Sarcoma fusion gene nanopore sequencing primer set and application thereof

By designing standardized nanopore sequencing primer sets and matching kits for sarcoma fusion genes, the problems of poor primer specificity and low amplification efficiency in existing technologies have been solved, enabling efficient and accurate detection of sarcoma fusion genes and supporting early diagnosis and targeted therapy.

CN122168759APending Publication Date: 2026-06-09SHANGHAI SIXTH PEOPLES HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610553985.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-24
Publication Date
2026-06-09

AI Technical Summary

Technical Problem

Existing methods for detecting sarcoma fusion genes suffer from poor primer specificity, low amplification efficiency, lack of standardized design systems, and a shortage of alternative primers, resulting in high detection costs and insufficient sensitivity, making it difficult to meet diverse clinical needs.

Method used

A set of nanopore sequencing primers for sarcoma fusion genes with high specificity and excellent amplification performance, following the principle of standardization, was designed. It includes 5 pairs of fixed sequence primers with a length of 18-25 bp, a GC content of 40%-60%, and a 3' end that strictly matches the target sequence. The length of the amplified product is adapted to nanopore sequencing, and the matching kit achieves full-process standardization.

Benefits of technology

This method enables the detection of sarcoma fusion genes with high specificity and high amplification efficiency, simplifies the experimental procedure, and improves the accuracy and universality of detection, providing a reliable molecular biological basis for the early diagnosis and targeted therapy of sarcoma.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122168759A_ABST
    Figure CN122168759A_ABST
Patent Text Reader

Abstract

The application relates to a sarcoma fusion gene nanopore sequencing primer set and application thereof, wherein the primer set comprises five pairs of specific primers (Primer 1-5) with fixed sequences, each primer follows the design principle of 18-25 bp in length, 40%-60% in GC content and strict matching of a target sequence at a 3' end, and the length of an amplification product is 300-800 bp, which is suitable for nanopore sequencing. Through qPCR verification, the primer set has single-peak melting curves, close-to-100% amplification efficiency, strong specificity and excellent amplification performance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology and tumor diagnostic technology, and specifically relates to a nanopore sequencing primer set for sarcoma fusion genes and its application. Background Technology

[0002] Sarcoma is a common malignant bone tumor in clinical practice. Its occurrence and development are closely related to the abnormal expression of specific fusion genes such as EWSR1-FLI1 and PAX3-FOXO1. Accurate detection of fusion genes is a key basis for sarcoma diagnosis, prognostic assessment and targeted therapy formulation.

[0003] Currently, commonly used clinical methods for detecting sarcoma fusion genes include quantitative real-time PCR and first-generation sequencing, which have drawbacks such as low throughput, high detection cost, and insufficient sensitivity. Nanopore sequencing technology, with its advantages of long read length, real-time monitoring, and no need for PCR amplification, has shown great application potential in the field of fusion gene detection. However, its application in sarcoma fusion gene detection is still limited by the lack of primers with high specificity and amplification efficiency, as well as the lack of a standardized primer design system.

[0004] Existing primers suffer from low sequence matching, significant non-specific amplification, and poor compatibility of amplified product length with nanopore sequencing. Furthermore, there are currently no multiple high-quality primer pairs specifically targeting sarcoma fusion genes, making it difficult to meet diverse clinical testing needs. Therefore, there is an urgent need to develop a set of nanopore sequencing primers for sarcoma fusion genes that adhere to standardized design principles, have fixed sequences, high specificity, and excellent amplification performance, along with corresponding kits, to improve the accuracy, efficiency, and universality of sarcoma fusion gene detection. Summary of the Invention

[0005] This invention provides a nanopore sequencing primer set for sarcoma fusion genes and its application, which solves the technical problems of poor specificity, low amplification efficiency, lack of standardized design system and lack of alternative primers in existing sarcoma fusion gene detection primers.

[0006] In a first aspect, the present invention provides a nanopore sequencing primer set for sarcoma fusion genes, comprising at least one pair of specific primers: Primer 1: The forward primer sequence is CACCTCCATCCTACCCTCCT, and the reverse primer sequence is GTCCGTCATTTTGAACTCCC; Primer 2: The forward primer sequence is CTACTCCAACTGCCCCCCAG, and the reverse primer sequence is CCGTCATTTTGAACTCCCCG; Primer 3: The forward primer sequence is CCTCCTACCAGCTATTCCTC, and the reverse primer sequence is TCTTACTGATCGTTTGTGCC; Primer 4: The forward primer sequence is AGCCACTGCACCTACAAGAC, and the reverse primer sequence is TCCAGGAGGAATTGCCACAG; Primer 5: The forward primer sequence is GAACACCTATGGGCAACCGA, and the reverse primer sequence is CTCCAGGAGGAATTGCCACA.

[0007] The primer pairs described above are designed to target the core sequences of common fusion genes in sarcomas (such as EWSR1-FLI1 and PAX3-FOXO1). The forward and reverse sequences of each primer pair are fixed sequences, and all primers follow a unified standardized design principle.

[0008] Furthermore, each primer in the primer set is 18-25 bp in length, has a GC content of 40%-60%, has no consecutive identical bases, and the 3' end of the primer strictly matches the target sequence of the sarcoma fusion gene.

[0009] Furthermore, the primer set amplifies the sarcoma fusion gene to a product length of 300-800 bp, which is suitable for the fragment length requirements of nanopore sequencing.

[0010] Secondly, the present invention provides a primer composition comprising the aforementioned nanopore sequencing primer set for sarcoma fusion genes, and further comprising one or more of PCR reaction buffer, dNTPs, DNA polymerase, and reverse transcriptase, which can be directly used for the amplification reaction of sarcoma fusion genes, simplifying experimental operations.

[0011] Thirdly, the present invention provides the application of the aforementioned nanopore sequencing primer set for sarcoma fusion genes or the aforementioned primer composition in the preparation of sarcoma fusion gene detection reagents.

[0012] Fourthly, the present invention provides the application of the aforementioned sarcoma fusion gene nanopore sequencing primer set or the aforementioned primer composition in sarcoma fusion gene nanopore sequencing.

[0013] Fifthly, the present invention provides the application of the nanopore sequencing primer set or the primer composition for sarcoma fusion gene in detecting EWSR1-FLI1 and PAX3-FOXO1 sarcoma characteristic fusion genes.

[0014] In a sixth aspect, the present invention provides the application of the aforementioned sarcoma fusion gene nanopore sequencing primer set or the aforementioned primer composition in the preparation of sarcoma diagnostic, prognostic assessment or targeted therapy guidance kits.

[0015] Seventhly, this invention provides a nanopore sequencing detection kit for sarcoma fusion genes, comprising the aforementioned nanopore sequencing primer set for sarcoma fusion genes, and further comprising one or more of the following: RNA extraction reagent, cDNA synthesis reagent, qPCR verification reagent, and nanopore sequencing library construction reagent. This invention forms an integrated detection kit, covering the entire process from sample processing to pre-sequencing preparation, achieving standardization and integration of the detection reagents.

[0016] Preferably, the RNA extraction reagent comprises lysis buffer, proteinase K, chloroform, isopropanol, 75% ethanol, and DEPC water.

[0017] Preferably, the cDNA synthesis reagent is a reverse transcription kit.

[0018] Beneficial effects (1) The primer set of the present invention contains 5 pairs of fixed sequence specific primers, and provides preferred primer (Primer 1) and alternative primers (Primer 2~5) to meet the needs of different clinical testing scenarios and improve the universality and flexibility of testing.

[0019] (2) All primers in this invention follow standardized design principles, and the length of the amplified product is highly compatible with nanopore sequencing. qPCR verification showed that the melting curves of each primer set exhibited a single peak, with no non-specific amplification, and the amplification efficiency was close to 100% (2). - With a ΔΔCt value of ≈1, both specificity and amplification performance meet the high standards for clinical testing.

[0020] (3) The primer composition of the present invention can be directly used for fusion gene amplification without additional optimization of the reaction system, and the operation is simple; the matching detection kit realizes the integration of reagents from RNA extraction, cDNA synthesis, qPCR verification to library construction, which greatly simplifies the experimental process and improves detection efficiency. (4) The primer set of the present invention can accurately detect characteristic fusion genes of sarcoma such as EWSR1-FLI1 and PAX3-FOXO1, providing reliable molecular biological basis for early diagnosis, prognostic assessment and selection of targeted therapy for sarcoma. It fills the gap of high-quality primers in the detection of sarcoma fusion genes by nanopore sequencing technology and has high clinical translational value. Attached Figure Description

[0021] Figure 1 This is a schematic diagram of the primer design process for this invention.

[0022] Figure 2 This is the qPCR result data for the primers of this invention.

[0023] Figure 3 The image shows the qPCR results of the primers used in this invention.

[0024] Figure 4 This is a sequence diagram of the fusion gene obtained from the nanopore sequencing results of this invention. Detailed Implementation

[0025] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Furthermore, it should be understood that after reading the teachings of this invention, those skilled in the art can make various alterations or modifications to the invention, and these equivalent forms also fall within the scope defined by the appended claims.

[0026] Example 1 1. Experimental Materials Sarcoma patient tissue samples, positive control cell lines, lysis buffer, proteinase K, TRIzol, chloroform, isopropanol, 75% ethanol, DEPC water, reverse transcription kit, qPCR reaction buffer, dNTPs, Taq DNA polymerase, nanopore sequencing library construction kit; 1.5 mL sterile Eppendorf tubes, high-speed refrigerated centrifuge, qPCR instrument, nanopore sequencing platform (ONTMinION).

[0027] 2. Primer design and synthesis Primer design process as follows Figure 1 As shown in the table below, five pairs of fixed-sequence-specific primers (Primers 1-5) were designed and chemically synthesized targeting the core sequence of the sarcoma fusion gene EWSR1-FLI1, following the design principles of primer length 18-25 bp, GC content 40%-60%, strict 3' end matching of the target sequence, and amplification product 300-800 bp. The sequences are shown in the table below. 3. qPCR performance validation of the primer set Using sarcoma fusion gene positive cDNA samples as templates, qPCR reaction systems were set up with Primers 1-5 as amplification primers, and blank controls were also set up. qPCR reaction program: pre-denaturation 95℃ for 30 seconds; 95℃ for 310 seconds, 60℃ for 1030 seconds, 40 cycles; melting curve using the instrument's default program; Result determination: Amplification efficiency is defined as 2... - A value of ΔΔCt ≈ 1 is considered acceptable, and specificity is indicated by a single peak in the melting curve.

[0028] Validation results: The melting curves of Primers 1-5 all showed a single peak with no non-specific amplification peaks, indicating excellent specificity; the 2- of all primer pairs... -The ΔΔCt values ​​were all close to 1, indicating amplification efficiency close to 100%. Primer 1 showed the best amplification efficiency and specificity, while Primers 2-5 were high-performance alternatives. Figure 2 and Figure 3 As shown.

[0029] 4. Validation of nanopore sequencing applications using primer sets ①Tissue samples were taken from sarcoma patients, and after dewaxing, dehydration, and lysis, total RNA was extracted using the TRIzol method, and cDNA was synthesized using a reverse transcription kit; ② Using Primers 1-5 as primers, PCR amplification of cDNA was performed, and the amplification products were used to construct nanopore sequencing libraries. ③ Load the library onto the ONT MinION nanopore sequencing platform for sequencing and analyze the fusion gene sequence.

[0030] ④ Verification results: such as Figure 4 As shown, Primers 1-5 successfully amplified the target fragment of the sarcoma fusion gene, and nanopore sequencing clearly detected the EWSR1-FLI1 fusion gene sequence. The sequencing results matched the target sequence 100%, proving that this primer set can be efficiently applied to the nanopore sequencing detection of sarcoma fusion genes.

[0031] The nanopore sequencing primer set for sarcoma fusion genes of this invention consists of standardized primers with fixed sequences, enabling large-scale chemical synthesis. The matching primer composition and detection kit can be industrially produced. The products have good stability and long shelf life, and can be widely used in hospitals at all levels, third-party medical testing institutions, and biological laboratories for the detection of sarcoma fusion genes. It has significant industrial application value and clinical promotion value.

[0032] This invention solves the key technical problems of poor primer specificity, low amplification efficiency, and cumbersome experimental procedures in nanopore sequencing of sarcoma fusion genes by standardizing primer design, developing multiple pairs of fixed sequence primers, and constructing supporting reagent kits. It provides a reliable molecular biology tool for the precise diagnosis and treatment of sarcoma and has broad application prospects.

Claims

1. A nanopore sequencing primer set for sarcoma fusion genes, characterized in that, Includes at least one pair of specific primers: Primer 1: The forward primer sequence is CACCTCCATCCTACCCTCCT, and the reverse primer sequence is GTCCGTCATTTTGAACTCCC; Primer 2: The forward primer sequence is CTACTCCAACTGCCCCCCAG, and the reverse primer sequence is CCGTCATTTTGAACTCCCCG; Primer 3: The forward primer sequence is CCTCCTACCAGCTATTCCTC, and the reverse primer sequence is TCTTACTGATCGTTTGTGCC; Primer 4: The forward primer sequence is AGCCACTGCACCTACAAGAC, and the reverse primer sequence is TCCAGGAGGAATTGCCACAG; Primer 5: The forward primer sequence is GAACACCTATGGGCAACCGA, and the reverse primer sequence is CTCCAGGAGGAATTGCCACA.

2. The nanopore sequencing primer set for sarcoma fusion genes according to claim 1, characterized in that, The primers in the primer set are 18-25 bp in length, have a GC content of 40%-60%, have no consecutive identical bases, and the 3' end of the primers strictly matches the target sequence of the sarcoma fusion gene.

3. The nanopore sequencing primer set for sarcoma fusion genes according to claim 1, characterized in that, The primer set amplifies the sarcoma fusion gene to a product length of 300-800 bp, which is suitable for the fragment length requirements of nanopore sequencing.

4. A primer composition comprising the nanopore sequencing primer set for sarcoma fusion genes according to any one of claims 1 to 3, characterized in that, It also includes one or more of the following: PCR reaction buffer, dNTPs, DNA polymerase, and reverse transcriptase.

5. The use of the nanopore sequencing primer set for sarcoma fusion genes according to any one of claims 1 to 3 or the primer composition according to claim 4 in the preparation of sarcoma fusion gene detection reagents.

6. The application of the nanopore sequencing primer set for sarcoma fusion genes according to any one of claims 1 to 3 or the primer composition according to claim 4 in nanopore sequencing of sarcoma fusion genes.

7. The use of the nanopore sequencing primer set for sarcoma fusion genes according to any one of claims 1 to 3 or the primer composition according to claim 4 in detecting the characteristic fusion genes of EWSR1-FLI1 and PAX3-FOXO1 sarcoma.

8. The use of the sarcoma fusion gene nanopore sequencing primer set according to any one of claims 1 to 3 or the primer composition according to claim 4 in the preparation of sarcoma diagnostic, prognostic assessment or targeted therapy guidance kits.

9. A nanopore sequencing detection kit for sarcoma fusion genes, comprising the nanopore sequencing primer set for sarcoma fusion genes as described in any one of claims 1 to 3, characterized in that, It also includes one or more of the following: RNA extraction reagents, cDNA synthesis reagents, qPCR verification reagents, and nanopore sequencing library construction reagents.

10. The sarcoma fusion gene nanopore sequencing detection kit according to claim 9, characterized in that, The RNA extraction reagent includes lysis buffer, proteinase K, chloroform, isopropanol, 75% ethanol, and DEPC water; the cDNA synthesis reagent is a reverse transcription kit.