A peptide / aptamer / Ti3C2-CNTs-Au electrochemical aptamer sensor, its preparation method and application

Abstract

This invention relates to a peptide / aptamer / Ti3C2-CNTs-Au electrochemical aptamer sensor, its preparation method, and its application. The electrochemical aptamer sensor of this invention includes a base electrode, and Ti3C2-CNTs and AuNP films sequentially modified on the surface of the base electrode, as well as TCs aptamers and antifouling peptides sequentially loaded via Au-S bonds; the Ti3C2-CNTs include carbon nanotubes (CNTs) and Ti3C2 nanosheets embedded in the CNTs. Compared with existing technologies, the sensor constructed in this invention has outstanding advantages such as broad-spectrum recognition, high sensitivity, and excellent selectivity, and has been successfully applied to the actual detection of TCs in human serum samples. This technology provides strong technical support for drug hazard management and personalized risk assessment for therapeutic drug monitoring (TDM) in clinical settings, and has significant clinical application value.

Description

Technical Field

[0001] This invention relates to the fields of electrochemical analysis technology and TCs detection technology, and in particular to a peptide / aptamer / Ti3C2-CNTs-Au electrochemical aptamer sensor, its preparation method and application. Background Technology

[0002] Tetracyclines (TCs) are a class of broad-spectrum antibiotics whose overuse and misuse in human clinical and animal health settings have made them bioaccumulative trace hazardous pollutants in the global environment. The pervasive and persistent presence of TCs in environmental substrates (water, soil, and food) represents a major route of human exposure. This environmental exposure to humans raises two key and pressing public health concerns. First, persistent trace exposure accelerates the spread of antimicrobial resistance (AMR) genes within human communities, which are recognized as one of the most serious global health crises of the 21st century. Second, the residual levels of TCs in the human body, whether from environmental exposure or therapeutic administration, are the ultimate endpoint for assessing the individual health risks posed by these hazards. Therefore, ultrasensitive and real-time monitoring of TCs in human blood and other biological fluids is crucial not only for public health risk assessment but also for guiding personalized antimicrobial therapy to minimize drug toxicity and prevent treatment failure.

[0003] Currently, the monitoring of total toxic substances (TCs) in body fluids still relies on traditional methods such as high-performance liquid chromatography (HPLC), enzyme-linked immunosorbent assay (ELISA), capillary electrophoresis (CE), and liquid chromatography-mass spectrometry (LC / MS). While these methods demonstrate extremely high accuracy in trace detection, they are often limited by complex sample pretreatment, lengthy analysis times, and expensive, cumbersome equipment, making it difficult to meet the real-time and rapid diagnostic requirements of clinical total toxicity disorders (TDM). Furthermore, existing methods for assessing the health risks posed by multi-component hazards face dual technical limitations. First, TCs contain a variety of active homologues. Antibody-based immunoassays lack a general understanding of the core structural features of the TC family, and therefore often only detect single or a few homologues. This limitation can lead to false positives or false negatives. Second, the ultra-trace sensitivity required for accurate exposure detection at ng / L levels necessitates separation techniques capable of handling serum / whole blood samples with high protein content. However, complex biomatrix effects often lead to severe signal suppression, posing a significant challenge to the reliability and accuracy of ultra-trace detection. Therefore, developing an ultrasensitive detection technology that combines broad-spectrum recognition capabilities with tolerance to biological matrices has become a key technological challenge that urgently needs to be addressed in the field of biomonitoring.

[0004] Electrochemical sensing technology is widely considered an ideal solution to overcome the challenges of trace drug monitoring due to its high sensitivity, rapid response, and ease of integration. This technology is renowned for its exceptional sensitivity to substances with inherent electrochemical activity. Key biomolecules and drug metabolites, such as dopamine, uric acid, and the antidiabetic drug metformin, can be directly analyzed with high sensitivity via rapid heterogeneous electron transfer at the electrode. However, structurally complex drug molecules, such as TCs, often possess weak intrinsic redox signals and are susceptible to electrochemical background noise generated by various interfering substances in biological fluids. This makes ultra-trace and highly selective analysis via direct electrochemical methods extremely challenging. Therefore, the introduction of high-performance molecular recognition components is crucial.

[0005] Aptamers are widely used due to their high affinity and specificity for recognizing target molecules. However, this extreme specificity makes it difficult to achieve broad-spectrum recognition of structurally similar homologous molecules. This is a fundamental challenge currently facing aptamer-based homologous molecule sensing. Molecular engineering strategies are a key solution to overcome this limitation and achieve broad-spectrum recognition. The high specificity of aptamers stems from the specific secondary or tertiary conformations formed after binding with target molecules. Studies have shown that fine-tuning the aptamer structure can effectively reshape its recognition properties. For example, for the ATP aptamer, sequence minimization not only significantly optimizes binding kinetics and improves flexibility but also creates a larger conformational adjustment space for structurally similar molecules to enter the binding pocket. Furthermore, precisely tuning the unique interaction between the aptamer and the target molecule enables targeted modulation of the recognition spectrum. In designing Salmonella aptamers, researchers successfully extended recognition from a specific serotype to multiple serotypes by mutating key sites, demonstrating that mutation engineering is an effective strategy for achieving broad recognition. Therefore, in order to recognize the conserved core structures in the TC family, it is necessary to precisely tune the conformational change mechanisms of the aptamer.

[0006] Therefore, a highly sensitive and selective broad-spectrum method for the detection of TCs was developed by combining portable electrochemical technology with peptide / aptamer / Ti3C2-CNTs-Au nanocomposites. This method can alleviate the limitations of current detection methods and provide a real-time, rapid diagnostic tool for the management of drug hazards and the personalized assessment of TDM risks in clinical settings. Summary of the Invention

[0007] To address the technical problems of complex sample pretreatment, lengthy analysis time, and expensive and bulky instruments in existing tetracycline (TC) detection technologies, this invention provides a peptide / aptamer / Ti3C2-CNTs-Au electrochemical aptamer sensor, its preparation method, and its applications. This method self-assembles an aptamer with TC-specific recognition capabilities and an antifouling peptide with antifouling capabilities onto the surface of a Ti3C2-CNTs-Au modified electrode via Au-S bonds, effectively improving the sensitivity and selectivity of the analytical method and providing a new approach for the efficient and accurate detection of TCs.

[0008] The first objective of this invention is to provide a peptide / aptamer / Ti3C2-CNTs-Au electrochemical aptamer sensor, comprising a base electrode, and Ti3C2-CNTs and AuNP films sequentially modified on the surface of the base electrode, and TCs aptamers and antifouling peptides sequentially loaded via Au-S bonds. The Ti3C2-CNTs include carbon nanotubes (CNTs) and Ti3C2 nanosheets embedded in the carbon nanotubes (CNTs).

[0009] In some embodiments of the present invention, the base sequence of the TCs aptamer is TCGTCGACGGATCCATGGCACATGGATTACTAGCGAACGCATGAGCCGGCTGCGGCGCATGCGT (as shown in SEQ ID NO.1). The amino acid sequence of the antifouling peptide is CKEKEKEKE (as shown in SEQ ID NO.2); The base electrode includes a glassy carbon electrode.

[0010] A second objective of this invention is to provide a method for preparing the aforementioned peptide / aptamer / Ti3C2-CNTs-Au electrochemical aptamer sensor, comprising the following steps: Provide a basic electrode; Ti3C2 and carbon nanotubes (CNTs) were ultrasonically dispersed in water to obtain a Ti3C2-CNTs mixed dispersion, which was then dropped onto the surface of the base electrode and incubated for the first time to achieve stable modification of Ti3C2-CNTs on the surface of the base electrode. The above-modified Ti3C2-CNTs base electrode was electrodeposited in a solution containing gold source to obtain a working electrode with a surface-modified AuNP film. An aptamer solution was added to the surface of the working electrode and incubated a second time. Then, an antifouling peptide solution was added and incubated a third time. Finally, the electrode was blocked with a blocking solution to obtain a peptide / aptamer / Ti3C2-CNTs-Au electrochemical aptamer sensor.

[0011] In some embodiments of the present invention, the mass ratio of Ti3C2 to carbon nanotubes (CNTs) is 1:(5~10).

[0012] In some embodiments of the present invention, the gold source in the gold source solution is selected from one or more of tetrachloroauric acid, gold chloride and gold citrate; the concentration of the gold source solution is 6~10 mM; first incubation: overnight at room temperature.

[0013] In some embodiments of the present invention, the electrodeposition parameters are: voltage of -0.2 V, deposition duration of 600~1000 s; the peptide / aptamer / Ti3C2-CNTs-Au electrochemical aptamer sensor is the working electrode, the Ag / AgCl electrode is the reference electrode, and the platinum electrode is the counter electrode.

[0014] In some embodiments of the present invention, the concentration of the aptamer solution is 5.0~10 μM, and the second or third incubation is carried out at 1~4°C for 12~24 hours.

[0015] In some embodiments of the present invention, the concentration of the antifouling peptide solution is 2.0~5 μM; the blocking solution comprises a 1.0~5 mM solution of 6-mercaptohexanol (MCH).

[0016] A third objective of this invention is to provide the application of the aforementioned peptide / aptamer / Ti3C2-CNTs-Au electrochemical aptamer sensor in the detection of TCs.

[0017] In some embodiments of the present invention, the TCs include one or more of tetracycline (TC), chlortetracycline (CTC), doxycycline (DOX), and oxytetracycline (OTC).

[0018] In this invention, the sensor uses an aptamer with specific recognition capabilities and an antifouling peptide with anti-fouling properties as its core recognition elements. It is prepared by modifying the peptide / aptamer onto the surface of a sensing interface working electrode supported on a Ti3C2-CNTs-Au nanocomposite material using a self-assembly technique. The Ti3C2-CNTs-Au nanocomposite material significantly accelerates electron transfer kinetics and amplifies electrochemical signals, laying the foundation for the sensor's high-sensitivity detection. This invention successfully achieves high-sensitivity and high-selectivity analysis and detection of TCs by modifying the working electrode surface with Ti3C2-CNTs-Au nanocomposite material and then utilizing Au-S bonds to achieve stable self-assembly of the peptide / aptamer on the modified electrode surface. The sensor has a detection range of 0.01 nM-100 nM, a detection limit as low as 2 pM, and the entire detection process can be completed within 20 minutes, demonstrating rapid detection advantages. Furthermore, this sensor exhibits strong anti-interference capability against high concentrations of endogenous interfering substances (interference coefficient <12.34%), while also demonstrating excellent selectivity in systems where interfering substances and TCs coexist. Compared with existing technologies, the sensor constructed in this invention has outstanding advantages such as broad-spectrum recognition, high sensitivity, and excellent selectivity, and has been successfully applied to the actual detection of TCs in human serum samples. This technology provides strong technical support for drug hazard management and personalized risk assessment of therapeutic drug monitoring (TDM) in clinical settings, and has significant clinical application value.

[0019] The technical solution of the present invention has the following advantages compared with the prior art: This invention innovatively combines an ultra-high sensitivity Ti3C2-CNTs-Au electrochemical sensing interface material with an aptamer that can specifically recognize TCs and an antifouling peptide with antifouling properties, and for the first time successfully prepares a peptide / aptamer / Ti3C2-CNTs-Au electrochemical aptamer sensor, which is then applied to the detection and recognition of TCs in human serum samples.

[0020] (1) Compared with traditional detection methods such as HPLC and ELISA, the peptide / aptamer / Ti3C2-CNTs-Au electrochemical aptamer sensor constructed in this invention has the characteristics of simple operation, fast response and low cost, and can achieve high sensitivity, high selectivity and broad spectrum detection of TCs in a single detection.

[0021] (2) Compared with existing biosensors, the present invention uses Ti3C2-CNTs-Au nanocomposite material as the sensing interface: the two-dimensional Ti3C2 can provide an ultra-large electrochemical active surface area, the embedding of carbon nanotubes (CNTs) and the in-situ deposition of gold nanoparticles (AuNPs) can significantly improve the conductivity and electrocatalytic activity of the interface, realize the efficient amplification of the detection signal, and thus greatly improve the sensitivity of the analytical method.

[0022] (3) By reasonably truncating the aptamer, the present invention obtains an aptamer sequence that can recognize TCs in a broad spectrum; at the same time, by constructing a peptide / aptamer complex interface, it simultaneously achieves high selectivity recognition of the target and optimization of the anti-fouling performance of the sensing interface, effectively improving the selectivity and broad spectrum recognition capability of the analytical method.

[0023] (4) This invention employs electrochemical analysis technology to successfully achieve accurate detection of TCs in blood, and can sensitively monitor the concentration of TCs in the serum of patients undergoing therapeutic drug monitoring (TDM). The instruments used in this method are inexpensive, have a rapid detection response, and possess both ultra-high sensitivity and selectivity, thus showing promising prospects for clinical application. Attached Figure Description

[0024] To make the content of this invention easier to understand, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings, wherein... Figure 1 Linearity graph of TCs detection by the peptide / aptamer / Ti3C2-CNTs-Au electrochemical aptamer sensor prepared in Example 1 of this invention.

[0025] Figure 2 Selective detection of TCs by the peptide / aptamer / Ti3C2-CNTs-Au electrochemical aptamer sensor prepared in Example 1 of this invention. Detailed Implementation

[0026] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.

[0027] This embodiment provides the construction of a peptide / aptamer / Ti3C2-CNTs-Au electrochemical aptamer sensor for the high-sensitivity and high-selectivity broad-spectrum detection of TCs: The peptide / aptamer / Ti3C2-CNTs-Au electrochemical aptamer sensor described in this embodiment was constructed using a glassy carbon electrode as a substrate. First, Ti3C2-CNTs were modified using an electrostatic adsorption method. Then, a dense and uniform AuNPs film was formed on the electrode surface via electrodeposition. Subsequently, the peptide / aptamer was immobilized on the modified electrode surface through Au-S bond-mediated self-assembly, thus obtaining the peptide / aptamer / Ti3C2-CNTs-Au electrochemical aptamer sensor. The specific preparation process is as follows: (1) Pretreatment of glassy carbon electrode: The glassy carbon electrode is mechanically polished step by step with sandpaper of different grit until the electrode surface presents a uniform and smooth mirror state; then the polished electrode is placed in deionized water, anhydrous ethanol and deionized water respectively, and ultrasonically cleaned for 5 minutes in sequence to remove the polishing debris and impurities remaining on the surface.

[0028] (2) Synthesis and modification of sensing interface material Ti3C2-CNTs: 1 mg Ti3C2 and 5 mg multi-walled carbon nanotubes (MWCNTs) were added to 1 mL of ultrapure water and ultrasonically treated for 100 minutes to prepare a mixed dispersion of Ti3C2-CNTs; then 10 μL of the mixed dispersion was dropped onto the surface of the glassy carbon electrode and incubated overnight at room temperature to achieve stable modification of Ti3C2-CNTs on the surface of the glassy carbon electrode by means of electrostatic adsorption.

[0029] (3) Electrodeposition of gold nanoparticles: The working electrode of modified Ti3C2-CNTs was immersed in the electrodeposition solution (the electrodeposition solution is a 6 mM tetrachloroauric acid (HAuCl4) solution containing 0.1 M KNO3); at room temperature (25℃), a three-electrode system (glassy carbon electrode as working electrode, Ag / AgCl electrode as reference electrode, and platinum electrode as counter electrode) was used to perform electrodeposition by chronoamperometry (it curve method), the deposition potential was set to -0.2 V, and the deposition duration was 600 s.

[0030] (4) Self-assembly of peptide / aptamer at the electrode interface based on Au-S bond: After drying the Ti3C2-CNTs-Au modified electrode with nitrogen, 10 μL of TCs aptamer solution (TCGTCGACGGATCCATGGCACATGGATTACTAGCGAACGCATGAGCCGGCTGCGGCGCATGCGT) was added to the electrode surface and incubated at 4℃ for 12 hours. The aptamer self-assembly was achieved through Au-S bond (sulfur originates from cysteine ​​C in the antifouling peptide). The electrode surface was then rinsed with ultrapure water to remove the physically adsorbed aptamer. 10 μL of antifouling peptide solution with 2.0 μM was added and incubated at 4℃ for another 12 hours. The antifouling peptide self-assembly was completed through Au-S bond. Finally, 10 μL of a 1.0 mM 6-mercaptohexanol (MCH) solution was dropped onto the surface of the peptide / aptamer / Ti3C2-CNTs-Au modified electrode and incubated for 20 minutes to block residual active sites on the gold nanoparticle surface and inhibit non-specific adsorption. Through the above steps, the peptide / aptamer / Ti3C2-CNTs-Au electrochemical aptamer sensor was finally prepared. The amino acid sequence of the antifouling peptide used is: CKEKEKEKE.

[0031] Example 2 This embodiment provides a method for detecting TCs using a peptide / aptamer / Ti3C2-CNTs-Au electrochemical sensor, as detailed below: The peptide / aptamer / Ti3C2-CNTs-Au electrochemical sensor prepared in Example 1 was used as the working electrode, the Ag / AgCl electrode as the reference electrode, and the platinum electrode as the counter electrode, with a substrate containing 5.0 mM [Fe(CN)6]. 3- / 4- 0.1 M PBS buffer was used as the electrolyte. A series of TCs (including TC, DOX, CTC, and OTC at the same concentration) standard solutions of different concentrations (0.01 / 0.05 / 0.1 / 3 / 5 / 7 / 10 / 20 / 30 / 50 / 70 / 100 / 300 nM) were prepared. The sensors were sequentially immersed in these TCs standard solutions and incubated at room temperature for 20 minutes. The electrode surface was then rinsed with ultrapure water and dried with nitrogen. Differential pulse voltammetry (DPV) was used to measure the current signal of the sensors binding to different concentrations of TCs, with a pulse amplitude of 0.05 V and a pulse width of 0.1 s. Finally, a detection curve was established based on the linear relationship between the peak current I and the TCs concentration. The linear range was 0.01 nM–100 nM, and the detection limit was as low as 2 pM. Figure 1 As shown.

[0032] Example 3 This embodiment provides a method for detecting interference in the detection of TCs using a peptide / aptamer / Ti3C2-CNTs-Au electrochemical sensor, as detailed below: The peptide / aptamer / Ti3C2-CNTs-Au electrochemical sensor was immersed in three solutions (TCs standard solution, a mixture of interfering substances at 100 times the concentration of the TCs standard solution, and a mixture of interfering substances and TCs at 100 times the concentration of the TCs standard solution), respectively. After incubation at room temperature for 20 minutes, the electrode surface was rinsed with ultrapure water and dried with nitrogen. Under the same test conditions as in Example 2, the current signal of the sensor before and after identifying the target / interfering substance was measured, and the selectivity of TCs was verified by comparative analysis. The interfering substances included sodium chloride (NaCl), potassium chloride (KCl), fructose, lysine (L-lysine), bovine serum albumin (BSA), and metformin. The results showed that when the concentration of the interfering substances was 100 times that of the TCs standard solution, the interference rate of each interfering substance on the TCs recognition current was less than 12.34%. Furthermore, in the system where the target analyte is present, the sensor's current change is highly consistent with the response when TCs are incubated alone, fully demonstrating the sensor's excellent anti-interference capability. These characteristics are attributed to the high affinity and specific recognition ability of the TCs aptamer for the target analyte, enabling broad-spectrum recognition of TCs even in complex systems with coexisting substances. This demonstrates that the prepared peptide / aptamer / Ti3C2-CNTs-Au electrochemical aptamer sensor exhibits excellent selectivity in TCs detection. Figure 2 As shown.

[0033] Example 4 This embodiment provides a method for detecting TCs in a real-world scenario using a peptide / aptamer / Ti3C2-CNTs-Au electrochemical sensor, as detailed below: First, blood samples were pretreated to remove proteins and other macromolecules that might interfere with the electrochemical signal. Then, a known concentration of TCs standards was added to the pretreated serum sample. The peptide / aptamer / Ti3C2-CNTs-Au electrochemical sensor was immersed in this standard-doped serum solution and soaked at room temperature for 20 minutes. After removal, the electrode surface was rinsed with ultrapure water and dried under nitrogen. The sensor was then used with 5.0 mM [Fe(CN)6]. 3- / 4- Using 0.1 M PBS buffer as the electrolyte, current signals were measured under the same test conditions as in Example 2. The recovery rate of TCs in serum samples was calculated using the standard addition method, ultimately achieving accurate detection of TCs in actual serum samples. The results showed that the sensor recovery rate was between 99.3% and 103.3%, with a relative standard deviation (RSD) of less than 3.86% (n=3), which was satisfactory. It is evident that the constructed peptide / aptamer / Ti3C2-CNTs-Au electrochemical aptamer sensor exhibits excellent anti-interference ability and accuracy, as shown in Table 1.

[0034] Table 1 Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. A peptide / aptamer / Ti3C2-CNTs-Au electrochemical aptamer sensor, characterized in that, It includes a base electrode, and Ti3C2-CNTs and AuNP films sequentially modified on the surface of the base electrode, as well as TCs aptamers and antifouling peptides loaded sequentially through Au-S bonds; The Ti3C2-CNTs include carbon nanotubes (CNTs) and Ti3C2 nanosheets embedded in the carbon nanotubes (CNTs).

2. The peptide / aptamer / Ti3C2-CNTs-Au electrochemical aptamer sensor according to claim 1, characterized in that, The base sequence of the TCs aptamer is shown in SEQ ID NO.1; The amino acid sequence of the antifouling peptide is shown in SEQ ID NO.2; The base electrode includes a glassy carbon electrode.

3. A method for preparing a peptide / aptamer / Ti3C2-CNTs-Au electrochemical aptamer sensor as described in claim 1 or 2, characterized in that, Includes the following steps: Provide a basic electrode; Ti3C2 and carbon nanotubes (CNTs) were ultrasonically dispersed in water to obtain a Ti3C2-CNTs mixed dispersion, which was then dropped onto the surface of the base electrode and incubated for the first time to achieve stable modification of Ti3C2-CNTs on the surface of the base electrode. The above-modified Ti3C2-CNTs base electrode was electrodeposited in a solution containing gold source to obtain a working electrode with a surface-modified AuNP film. An aptamer solution was added to the surface of the working electrode and incubated a second time. Then, an antifouling peptide solution was added and incubated a third time. Finally, the electrode was blocked with a blocking solution to obtain a peptide / aptamer / Ti3C2-CNTs-Au electrochemical aptamer sensor.

4. The preparation method according to claim 3, characterized in that, The mass ratio of Ti3C2 to carbon nanotubes (CNTs) is 1:(5~10).

5. The preparation method according to claim 3, characterized in that, The gold source in the gold source solution is selected from one or more of tetrachloroauric acid, gold chloride, and gold citrate; the concentration of the gold source solution is 6~10 mM.

6. The preparation method according to claim 3, characterized in that, Electrodeposition parameters: voltage -0.2 V, deposition duration 600~1000 s; the peptide / aptamer / Ti3C2-CNTs-Au electrochemical aptamer sensor is the working electrode, the Ag / AgCl electrode is the reference electrode, and the platinum electrode is the counter electrode.

7. The preparation method according to claim 3, characterized in that, The concentration of the aptamer solution is 5.0~10 μM, and the second or third incubation is carried out at 1~4℃ for 12~24 hours.

8. The preparation method according to claim 3, characterized in that, The concentration of the antifouling peptide solution is 2.0~5 μM; the blocking solution includes a 6-mercaptohexanol solution with a concentration of 1.0~5 mM.

9. The application of the peptide / aptamer / Ti3C2-CNTs-Au electrochemical aptamer sensor according to claim 1 or 2 in the detection of TCs.

10. The application according to claim 9, characterized in that, The TCs include one or more of tetracycline, chlortetracycline, doxycycline, and oxytetracycline.

Images