A kit for detecting the differentiation state of drosophila testis spermatogonia and application thereof
The kit for detecting the expression levels of Bckdhb and Piwi genes solved the problem of inhibited differentiation of spermatogonia in Drosophila testes, enabling effective assessment of spermatogonia differentiation status, and has significant research and clinical application value.
Patent Information
- Application Number
- CN202610314335.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-16
- Publication Date
- 2026-06-09
AI Technical Summary
In the existing technology, Bckdhb knockdown in the testes of Drosophila leads to the inhibition of spermatogonial differentiation, and its role and molecular mechanism in male reproductive health are unclear, lacking effective detection methods to determine the differentiation status of spermatogonial cells.
Using Bckdhb as a detection marker, a kit for detecting Bckdhb gene expression level was prepared. Combined with Piwi gene expression level, qRT-PCR technology was used to determine the differentiation status of Drosophila testis spermatogonia, including the primer sequences for detecting Bckdhb mRNA and Piwi mRNA (SEQ ID NO. 1-4), and the expression level of Bckdhb in the testes was knocked down using the (UAS)/Gal4 system.
By detecting changes in the expression levels of Bckdhb and Piwi, the differentiation status of testicular spermatogonia can be effectively determined, providing a diagnostic criterion for judging spermatogonia differentiation obstruction, which has important research and clinical application value.
Smart Images

Figure CN122168766A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical technology, specifically to a kit for detecting the differentiation status of spermatogonia in Drosophila testis and its application. Background Technology
[0002] In Drosophila, spermatogenesis comprises three main stages: the pre-meiotic stage begins with the self-renewal and differentiation of spermatogonial stem cells; during meiosis, spermatocytes undergo meiosis to form haploid spermatids; and the post-meiotic stage involves spermatids developing into mature sperm through morphological remodeling. Throughout this process, spermatogonia, as a key intermediate cell type connecting spermatogonial stem cells and meiotic spermatocytes, play a crucial role in maintaining a balance between differentiation and proliferation, which is essential for normal spermatogenesis. This balance not only ensures the continuous production of sperm but also provides a sufficient cellular basis for meiosis, thereby guaranteeing the stability of reproductive function.
[0003] Bckdhb encodes a subunit of branched-chain ketoacid dehydrogenase (BCKDH), which catalyzes the first irreversible and rate-limiting step in BCAA catabolism and is inhibited by phosphorylation of BCKDH kinase (BCKDK). Although studies have shown that BCAAs have diverse metabolic and physiological functions, participating in protein synthesis, glucose and lipid metabolism, and playing a major role in the immune and nervous systems, the role and molecular mechanism of BCAA accumulation caused by Bckdhb knockdown in male testicular spermatogenesis remain unclear.
[0004] In the Drosophila testes, Piwi is essential not only for maintaining the self-renewal and differentiation of germline stem cells (GSCs) but also for maintaining somatic vesicular stem cells (CySCs). Ectopic expression of Bam in germline stem cells may specifically downregulate Piwi expression in germline cell lines.
[0005] This invention, based on previous research, revealed that Bckdhb is predominantly expressed in Drosophila testicular tissue, and its expression level is closely related to the differentiation status of spermatogonia. Using the (UAS) / Gal4 system, Bckdhb expression in the testes was knocked down, driven by Bam-Gal4. Bam is a key differentiation factor required for germ cell differentiation and is specifically expressed in differentiated spermatogonia; testes lacking Bam show an accumulation of undifferentiated spermatogonia. Drosophila exhibited a significant phenotype of impaired spermatogonia differentiation, including accumulation of undifferentiated cells in the testicular apex and impaired germ cell differentiation. Simultaneously, the mRNA expression level of Bckdhb was significantly decreased, while the mRNA expression level of Piwi was significantly increased. Therefore, exploring the role of Bckdhb in Drosophila testicular spermatogonia provides a theoretical basis for male reproductive health and has significant clinical implications. Summary of the Invention
[0006] Technical Problem Solved: Addressing the problems existing in the prior art, this invention proposes a kit for detecting the differentiation status of spermatogonia in Drosophila testis and its application. Bckdhb is a gene previously screened and identified by the inventor's research group. Knockdown of Bckdhb results in inhibited spermatogonia differentiation, thus possessing significant research and application value. Using Bckdhb as a marker for detecting spermatogonia differentiation status, a corresponding detection kit is prepared. Knockdown of Bckdhb results in inhibited spermatogonia differentiation, and detecting the expression level of Bckdhb can effectively determine the differentiation status of testicular spermatogonia.
[0007] Technical solution: The first objective of this invention is to provide a kit for detecting the differentiation status of spermatogonia in Drosophila testis, the kit comprising reagents for detecting the expression level of the Bckdhb gene.
[0008] This invention utilizes the (UAS) / Gal4 system to knock down the expression level of Bckdhb in the testes, driven by Bam-Gal4, to clearly identify the characteristics of spermatogonial differentiation arrest, including the accumulation of undifferentiated germ cells at the testicular apex and germ cell differentiation disorder. In testicular tissue with downregulated Bckdhb expression, spermatogonial differentiation is impaired, including an increased distance of deep nuclear staining at the testicular apex and germ cell differentiation defects. After knocking down Bckdhb, the mRNA expression level of Bckdhb in the testes significantly decreased, while the mRNA expression level of Piwi significantly increased.
[0009] Preferably, the reagent for detecting the expression level of the Bckdhb gene includes primers for detecting Bckdhb mRNA, the primer sequences of which are shown in SEQ ID NO.1 and SEQ ID NO.2.
[0010] Preferably, the kit also includes a reagent for detecting the expression level of the Piwi gene, and the combined detection of the expression levels of Bckdhb and Piwi helps to determine the differentiation status of spermatogonia.
[0011] Preferably, the reagent for detecting Piwi gene expression level includes primers for detecting Piwi mRNA, the primer sequences of which are shown in SEQ ID NO.3 and SEQ ID NO.4.
[0012] The second objective of this invention is to provide the application of the Bckdhb gene as a biomarker in the preparation of a kit for detecting the differentiation status of Drosophila testis spermatogonia.
[0013] The third objective of this invention is to provide the application of reagents for detecting the expression level of the Bckdhb gene in the preparation of a kit for detecting the differentiation status of Drosophila testis spermatogonia.
[0014] Preferably, the reagent for detecting the expression level of the Bckdhb gene is used in combination with the reagent for detecting the expression level of the Piwi gene to prepare a kit for determining the differentiation status of spermatogonia in the testes of Drosophila.
[0015] The fourth objective of this invention is to provide a method for detecting the differentiation status of Drosophila testis spermatogonia for non-diagnostic purposes, including the step of detecting the expression level of the Bckdhb gene in the test sample.
[0016] As a preferred option, downregulation of the Bckdhb gene expression level indicates impaired spermatogonial differentiation.
[0017] Preferably, the test sample is fruit fly testicular tissue.
[0018] Beneficial effects:
[0019] 1. This invention is the first to discover the association between the Bckdhb gene and spermatogonial differentiation. Downregulation of Bckdhb expression can lead to impaired spermatogonial differentiation. By detecting the expression level of Bckdhb in testicular tissue samples, the degree of impaired spermatogonial differentiation can be effectively determined, which has important research value for the testicular spermatogenesis process.
[0020] 2. The kit described in this invention uses the inhibition of spermatogonial differentiation following Bckdhb knockdown in testicular tissue as a diagnostic criterion. The expression level of Bckdhb in the testes is knocked down using the UAS / Gal4 system, driven by Bam-Gal4, to clearly identify the accumulation of undifferentiated germ cells in the testicular apex and the characteristic of impaired germ cell differentiation, thus representing the inhibition of spermatogonial differentiation. The kit uses qRT-PCR technology to detect a significant decrease in Bckdhb expression and a significant increase in Piwi expression in the sample tissue. Attached Figure Description
[0021] Figure 1 Bckdhb knockdown leads to germ cell differentiation defects. Figure a shows the distance of the deeply stained region of the apical nucleus in the testis in the Control, Bam>Bckdhb RNAi, and Bam>Bckdhb RNAi groups; Figure b shows the Vasa+FasⅢ+1B1 staining results in the Control, Bam>Bckdhb RNAi, and Bam>Bckdhb RNAi groups;
[0022] Figure 2 The effect of Bckdhb knockdown on the expression levels of Bckdhb and Piwi genes in the testes of Drosophila is shown in the figure. Detailed Implementation
[0023] Embodiments of the present invention are described in detail below, examples of which are illustrated in the accompanying drawings. The embodiments described below with reference to the accompanying drawings are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention.
[0024] Example 1: Bckdhb knockdown leads to impaired spermatogonial differentiation.
[0025] Immunofluorescence staining was used to observe the effect of Bckdhb knockdown on spermatogonial differentiation in male Drosophila using immunofluorescence staining techniques.
[0026] (1) Fruit fly rearing:
[0027] The fruit flies were reared in a dedicated fruit fly incubator at a temperature of 28℃ and a relative humidity maintained between 40% and 60%. Their food was changed weekly. The fruit flies used in this experiment were wild-type (w). 1118 Bam>Bckdhb RNAi and Bam>BckdhbRNAi; △86 / + male Drosophila. Bam>Bckdhb RNAi and Bam>Bckdhb RNAi; △86 / + Drosophila were obtained by specifically knocking down Bckdhb (FlyBase ID: FBgn0039993) in spermatogonia using the (UAS) / Gal4 system, driven by Bam-Gal4, through hybridization of UAS-Bckdhb RNAi (from Tsinghua University Drosophila Resource Center #TH04293.N) with Bam-Gal4; △86 / TM3. The relevant UAS-Gal4 hybridization method can be found in Cell Death Dis. 2021 May14;12(5):491. doi: 10.1038 / s41419-021-03783-9. After mating, female fruit flies lay eggs and go through larval, pupa, and other stages before finally emerging as adults. Male fruit flies within two days of emergence were collected, and immunofluorescence staining of testicular tissue was performed.
[0028] (2) Immunofluorescence staining
[0029] Wild-type fruit flies were selected. 1118 Bam>Bckdhb RNAi and Bam>Bckdhb RNAi; △86 / + Drosophila, testicular tissue was obtained by dissection within 2 days of birth. Testicular tissue was fixed with 4% PFA (paraformaldehyde) for 30 min. It was permeabilized with 1% PBST (phosphate-buffered saline containing TWEEN20) for 15 min. Finally, it was blocked with BSA (bovine serum albumin) for 30 min.
[0030] Primary antibody working solution information:
[0031]
[0032] Testicular tissue was incubated with diluted primary antibody working solution (100 μl) at room temperature for one hour or overnight at 4°C. After primary antibody incubation, the tissue was washed three times with 1% PBST for 5 min each time. Secondary antibody working solution (1:800 dilution, 100 μl) containing A488, Cy3, and A647 fluorescent groups was then incubated (in the dark) for 1 hour. After secondary antibody incubation, the tissue was washed three times with 1% PBST for 5 min each time. Hoechst staining solution (1:1000 dilution, 100 μl) was added and the tissue was treated at room temperature in the dark for 10 min. Testicular tissue was pipetteted and transferred to a glass slide. Impurities were removed and the tissue was arranged using fine forceps. The slide was then mounted with an anti-quenching agent. The distance of deep staining of the nucleus at the testicular apex and the differentiation of germ cells were observed under a fluorescence microscope.
[0033] Immunofluorescence results showed that, compared with wild-type Drosophila, knocking down the Bckdhb gene in male Drosophila increased the distance of deep staining at the apical nucleus of the testes, led to the accumulation of early undifferentiated germ cells, and resulted in germ cell differentiation defects. These results indicate that Bckdhb knockout leads to impaired spermatogonial differentiation.
[0034] Example 2: Real-time quantitative PCR detection of Bckdhb and Piwi expression levels in Drosophila testes
[0035] This embodiment uses qRT-PCR technology to verify the changes in mRNA expression of the Bckdhb and Piwi genes in the testes of Bckdhb knockdown flies, as detailed below:
[0036] Real-time quantitative PCR (qRT-PCR):
[0037] Wild-type fruit flies were extracted separately. 1118 Bam>Bckdhb RNAi and Bam>Bckdhb RNAi were used to obtain RNA from Drosophila testis tissue (Trizol method). The RNA was reverse transcribed to obtain the corresponding cDNA, which was stored at -20°C. The expression levels of Bckdhb and Piwi in Drosophila testis tissue were detected by qRT-PCR. The commonly used internal control gene (Gapdh) was used as a reference gene for qPCR in the above three groups of testis tissue samples. Real-time quantitative PCR was performed on two genes (Bckdhb and Piwi) in the four sample groups.
[0038] The primer sequences are:
[0039] Bckdhb-F: TGTTTGGCGAGGATGTGGGATTC (SEQ ID NO.1)
[0040] Bckdhb-R: AAGCCTGCGATTCCTTGCTCAC (SEQ ID NO.2)
[0041] piwi-F: ACTGGAACTTATGTGAGAGCAATGG (SEQ ID NO.3)
[0042] piwi-R: GATTGATGAGTATCTTTCGGGCTTATC (SEQ ID NO.4)
[0043] Gapdh-F:GTGGTGAACGGCCAGAAGAT (SEQ ID NO.5)
[0044] Gapdh-R: GCCTTGTCAATGGTGGTGAA (SEQ ID NO.6)
[0045] Specifically, the RNA extraction process is as follows:
[0046] 1. Dissect and collect Drosophila testes in pre-cooled RNase-free PBS buffer (complete within 30 minutes).
[0047] 2. Add 1 mL of Trizol to every 50-100 mg of tissue for lysis and transfer to an RNase-free centrifuge tube. Let stand at room temperature for 5 minutes.
[0048] 3. Add 0.2 ml of chloroform to every 1 mL of Trizol, tighten the cap, shake vigorously by hand for 15 seconds, and let stand at room temperature for 2-3 minutes.
[0049] 4. Centrifuge at 12,000×g for 15 minutes at 4℃. After centrifugation, the mixture separates into three layers: a colorless upper aqueous phase (containing RNA), a white middle layer (containing DNA), and a red lower organic phase (containing protein).
[0050] 5. Carefully aspirate the upper aqueous phase (approximately 500 μL) into a new centrifuge tube, being careful not to touch the middle layer to avoid contamination.
[0051] 6. Add an equal volume of isopropanol, gently invert to mix, and let stand at room temperature for 10 minutes.
[0052] 7. Centrifuge at 12,000×g for 10 minutes at 4℃. After centrifugation, a gel-like precipitate, i.e., total RNA, will be visible at the bottom of the tube.
[0053] 8. Carefully discard the supernatant, add 1 mL of 75% ethanol (prepared with DEPC water), and gently shake to wash the precipitate.
[0054] 9. Centrifuge at 7,500×g for 5 minutes at 4℃.
[0055] 10. Discard the ethanol and dry at room temperature for 5-10 minutes.
[0056] 11. Add an appropriate amount of RNase-free water (10-30 μL) to dissolve.
[0057] Reverse transcription process:
[0058] Preparation of reverse transcription system (10 μL):
[0059]
[0060] Gently mix the prepared system, centrifuge briefly, and then place it into a PCR instrument.
[0061] Reverse transcription: 37℃, 15 minutes.
[0062] Enzyme inactivation: 85℃, 5 seconds.
[0063] Storage: After the reaction is complete, immediately place the cDNA at 4°C for short-term storage or at -20°C for long-term storage.
[0064] qPCR process:
[0065] ① Prepare the qRT-PCR reaction system (10 μl):
[0066]
[0067] Repeat wells: Nine technical replicates were performed for each sample.
[0068] ②Reaction procedure:
[0069]
[0070] See real-time quantitative PCR results Figure 2 As can be seen from the figure, compared with wild-type Drosophila testis tissue, knocking down Bckdhb significantly reduced the mRNA expression level of Bckdhb, while significantly increasing the mRNA expression level of piwi.
[0071] Example 3 Preparation of the reagent kit
[0072] This embodiment provides a method for preparing a kit for detecting the differentiation status of spermatogonia in the testes of Drosophila.
[0073] The kit consists of the following components:
[0074] Reagents for detecting Bckdhb gene expression levels, including Bckdhb gene primers SEQ ID NO.1 and SEQ ID NO.2;
[0075] Optional reagents for detecting piwi gene expression levels include piwi gene primers SEQ ID NO.3 and SEQ ID NO.4;
[0076] Internal reference gene primers (Gapdh) SEQ ID NO. 5 and SEQ ID NO. 6;
[0077] Standard reagents for qRT-PCR.
[0078] Method of application: Total RNA was extracted from the testicular tissue of Drosophila, and cDNA was obtained by reverse transcription. The cDNA was then used as a template for qRT-PCR to detect the mRNA expression level of the Bckdhb gene. A significant downregulation of Bckdhb expression compared to the normal control suggests possible inhibition of spermatogonial differentiation.
[0079] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features therein. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. A kit for detecting the differentiation status of spermatogonia in the testes of Drosophila, characterized in that, The kit includes reagents for detecting the expression level of the Bckdhb gene.
2. The reagent kit according to claim 1, characterized in that, The reagent for detecting the expression level of the Bckdhb gene includes primers for detecting Bckdhb mRNA, the primer sequences of which are shown in SEQ ID NO.1 and SEQ ID NO.
2.
3. The reagent kit according to claim 1, characterized in that, The kit also includes reagents for detecting the expression level of the Piwi gene, which can be used to help determine the differentiation status of spermatogonia by jointly detecting the expression levels of Bckdhb and Piwi.
4. The reagent kit according to claim 3, characterized in that, The reagent for detecting Piwi gene expression level includes primers for detecting Piwi mRNA, the primer sequences of which are shown in SEQ ID NO.3 and SEQ ID NO.
4.
5. Application of the Bckdhb gene as a biomarker in the preparation of a kit for detecting the differentiation status of Drosophila testis spermatogonia.
6. Application of reagents for detecting Bckdhb gene expression levels in the preparation of kits for detecting the differentiation status of Drosophila testis spermatogonia.
7. The application according to claim 6, characterized in that, The reagents for detecting the expression level of the Bckdhb gene and the reagents for detecting the expression level of the Piwi gene are used together to prepare a kit for determining the differentiation status of spermatogonia in the testes of Drosophila.
8. A method for detecting the differentiation status of Drosophila testis spermatogonia for non-diagnostic purposes, characterized in that, This includes steps to detect the expression level of the Bckdhb gene in the test sample.
9. The method according to claim 8, characterized in that, Downregulation of Bckdhb gene expression indicates impaired spermatogonial differentiation.
10. The method according to claim 8, characterized in that, The test sample was Drosophila testicular tissue.