method for activating the trans-cleavage activity of the Cas12a-crRNA complex includes:

[0121] 1 μL of RCA product was mixed with 2 μL of NEBuffer r2.1, 13 μL of DEPC-treated water, 1 μL of Cas12a (1 μM), 1 μL of crRNA (1 μM), and 2 μL of 25 nM FAM-labeled CRD-Reporter. The mixture was incubated at 37°C for 50 min to activate the transduction activity of the CRISPR / Cas12a system and used directly for FP measurements.

[0122] In some preferred embodiments, the method for measuring FP includes:

[0123] 20 μL of the cleavage product was mixed with 500 μL of polarization buffer (1 M Tris-HCl, 1 M NaCl, and 1 M MgCl2; pH 8.0 at 25°C) and FP was measured using a Sentry300 series fluorescence polarimeter (Ellie Ltd., USA).

[0124] 5) Signal Detection and Quantification: The cleavage process disrupts the rigid double-stranded structure of the CRD-Reporter, especially when the fluorophore is located internally. The double-stranded fragment containing the fluorophore partially dissociates, releasing small, freely rotating fluorophore fragments. The fluorescence polarization (FP) value of the reaction system is measured. Due to the significant increase in the rotational speed of the fluorophore, the FP value drops sharply from a high initial value. The magnitude of the FP value decrease (ΔFP) is proportional to the concentration of AFB1 in the sample, and quantitative detection can be achieved using a standard curve.

[0125] In some preferred embodiments, the method for spiked detection of AFB1 in complex food matrices includes:

[0126] First, rice, wheat, corn, peanuts, and tea samples (white tea, black tea, and green tea) were ground into a homogeneous powder and freeze-dried to remove residual moisture. To prepare spiked samples, 5 mL of AFB1 standard solution (1500, 30, or 0.3 ng / mL) was added to 5.0 g of homogenized powder and thoroughly mixed. The samples were equilibrated overnight at 4°C to ensure sufficient interaction between AFB1 and the food matrix before extraction. Extraction was performed according to the Chinese National Food Safety Standard (GB 5009.22-2016). Each equilibrated sample was extracted with 20 mL of methanol / water (7:3, v / v) by vortexing for 20 min. After centrifugation at 6000 rpm for 10 min, the supernatant was collected, corresponding to AFB1 concentrations of 375, 7.5, and 0.075 ng / mL in the extract solutions, respectively. Subsequently, 100 μL of the extract was gently incubated with an aptamer cDNA-MB system by rotation for 30 min, followed by magnetic separation to obtain a supernatant containing released cDNA. Subsequently, 10 μL of the supernatant was injected into the RCA reaction mixture, resulting in AFB1 concentrations of 150, 3, and 0.03 ng / mL, respectively, for CRISPR / Cas12a activation and FP analysis, using the standard AFB1 detection procedure described above.

[0127] Example 2: Feasibility Study of Detecting AFB1 with a Fluorescent Polarization Biosensor

[0128] To verify the effectiveness of AFB1-induced RCA product in activating the trans-cleavage activity of Cas12a, fluorescence measurements were performed using a conventional F-QReporter. Real-time fluorescence signals were monitored for 60 minutes under the same reaction conditions (see [link to F-QReporter]). Figure 2 In the absence of AFB1, the fluorescence intensity remained almost constant throughout the reaction, indicating that non-specific activation of the Cas12a system was negligible. In contrast, the fluorescence increased significantly over time after the addition of AFB1. This enhancement confirms that AFB1 binding to the aptamer triggers cDNA release, which initiates lock-probe circularization and RCA. The resulting RCA product activates the Cas12a-crRNA complex, leading to trans-cleavage of the FQ Reporter (SEQ. ID NO. 9) and the separation of the FAM fluorophore from the BHQ1 silencing agent. These results provide independent fluorescence evidence supporting the activation of Cas12a transdilation activity induced by AFB1 and further validate the mechanistic basis of the FP sensing strategy.

[0129] Next, to evaluate the overall signal response of the developed RCA-CRISPR / CRD-reporting system, the FP value was first measured in both AFB1 absence and presence conditions (see...). Figure 3AUnder target-free conditions (a), the CRD-Reporter remains intact, maintaining a rigid double-constitutional configuration with a FP value of approximately 346 mP. Upon introduction of AFB1 (b), aptamer-cDNA interactions are disrupted, triggering cDNA primer release, PP circularization, and subsequent RCA-driven Cas12a activation. The activated nuclease efficiently cleaves the CRD-Reporter, transforming it from a confined, slowly rotating structure into a short, freely tumbling fragment. Consequently, the FP signal significantly decreases to approximately 197 mP. This significant FP decrease (FP≈149 mP) establishes a clear response between the two states and confirms the effectiveness of the proposed conformational restriction depolarization mechanism in detecting the AFB1 target.

[0130] Figure 3B Further validation of a series of control reactions analyzed by native-PAGE confirmed the feasibility of PP circularization and subsequent RCA initiation. In channel a (PP only), a single band corresponding to the complete probe was observed. In channel a (containing only cDNA), no obvious band was visible due to the short single strand of cDNA and its weak staining efficiency under specific conditions. When PP was mixed with cDNA (channel c), the band shifted slightly upwards compared to channel b, indicating that PP and cDNA formed a double strand. When T4 DNA ligase (channel d) was provided, the band position remained almost unchanged relative to channel c, indicating that ligation did not affect electrophoretic mobility. In band e (containing PP, T4 DNA ligase, dNTPs, and Phi29 polymerase but without cDNA), the band pattern remained similar to band b, indicating that no extended product was generated in the absence of cDNA. Only when all components were present (channel f; PP, cDNA, T4 DNA ligase, dNTPs, and Phi29 polymerase) did a broad and high-molecular-weight band structure appear, characteristic of long RCA products. These results collectively confirm that cDNA can correctly hybridize with PP, that the T4 ligase efficiently circularizes the double-stranded structure into a closed RCA template, and that Phi29-driven polymerization produces long RCA amplicons, which are crucial for downstream Cas12a activation and signaling.

[0131] Example 3: Stepwise verification of the workflow for AFB1-induced RCA-CRISPR amplification

[0132] To elucidate the contribution of each reactant and verify the FP transduction mechanism, FP was systematically evaluated in six stepwise assembly reaction configurations (see [link to relevant documentation]). Figure 4B CRD-Reporter is incorporated as a constant component into all reaction systems. For example... Figure 4AAs shown, in condition a, the mixture containing only the aptamer / cDNA duplex and CRD-Reporter exhibited a high FP value, consistent with the reporter remaining intact and structurally constrained. After the addition of AFB1 (condition b), the FP signal remained essentially unchanged, indicating that target binding and subsequent aptamer / cDNA substitution did not affect the reporter conformation. After the introduction of PP (condition c) and subsequently T4 DNA ligase (condition d), the FP value remained consistent with the previous groups, indicating that ligation and circular template formation did not directly affect reporter motility. These steps only prepared the circular substrate required for RCA, and did not yet generate a species capable of interacting with the reporter. When Phi29 DNA polymerase and dNTPs were added to initiate RCA (condition e), FP still did not show a significant decrease, confirming that RCA amplification alone does not degrade or alter the CRD-Reporter. Only after the introduction of the Cas12a-crRNA complex with the RCA product (condition f) did FP show a significant decrease. This significant depolarization reflects the efficient cleavage of the CRD-Reporter by activated Cas12a, releasing the fluorophore into a free-rotating state. The significant decrease in FP validates that the sequential RCA amplification and CRISPR activation cascade reaction successfully translated target identification into measurable FP readings.

[0133] Example 4: Selection of Different Reporters

[0134] To further demonstrate the efficient FP response of the designed CRD-reporter to AFB1, four different reporter probes were synthesized for systematic comparison: ssDNA II' (SEQ. ID NO. 7), ssDNA II (SEQ. ID NO. 6), CRD-Reporter' (formed by annealing ssDNA I and ssDNA II'), and CRD-Reporter (formed by annealing ssDNA I and ssDNA II). Figure 5A As shown, the FAM fluorophore was attached to the 5' end of ssDNA II'. Without AFB1, the detector exhibited a FP signal of approximately 210 mP. With the addition of AFB1, the FP did not decrease significantly. This behavior can be attributed to the fact that ssDNA II', due to its single strand and flexibility, cannot effectively restrict the rotational freedom of the FAM fluorophore, resulting in an inherently low FP value. Even after CRISPR / Cas12a transcleavage, the rotational state of the fluorophore only slightly changes due to the slight shortening of the DNA strand. Furthermore, single-strand breaks only cause a slight decrease in molecular weight and hydrodynamic volume, insufficient to significantly perturb the rotational diffusion of the fluorophore in solution, resulting in a ΔFP of only ~13 mP. Similarly, when the fluorophore is located inside ssDNA II (see...), the FP signal is significantly lower. Figure 5BIn the absence of AFB1, the FP signal is comparable to ssDNA II′, indicating that the localization of the fluorophore on single-stranded DNA has little effect on its intrinsic FP response. Similarly, with the introduction of the target material, FP only decreases weakly, with ΔFP approximately 14 mP. This can be attributed to the low molecular weight and high flexibility of single-stranded DNA itself, which allows the FAM fluorophore to rotate and oscillate rapidly in solution. Therefore, Cas12a-mediated breakage produces only limited FP changes. To overcome this limitation, a double-stranded reporter mechanism with enhanced molecular weight and structural rigidity was designed. Figure 5C As shown, in the absence of AFB1, the FP signal of CRD-Reporter' was significantly increased (~345 mP), indicating that the duplex structure effectively restricted the spatial rotation and wobbling of the FAM fluorophore. After the target was added, the decrease in FP was observed to be slightly greater than that of ssDNA II' and ssDNA II, with ΔFP reaching ~23 mP. Therefore, structural dissociation and changes in fluorophore rotation may not be sufficient to induce a significant decrease in FP.

[0135] Therefore, the CRD-Reporter was further designed, in which the fluorophore is located inside the double-stranded structure (see...). Figure 5D In the absence of AFB1, the FP signal displayed by CRD-Reporter was almost identical to that of CRD-Reporter (~346 mP). However, upon target introduction, the FP signal significantly decreased (approximately 197 mP), corresponding to a ΔFP of approximately 149 mP. This response was 11.46-fold, 10.64-fold, and 6.48-fold higher than that of ssDNAII', ssDNA II, and CRD-Reporter', respectively. The superior performance of the CRD-Reporter is attributed to Cas12a-crRNA-mediated transdissociation of the ssDNA II loop region, which triggers the dissociation of the double-stranded fragment containing the internal fluorophore. The release of these fluorophores significantly increases the rotational and wobbling degrees of freedom of the FAM molecule in solution, thereby significantly reducing FP. In summary, CRD-Reporter combines a stable and rigid structural framework with efficient fluorophore confinement, achieving highly sensitive and specific FP signal transduction upon target activation. These findings validate the feasibility and robustness of the FP-based CRD-Reporter for AFB1 detection.

[0136] Furthermore, to gain a deeper understanding of the mechanism underlying the performance difference between CRD-Reporter and CRD-Reporter', additional PAGE analysis (without any nucleic acid dyes) was performed to observe the cleavage patterns of the two CRD reporter molecules after Cas12a activation. Figure 6As shown, when Cas12a is not activated, CRD-Reporter and CRD-Reporter' remain intact and exhibit band structures consistent with their molecular weights via the connected FAM fluorophores (channels a and c). Upon introduction of ssDNA III (SEQ.ID NO. 8), crRNA binds and activates the transcleavage activity of Cas12a, resulting in the cleavage of the single-stranded loop regions of both reporter probes. As shown in channel d, although CRD-Reporter' undergoes transcleavage in its exposed single-stranded region, the double-stranded domain carrying the terminal fluorophore remains largely intact, indicating limited structural damage. In contrast, cleavage of CRD-Reporter leads to dissociation of the FAM fluorophore, corresponding to a significant decrease in the observed ΔFP. Due to their lower molecular weight, these free fluorophores are not observable by electrophoresis. (Channel B) At this stage, although the remaining double-stranded structure remains intact, it is not effectively detectable by electrophoresis due to FAM dissociation and the lack of nucleic acid dyes.

[0137] These experimental findings directly support the initial inference that, for CRD-Reporter', cutting the reachable ring region does not sufficiently perturb the rigid duplex frame to induce significant fluorophore release or rotational degree of freedom changes.

[0138] Example 5: Validation of the accuracy and repeatability of the fluorescence polarization biosensor.

[0139] To evaluate the analytical precision and reproducibility of the FP-based RCA-CRISPR / Cas12a biosensor, 200 consecutive measurements were performed at two representative AFB1 concentrations under both negative (NTC) and positive (Pos) conditions. Figure 7A As shown, the FP signals of NTC and the low-energy AFB1 group (0.03 ng / mL) remained highly consistent across 200 repeated measurements, indicating negligible instrument and program drift. Statistical analysis showed a low relative standard deviation (RSD). NTC = 1.03%, RSD Pos = 1.47%, confirming excellent accuracy for trace-level detection. To further evaluate robustness at high analyte levels, the same evaluation was performed at 3 ng / mL AFB1. Figure 7B As shown, the NTC group and the positive group maintained tightly clustered FP values ​​across all 200 tests. Correspondingly, statistical analysis showed an RSD of 1.03% (RSD...). NTC ) and 1.62% (RSD) PosThis further demonstrates high reproducibility and negligible signal fluctuations at high concentrations. Notably, the superior stability of FP readout stems from the inherent ratio of FP, determined by the ratio of parallel to perpendicular emission components, rather than absolute fluorescence intensity. These results indicate that the proposed biosensor achieves excellent accuracy and repeatability, meeting the requirements for reliable quantitative detection in complex food matrices.

[0140] Example 6: Comparison of FP signals of fluorescence polarization biosensors in different systems.

[0141] To verify whether each biochemical enzyme functioned as expected in the RCA-coupled CRISPR / Cas12a FP assay, a series of mechanistic control experiments were performed, selectively omitting key elements, including T4 DNA ligase, Phi29 DNA polymerase, and Cas12a (see [link to mechanistic control experiments]). Figures 8A-8D These configurations allow us to analyze their specific contributions to CRD-Reporter digestion and FP modulation. Figure 8A First, the role of T4 DNA ligase was verified. No difference in FP was observed between the -AFB1 and +AFB1 groups, indicating that effective signal transduction cannot be achieved in the absence of T4 DNA ligase. Without ligase-mediated circularization, PP remains linear and cannot serve as a substrate for RCA. Therefore, no RCA amplicons are generated to activate CRISPR / Cas12a, and the CRD reporter remains intact and maintains high FP. Similarly, Figure 8B The Phi29 DNA polymerase is omitted, and the FP value is related to... Figure 4A Almost identical. Although the ligase successfully circularized the PP, the absence of the polymerase prevented RCA elongation. Since Cas12a activation is strictly dependent on the target repeat sequence generated by the RCA, the CRD-Reporter did not undergo cleavage. This result confirms that RCA amplification is indispensable for downstream CRISPR activation and FP readout. Figure 8C In the study, after removing the Cas12a-crRNA complex, the FP change between the positive and negative groups was negligible. Although template circularization and RCA amplification were successful, the lack of nuclease eliminated the mechanism of CRD-Reporter cleavage, resulting in... Figure 8A and 8B Similar high FP values. In contrast, Figure 8DThis indicates that robust RCA amplification occurs when all essential components (including T4 DNA ligase, Phi29 DNA polymerase, and Cas12a-crRNA) are present simultaneously, followed by efficient activation of Cas12a. Activated Cas12a cleaves the CRD-Reporter, disrupting its rigid duplex structure and generating a freely rotating fragment. As expected, this structural shift produced a significant decrease in FP, ΔFP ≈ 146 mP compared to the negative control group. This significant decrease in FP confirms that the entire cascade reaction, from aptamer recognition to RCA amplification, CRISPR activation, and conformational restriction depolarization, proceeded as designed.

[0142] Example 7 Condition Optimization

[0143] To maximize the analytical performance of FP detection by the RCA-CRISPR-based CRD-Reporter, several key parameters were systematically optimized. This was achieved by monitoring the FP signals of target AFB1 deficiency (-AFB1) and presence (+AFB1) and calculating the net response (ΔFP = FP). -AFB1 -FP +AFB1 )(See Figures 9A-9D Optimize accordingly. For example... Figure 9A As shown, increasing the cDNA concentration from 2 to 12 μM had little effect on the background FP of -AFB1, while the FP value of +AFB1 gradually decreased, leading to an increase in ΔFP. The maximum ΔFP was obtained in the range of 5-12 μM, and 5 μM was selected as the optimal cDNA concentration to save reagents. The RCA reaction time T... RCA See the impact Figure 9B - The FP controlled by AFB1 remained almost constant between 30 and 90 minutes. In contrast, the FP of AFB1-positive samples initially decreased from 30 to 60 minutes, reflecting a gradual increase in reporter Cas12a-mediated cleavage, followed by a gradual increase between 75 and 90 minutes, possibly due to excessive stretching of RCA products and increased solution crowding, partially boosting the FP baseline. Consistent with this trend, ΔFP reached its maximum at 60 minutes and then decreased slightly, thus selecting T... RCA = 60 minutes is the optimal amplification time. Figure 9C The concentration of CRD-Reporter (C) was shown. CRD-ReporterThe effect of reporter concentration on the overall FP (fiber retrieval) was investigated. In the -AFB1 group, the FP value steadily increased with increasing reporter concentration, reflecting the expected increase in global molecular rigidity as more intact duplex reporters contribute to the polarization signal. In contrast, the +AFB1 group exhibited a non-monotonic trend, with the FP value initially decreasing at 5–25 nM reporter concentrations and subsequently increasing at 50 nM. This biphasic pattern is mechanistically plausible: at low reporter protein concentrations (≤25 nM), Cas12a activated by the RCA amplicon rapidly cleaves most available reporter molecules. Due to the limited number of reporter molecules, the cleavage is almost complete, producing a large number of short, freely rotating fragments, leading to a significant decrease in FP. At higher reporter concentrations (50 nM), although Cas12a remains active, the amount of reporter exceeds the effective cleavage capacity of the nuclease within the reaction time window. Therefore, a significant portion of intact and rigid reporters remain uncleaved, shifting the collection rotation-related time upwards, causing the FP to rise again. Thus, 25 nM was chosen as a trade-off between signal amplitude and background. Finally, the CRISPR / Cas12a reaction time (T0) was investigated. CRISPR / Cas12a )(See Figure 9D -AFB1 FP remained almost constant, while +AFB1 FP gradually decreased with increasing latency, reflecting successive reporter cutoffs. Correspondingly, ΔFP rose, reaching a plateau after approximately 50-60 minutes, with 50 minutes being adopted as the optimal T for subsequent experiments. CRISPR / Cas12a .

[0144] Example 8 Sensitivity Measurement

[0145] like Figure 10A As shown, under optimal conditions, the absolute FP value gradually decreased as the AFB1 concentration increased from 0 to 300 ng / mL. This decrease stems from Cas12a-mediated enhanced cleavage in the CRD-Reporter, which induces rapid rotation of the fluorophore, thereby reducing measurement polarization. To further quantify the analytical response, the FP reduction at each concentration (ΔFP = FP) was calculated. NTC -FP Pos ).like Figure 10B As shown, ΔFP exhibits a clear upward trend and is monotonically correlated with AFB1 concentration, indicating that the signal difference between NTC and positive samples becomes more pronounced as the target level increases. Figure 10C It provides a qualitative visualization of concentration-dependent FP changes, with heatmaps clearly highlighting the gradual transition from a high-polarization (low AFB1) state to a low-polarization (high AFB1) state. Figure 10D The calibration curve is shown by plotting ΔFP against the logarithm of AFB1 concentration. Within the test range (R² = 0.9908), ΔFP = 104.9 + 28.59lgC. AFB1The strong linear correlation confirms the robustness and quantitative reliability of the FP-based readings. The wide linear range stems from the proportional FP readings, which utilize proportional RCA amplification with gradual Cas12a activation and minimize signal saturation background interference. The LOD, determined using the 3σ rule, is 0.00113 ng / mL, reflecting the high sensitivity achieved through programmable RCA amplification and CRISPR / Cas12a-triggered reporter depolarization. Table S2 compares this assay with previously reported mycotoxin detection methods, demonstrating its superior performance in terms of LOD, detection time, and linear dynamic range.

[0146] Example 9 Specificity determination

[0147] The specificity and anti-interference capability of the RCA-CRISPR / CRD-Reporter biosensor were systematically evaluated (see...). Figures 11A-11B ).like Figure 11A As shown, FP responses were recorded in the presence of various structure-related aflatoxins (AFB1, AFB2, AFG1, and AFG2) and irrelevant toxins (STX, MC-LR, and OA). The FP signals generated by all non-target analytes were comparable to the blank control, indicating that the CRD-Reporter remained intact and that none of these species triggered aptamer replacement, RCA initiation, or CRISPR / Cas12a activation. In contrast, the AFB1 group showed a significant reduction in FP, producing a significantly higher ΔFP than all other tested fungal toxins. The corresponding radar plot further highlights the specificity for AFB1, despite its structural similarity to other aflatoxins.

[0148] To further evaluate the platform's robustness in complex environments, competing interference measurements were conducted (see...). Figure 11B When potential interfering agents (Mix I: AFB2, AFG1, AFG2, STX, MC-LR, and OA) were tested individually, the FP signal remained largely unchanged, exhibiting negligible nonspecific activation. However, when AFB1 was excited together with these interfering agents (Mix II: Mix I and AFB1), the FP decreased significantly, comparable to that of pure AFB1. In all cases, the ΔFP generated by Mix II and pure AFB1 was significantly higher than that of Mix I, indicating that neither the structure-related aflatoxin nor the irrelevant toxins hindered aptamer binding, RCA amplification, or downstream Cas12a cleavage. Radar plots further visualized this robust discriminative ability, showing a persistently high ΔFP for AFB1, while the response to co-existing mycotoxins was near zero. These findings demonstrate that this biosensor exhibits excellent specificity and strong anti-interference performance, ensuring reliable detection of AFB1 in complex food matrices.

[0149] Example 10: Spiked Recovery Determination of Actual Samples

[0150] To evaluate the applicability of the RCA-CRISPR / Cas12a-based FP biosensor system in complex food matrices, a series of representative agricultural products and foods, including rice, wheat, corn, peanuts, and tea (white tea, black tea, and green tea), were selected as AFB1 sample matrices, with buffer detection performance as a benchmark. The overall analytical workflow for AFB1-spiked real samples was as follows: Figure 12A The diagram is shown below. The corresponding FP recovery results are shown in [the diagram]. Figure 12B As expected, the blank samples showed the highest FP values. In contrast, the FP signals of the AFB1-spiked samples gradually decreased with increasing AFB1 concentrations in the final reaction mixture (0.03, 3, and 150 ng / mL), which represent the concentration in the extract solution injected into the RCA system, not in the original solid matrix. Notably, the FP responses obtained in all tested food matrices were almost identical to those measured in the buffer, indicating that matrix interference was negligible. Figure 12C The ΔFP values ​​corresponding to the three peak levels are shown, which are in high agreement with the ΔFP responses obtained in the buffer system. The recoveries ranged as follows: rice 93.17% to 99.43%, wheat 94.92% to 98.22%, corn 94.03% to 99.56%, peanuts 96.99% to 99.19%, white tea 97.40% to 98.68%, green tea 98.15% to 100.20%, and black tea 91.94% to 97.93%. In all cases, the mean relative standard deviation (RSD) was less than 6.0%, indicating that the proposed RCA-CRISPR / Cas12a-based FP biosensing system has excellent accuracy, repeatability, and applicability to AFB1 detection in a variety of food matrices.

[0151] In addition, the inventors of this case also conducted experiments with other raw materials, process operations, and process conditions described in this specification, referring to the aforementioned embodiments, and obtained relatively ideal results in all cases.

[0152] It should be understood that the technical solutions of the present invention are not limited to the specific embodiments described above. Any technical modifications made to the technical solutions of the present invention without departing from the spirit and scope of the claims are within the scope of protection of the present invention.

Claims

1. A rigid-response fluorescent polarization biosensor for detecting AFB1, characterized in that, include: The target recognition unit includes an aptamer-complementary double-stranded complex that specifically recognizes AFB1, the aptamer-complementary double-stranded complex being formed by hybridization of an aptamer with cDNA; The signal amplification unit includes a rolling circle amplification reaction system, which includes a lock-lock probe for rolling circle amplification and rolling circle amplification reaction reagents. A signal conversion unit, the signal conversion unit including a CRISPR / Cas12a detection system, the CRISPR / Cas12a detection system including LbCas12a protein and crRNA; And a signal output unit, the signal output unit including a conformational restriction depolarization reporter, the conformational restriction depolarization reporter being a single-stranded DNA / double-stranded DNA complex structure, the conformational restriction depolarization reporter being formed by annealing single-stranded DNA and double-stranded DNA.

2. The rigid-response fluorescence polarization biosensor according to claim 1, characterized in that: The aptamer has a sequence as shown in SEQ ID NO. 1; And / or, the cDNA has a sequence as shown in SEQ ID NO. 2; And / or, the locking probe has a sequence as shown in SEQ ID NO. 3; And / or, the crRNA has a sequence as shown in SEQ ID NO. 4; And / or, the single-stranded DNA has a sequence as shown in SEQ ID NO. 5; And / or, the double-stranded DNA has a sequence as shown in SEQ ID NO.

6.

3. The rigid-response fluorescence polarization biosensor according to claim 1, characterized in that: The fluorescent group in the conformationally restricted depolarized reporter is located on the inner strand of the double-stranded DNA, which allows for the effective release of the fluorescent group after Cas12a cleavage.

4. The rigid-response fluorescence polarization biosensor according to claim 1, characterized in that: The aptamer-complementary double-stranded complex is immobilized on the surface of the magnetic beads via biotin-streptavidin interaction.

5. The rigid-response fluorescence polarization biosensor according to claim 1, characterized in that: The rolling circle amplification reaction reagents include T4 DNA ligase, phi29 DNA polymerase, and dNTPs.

6. The use of the rigid-response fluorescent polarization biosensor for detecting AFB1 according to any one of claims 1-5 in the detection of AFB1 or in the preparation of a kit for detecting AFB1.

7. A kit for detecting AFB1, characterized in that, include: The rigid-response fluorescent polarization biosensor for detecting AFB1 according to any one of claims 1-5.

8. A method for detecting AFB1 using the rigid-response fluorescence polarization biosensor for detecting AFB1 as described in any one of claims 1-3, characterized in that, include: (1) The aptamer-complementary double-stranded complex was immobilized on the surface of magnetic beads by biotin-streptavidin interaction and then mixed with the sample to be tested for incubation. (2) The product obtained from incubation was separated by magnetic separation technology to obtain the supernatant; (3) The supernatant is mixed with the rolling ring amplification reaction system to obtain the RCA amplification product; (4) The RCA amplification product is mixed with the CRISPR / Cas12a detection system and conformation restriction depolarization reporter to obtain the test product; (5) Construct a standard curve of the decrease in fluorescence polarization value of AFB1 versus AFB1 concentration, detect the fluorescence polarization value of the test product, and achieve quantitative detection of AFB1 in the test sample by comparing the standard curve.

9. The method according to claim 8, characterized in that, Specifically, this includes: providing a series of standard AFB1 samples with different concentrations, using the same steps (1)-(4) to obtain a series of test products, comparing the fluorescence polarization values ​​of the series of test products with the corresponding standard AFB1 samples, thereby constructing a standard curve of fluorescence polarization value decrease ΔFP versus AFB1 concentration.

10. The method according to claim 8, characterized in that: The sample to be tested includes a complex food matrix, which includes any one or more combinations of rice, wheat, corn, peanuts, and tea.