Methods of making circular RNA
By utilizing TERIC technology, the interaction between modified ribozymes and bridging sequences is leveraged to achieve efficient circularization of long/modified RNA, solving the problem of low circularization efficiency in existing technologies, and the ribozymes can be reused.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- UNITED KINGDOM RESEARCH AND INNOVATION
- Filing Date
- 2024-08-29
- Publication Date
- 2026-06-09
AI Technical Summary
Existing technologies struggle to efficiently circularize long/modified RNA, especially since base modifications in the PIE method can disrupt the structure of ribozymes, leading to low circularization efficiency.
The TERIC (Trans-Cut Ribozyme-Based Circulation) technique is employed to restore the tertiary structure of a ribozyme by providing a modified ribozyme and a nucleic acid molecule containing a bridging sequence, and by utilizing the interaction between the truncated ribozyme and the target gene.
This method achieves efficient cyclization of target genes containing modified nucleotides, and the ribozyme can be reused, solving the problem of low cyclization efficiency in existing methods.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
[0001] This application claims priority to GB2313326.7, filed on September 1, 2023, the entire contents and elements of which are incorporated herein by reference for all purposes. Technical Field
[0002] This invention relates to a method for preparing circular RNA. The invention also relates to modified ribozymes for preparing circular RNA, nucleic acid molecules for preparing circular RNA, and kits for preparing circular RNA. Background Technology
[0003] Ribosomes are molecular machines that translate the genetic code carried by messenger RNA (mRNA) into functional proteins. When exogenous mRNA is introduced into cells, the target gene (GOI) encoded by that mRNA can be expressed, laying the foundation for mRNA therapy. However, despite its promising prospects in animals since the 1990s, challenges such as mRNA instability, high innate immunogenicity, and low in vivo delivery efficiency remain (Pardi, N. et al., 2018). Nat Rev Drug Discov (17, 261-279) mRNA therapy has not received substantial investment. In recent years, breakthroughs in mRNA delivery and nucleotide modification technologies have enabled the successful application of mRNA therapy, particularly in the vaccine field. However, other types of mRNA therapy, such as protein replacement therapy, still face numerous challenges due to the instability of mRNA.
[0004] In therapeutic applications, circular RNA (circRNA) has emerged as a promising solution to the problem of mRNA instability. Due to its covalently closed structure, circRNA is naturally resistant to exonucleases, making it more stable than linear mRNA (Jeck, WR and Sharpless, NE, (2014)). Nat Biotechnol Circular RNAs are widely distributed in human cells and can serve as microRNAs and protein sponges, as well as templates for peptide or protein synthesis (Liu, CX and Chen, LL, (2022)). Cell , 185, 2016-2034. Although circular RNA is mainly produced by intracellular backsplicing, it can also be synthesized in vitro using chemical or enzymatic ligation methods or by cyclization methods based on type I introns (Petkovic, S. and Muller, S., (2015)). Nucleic Acids Res , 43, 2454-2465). Among these methods, the intron-exon substitution method (PIE) and the trans-ribozyme-based cyclization method (TRIC) are highly efficient in cyclizing long RNAs. Figure 1(AC) (Puttaraju, M. and Been, MD, (1992) Nucleic Acids Res 20, 5357-5364; Wesselhoeft, RA, Kowalski, PS, and Anderson, DG, (2018) Nat Commun 9, 2629). However, a limitation of the PIE method is that it cannot circularize modified circular RNA (Wesselhoeft, RA et al., (2019)). Mol Cell 74, 508-520, e504). This limitation is due to the possibility that base modifications in the PIE construct may disrupt the structure of the ribozyme. Although previous studies have shown that circular RNAs are less immunogenic than unmodified linear mRNAs, base modifications may still be beneficial given the inevitability of cleavage in circular RNAs.
[0005] Therefore, there is still a need in the field for improved methods to efficiently circularize RNA, especially long / modified RNA. Summary of the Invention
[0006] In a first aspect, the present invention provides a method for producing a circular target gene, the method comprising: a) Provide a nucleic acid molecule, wherein the nucleic acid molecule includes a first bridging sequence and a target gene in the 5' to 3' direction, wherein the first bridging sequence includes a sequence corresponding to the 3' portion of the ribozyme; b) Provide a modified ribozyme comprising a truncated ribozyme, wherein the truncated ribozyme does not contain the 3' portion of the corresponding wild-type ribozyme; and c) Combining the nucleic acid molecule and the modified ribozyme under conditions suitable for cyclization.
[0007] In a second aspect, the present invention provides a circular RNA obtained by the method described herein.
[0008] In a third aspect, the present invention provides a modified ribozyme used in a method for circularizing RNA molecules, wherein the modified ribozyme comprises, from the 5' to 3' direction: a) First Extended Guide Sequence (EGS); b) First circular sequence; and c) A truncated ribozyme, wherein the truncated ribozyme does not contain the 3' portion of the corresponding wild-type ribozyme.
[0009] In a fourth aspect, the present invention provides a nucleic acid molecule comprising a target gene, wherein the nucleic acid molecule is used in a method for circularizing the target gene, and wherein the nucleic acid molecule comprises, from the 5' to the 3' direction: a) A bridging sequence comprising a sequence corresponding to the 3' portion of a ribozyme sequence; b) The target gene; c) Circular sequence; good d) Extend the wizard sequence.
[0010] In a fifth aspect, the present invention provides a kit for circularizing a target gene, the kit comprising a modified ribozyme and a nucleic acid molecule containing the target gene. The modified ribozyme comprises a truncated ribozyme that does not contain the 3' portion of the corresponding wild-type ribozyme, and The nucleic acid molecule containing the target gene comprises, from the 5' to the 3' direction: a) A bridging sequence comprising the 3' portion of the ribozyme; and b) The target gene.
[0011] The modified ribozyme may be the modified ribozyme described in the third aspect. The nucleic acid molecule may be the nucleic acid molecule described in the fourth aspect.
[0012] In a sixth aspect, the present invention provides a DNA molecule encoding a modified ribozyme as defined herein.
[0013] In a seventh aspect, the present invention provides a DNA molecule encoding a nucleic acid molecule containing a target gene as defined herein.
[0014] In an eighth aspect, the present invention provides a kit for circulating a target gene, the kit comprising the DNA molecules described in the sixth aspect and the DNA molecules described in the seventh aspect. Brief description of the attached diagram Figure 1 Comparison of existing techniques and the TERIC-based trans-ribozyme cyclization method. (A) Schematic diagram showing splicing using type I introns from cyanobacterium (Ana) to produce a linear molecule containing linked exons. (B) Schematic diagram showing cyclization of the target gene using the substitutional intron-exon (PIE) method. (C) Schematic diagram showing cyclization of the target gene using the TRIC method. (D) Schematic diagram showing splicing using trans-ribozyme (TER). (E) Schematic diagram showing cyclization of the target gene using the TERIC method.
[0016] Figure 2(A) Secondary structure of Ana type I introns. Lowercase letters indicate exon sequences. TER V1 and TER V2 markers indicate the cleavage sites of the 3' portion of the intron. (B) Design details of the trans-cleavage ribozyme (TER) and the corresponding GOI precursor (pG) using the tRNALeuI type intron from cyanobacterium Anabaena (Ana) as an example.
[0017] Figure 3 (A) Splicing products of TERIC V1 and V2 were loaded onto 0.8% natural agarose gels. TRICV2-CVB3-EGFP was used as a positive control. (B) Circulated samples of pG, TER, and TERIC V2 were loaded onto 1.5% agarose gels containing 6M urea. Circulated CVB3-EGFP was present in the TERIC circularized samples. (C) RT-PCR analysis was performed on the circularized samples of pG and TERIC V2. Primers used here are as follows: Figure 2 As shown in B. (DE) TERIC V1 (SEQ ID NO: 5 and 6) and V2 (SEQ ID NO: 7 and 8) sequences of TER and pG.
[0018] Figure 4 The optimization of (A) the TER to pG ratio, (B) the pG concentration, and (C) the cyclization reaction time was investigated. A 0.8% natural agarose gel was used. In cases (B) and (C), TER ran out of the gel. Although both TERIC V1 and V2 achieved cyclization, TERIC V2 generally showed better cyclization efficiency than TERIC V1. The most efficient cyclization scheme for TERIC V2 was: a TER to pG ratio of 4:1 in the presence of 2 mM GTP, a pG concentration of 200-400 nM, and a cyclization reaction time of 20-40 minutes.
[0019] Figure 5 (A) The circularization efficiency of pGs containing the eACA element or the native tRNA sequence was compared. The results showed that eACA is essential for TERIC to function. (B) The sequence of TERIC-pG-tRNA (SEQ ID NO: 9).
[0020] Figure 6(A) Circulation reactions were performed using modified and unmodified PIE, TRIC, and TERIC precursors, and the samples were loaded onto 0.8% native agarose gels. No modified circular RNA was observed in any of the three constructs. (B) The IGS of TRIC and TERIC was mutated from UUGAG to CCGCC, with circZnf609 selected as the target sequence. The appearance of circular modified RNA after the IGS mutation to CCGCC indicates that TERIC has restored ribozyme activity. (C) The sequences of TER (1,226)-IGS CCGCC (SEQ ID NO:10) and pG_circZnf609 (SEQ ID NO:11).
[0021] Figure 7 A schematic overview of the TERIC method.
[0022] Figure 8 Extended anticodon arm (eACA). A circularization site can be assembled as long as a stem-loop structure is found, where the third position of the loop is uracil, and the stem region length is ≥5 bp. Therefore, the circularization site can be located in the UTR or CDS.
[0023] Figure 9 pG was cyclized using a TER with a 3' truncated end or a TER with both the 5' and 3' ends truncated. The 3' bridging sequence in the pG was either identical to the truncated portion of the ribozyme or contained a mutation. The cyclization reaction was carried out at a TER / pG ratio of 4:1 at 55°C for 20 minutes, followed by analysis on a 0.8% natural agarose gel.
[0024] Detailed Explanation This invention provides a novel method for circularizing a target gene to produce circular RNA. The invention is based at least in part on the discovery that a portion of a ribozyme sequence can be repositioned onto a target gene, thereby enabling the ribozyme to interact with the target gene and promote trans-splicing. This results in the circularization of the target gene, while the ribozyme itself can be reused. This invention can circularize target genes containing modified nucleotides.
[0025] As will be described in more detail below, this invention relies on the use of a "bridging sequence" and a corresponding truncated ribozyme. For example, a truncated ribozyme lacking its 3' sequence portion can be designed. A bridging sequence corresponding to the missing portion of this ribozyme can then be designed. When this bridging sequence is added to the target gene, it enables the truncated ribozyme to interact with the target gene and restore its tertiary structure, thereby achieving splicing and circularization of the target gene.
[0026] The inventors named this method cyclization technology based on trans-cleavage ribozymes, or TERIC.
[0027] This new system enables cyclization by providing a ribozyme and the target gene as independent constructs. It offers several advantages: it can cyclize genes containing modified nucleotides, a feat difficult to achieve with existing methods in the field, such as intron-exon substitution (PIE). Another advantage is the reusability of the ribozyme, which is also impossible with methods like PIE.
[0028] Abbreviation Table ACA – Anti-codon Arm CDS – Encoded Sequence EGS – Extended Wizard Sequence eIGS – Extended Internal Wizard Sequence eACA – Extended Anticodon Arm GOI – Target Gene IGS – Internal Wizard Sequence IVT – In vitro transcription pG – Pre-gene of target gene PIE – Substitutional Intron-Exon RNA – Ribonucleic Acid TERIC – Cycloning technology based on trans-ribozyme cleavage TRIC – A cyclization technology based on transribozymes TER – Trans-cutting Ribozyme tRNA – transfer RNA UTR – Untranslated Area The following provides specific definitions for the terms, techniques, and embodiments used herein.
[0029] Generally, this document describes a method for producing a circular target gene. The method includes providing a nucleic acid molecule comprising a bridging sequence and a target gene, and a modified ribozyme. The bridging sequence comprises a sequence corresponding to the 3' portion of the ribozyme. The modified ribozyme comprises a truncated ribozyme, wherein the truncated ribozyme does not contain the 3' portion of the corresponding wild-type ribozyme. The method further includes combining the nucleic acid molecule and the modified ribozyme under conditions suitable for circulization to produce a circular target gene.
[0030] Ribozyme Ribozymes, such as type I introns, can fold to form tertiary structures composed of paired fragments (called P1-P10) (e.g., Figure 2 (As shown in A). The method of this invention utilizes these self-interactions by repositioning a portion of the ribozyme sequence onto the target gene. Truncated ribozymes, which may lack the 3' portion of their sequence, or both the 3' and 5' portions, can interact with the repositioned portion of the ribozyme sequence on the target gene (i.e., the bridging sequence), thereby restoring its tertiary structure.
[0031] Therefore, this paper discloses modified ribozymes, which typically contain truncated ribozymes. A truncated ribozyme generally refers to a ribozyme whose 3' portion of the corresponding wild-type ribozyme sequence has been removed. A truncated ribozyme can also refer to a ribozyme whose 3' and 5' portions of the corresponding wild-type ribozyme sequence have both been removed.
[0032] The ribozyme can be any ribozyme capable of acting as a trans-cleaving ribozyme. In some cases, the ribozyme is derived from or from type I introns. A suitable example of a ribozyme is Tetrahymena ( Tetrahymena ) ribonucleoside introns, T4 phage thymidylate synthase introns, cyanobacteria ( Anabaena The sequences of these ribozymes are shown below, including the Ana tRNA pre-intron, the Azoarcus sp. BH72 Ile tRNA intron, and the Staphylococcus bacteriophage Twort ribonucleotide reductase intron. The internal guide sequences (IGS) are indicated by underlined shaded letters.
[0033] Ana type I introns: AATAA TTGAG CCTTAGAGAAGAAATTCTTTAAGTGGATGCTCTCAAACTCAGGGAAACCTAAATCTAGCTATAGACAAGGCAATCCTGAGCCAAGCCGAAGTAGTAATTAGTAAGTTAACAGATAACTTACAGCTAATCGGAAGGTGCAGAGACTCGACGGGAGCTACCCTAACGTCAAGACGAGGGTAAAGAGAGAGTCCAATTCTCAAAGCCAATAGGCAGTAGCGAAAGCTGCGGGAGAAATG (SEQ ID NO: 49).
[0034] T4 phage type I introns: AATTG AGGCCTGA
[0035] Tetrahymena ( Tetrahymena Ribosome introns: AAATAGCAATATT TACCTTTGGAGGG AAAAGTTATCAGGCATGCACCTGGTAGCTAGTCTTTAAAACCAATAGATTGCATCGGTTTAAAAGGCAAGACCGTCAAATTGCGGGAAAGGGGTCAACAGCCGTTCAGTACCAAGTCTCAGGGGAAACTTTGAGATGGCCTTGCAAAGGGTATGGTAATAAGCTGACGGACATGGTCCTAACCACGCAGCCAAG TCCTAAGTCAACAGATCTTCTGTTGATATGGATGCAGTTCACAGACTAAATGTCGGTCGGGGAAGATGTATTCTTCTCATAAGATATAGTCGGACCTCTCCTTAATGGGAGCTAGCGGATGAAGTGATGCAACACTGGAGCCGCTGGGAACTAATTTGTATGCGAAAGTATATTGATTAGTTTTGGAGTACTCG (SEQ ID NO: 3).
[0036] Azoarcus sp. BH72 Ile tRNA introns: ATTTCG ATGTG CCTTGCGCCGGGAAACCACGCAAGGGATGGTGTCAAATTCGGCGAAACCTAAGCGCCCGCCCGGGCGTATGGCAACGCCGAGCCAAGCTTCGGCGCCTGCGCCGATGAAGGTGTAGAGACTAGACGGCACCCACCTAAGGCAAACGCTATGGTGAAGGCATAGTCCAGGGAGTGGCGAAAGTCACACAAACCGG (SEQ ID NO: 4).
[0037] Staphylococcus bacteriophage Twort ribonucleotide reductase introns: AAACAA TTCTGCCCCCTATATTAGTAATAGTGTAGGTTAAAAAAACTTCCTTAATTCATGGGAAATCTCCCTGACTTTTATTATAAATTTTGGTATAGTAAAATGAGAAGGAGATAATCATGAGCAAGATAACCAATAGCAAAGAAACCCAAAAAGTACCTAACGCTACTAAAAGTATTTACCACCATATAAAAAGTAAAAGAAGGATGGAAGTCATTAAAT CACTTAATGAATTGGTAATTATCTTGTGCAACGACTAGAGAAAAGATAGTTTATTGTTACAGGCAGTAAATGAAGACTGAGTATCGTACACACAAGTGAGTGGAAACAGGAAGTATCCTAGAGTAACGACTAGGATAATGATATAGTCTGAACATTGTAGGTGACTACAAGAAGGTAAGGAGTAACGAACCTTATCGTAACATAATTG (SEQ ID NO: 51).
[0038] To enable ribozymes to function in a trans-regulatory manner (i.e., acting on individual RNA molecules), the 3' portion of the ribozyme is typically removed, and the corresponding sequence is introduced into the 5' end of the target gene. This provides a truncated ribozyme. Truncated ribozymes typically do not contain the 3' portion of the corresponding wild-type ribozyme. For example, in the Ana I intron described above, the 3' portion corresponding to nucleotide positions 227-249 can be removed. This 3' portion can also be shorter, for example, corresponding to nucleotide positions 242-249.
[0039] The term "3' portion" typically refers to the 3' terminal portion, effectively truncating the remaining ribozyme at the 3' end. The length of the removed 3' portion is usually between 1 and 1500 nucleotides. Truncated ribozymes may not contain the 3' portion of the corresponding wild-type ribozyme with the following lengths: 1 to 1250, 1 to 1000, 1 to 750, 1 to 500, 1 to 400, 1 to 300, 1 to 250, 1 to 200, 1 to 150, 1 to 100, 1 to 50, 5 to 1500, 5 to 1250, 5 to 1000, 5 to 750, 5 to 500, 5 to 4... 0, 5 to 300, 5 to 250, 5 to 200, 5 to 150, 5 to 100, 5 to 50, 10 to 1500, 10 to 1250, 10 to 1000, 10 to 750, 10 to 500, 10 to 400, 10 to 300, 10 to 250, 10 to 200, 10 to 150, 10 to 100, 10 to 50, or 10 to 30 nucleotides. In some cases, the truncated ribozyme does not contain the 3' portion of the corresponding wild-type ribozyme with a length between 1 and 30 nucleotides. For example, the missing or removed 3' portion may be 23 nucleotides long. The removed 3' portion may be 8 nucleotides long. For Ana I introns, the truncated ribozyme may not contain a 3' portion with a length between 1 and 249 nucleotides. This 3' portion may be referred to as the portion "removed" from the ribozyme. However, it should be understood that the method does not necessarily include a step of removing the portion (or 5' portion) from the ribozyme, as the ribozyme can be reused and thus can be provided in a truncated form.
[0040] The missing 3' portion of a truncated ribozyme is typically the part of the sequence that participates in the formation of the paired fragment in the wild-type ribozyme. For example, this 3' portion could be a sequence that forms or participates in the formation of the P9 region in the wild-type ribozyme.
[0041] When the ribozyme is an Ana I intron ribozyme, it may contain nucleotides 1-226 of SEQ ID NO: 1 or SEQ ID NO: 49 or a variant thereof. The ribozyme may contain the nucleotide sequence of SEQ ID NO: 12 or a variant thereof. The ribozyme may contain nucleotides 1-241 of SEQ ID NO: 1 or SEQ ID NO: 49 or a variant thereof. The ribozyme may contain the nucleotide sequence of SEQ ID NO: 13 or a variant thereof.
[0042] The truncated ribozymes described herein may also exclude the 5' portion of the corresponding wild-type ribozyme. The "5' portion" typically refers to the 5' terminal portion, such that the remaining ribozyme is substantially truncated at the 5' end. The length of the removed 5' portion is typically between 1 and 1500 nucleotides. Truncated ribozymes may exclude the 5' portion of the corresponding wild-type ribozyme with lengths ranging from: 1 to 1250, 1 to 1000, 1 to 750, 1 to 500, 1 to 400, 1 to 300, 1 to 250, 1 to 200, 1 to 150, 1 to 100, 1 to 50, 5 to 1500, 5 to 1250, 5 to 1000, 5 to 750, 5 to 500, 5 to 4... 00, 5 to 300, 5 to 250, 5 to 200, 5 to 150, 5 to 100, 5 to 50, 10 to 1500, 10 to 1250, 10 to 1000, 10 to 750, 10 to 500, 10 to 400, 10 to 300, 10 to 250, 10 to 200, 10 to 150, 10 to 100, 10 to 50, or 10 to 30 nucleotides. In some cases, truncated ribozymes do not contain the 5' portion of the corresponding wild-type ribozyme with a length between 1 and 30 nucleotides. Similar to the 3' portion, this 5' portion may be referred to as the portion "removed" from the ribozyme. However, it should be understood that the method does not necessarily include the step of removing this portion from the ribozyme, as the ribozyme can be reused and thus can be provided in a truncated form.
[0043] The missing 5' portion of a truncated ribozyme is typically the part that forms the internal guide sequence (IGS). In wild-type ribozymes, the IGS forms the P1 and P10 regions through base complementarity pairing. Figure 2 As shown in A. By repositioning this 5' portion (in the form of a bridging sequence) onto the target gene, the truncated ribozyme can interact with the target gene.
[0044] It should be understood that the ribozymes used in the methods described herein should generally match the ribozyme from which the bridging sequence on the target gene originates. For example, when using Ana I introns, the bridging sequence added to the target gene should also originate from Ana I introns; however, this is not absolutely necessary as long as the bridging sequence can interact with the truncated ribozyme. Similarly, the nucleotide sequence of the bridging sequence does not need to match the nucleotide sequence of the ribozyme portion missing in the truncated ribozyme. Likewise, sequence differences between the two are acceptable as long as the bridging sequence can interact with the truncated ribozyme. For example, the sequence in the first bridging sequence corresponding to the 3' portion of the ribozyme may differ from the 3' portion sequence of the corresponding wild-type ribozyme that is missing or absent in the truncated ribozyme. The sequence of the first bridging sequence may differ from the 3' portion missing in the corresponding wild-type ribozyme due to the insertion, addition, substitution, or deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotides. For example, the sequence of the first bridging sequence may contain a nucleotide sequence that has at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 98% sequence identity with the deleted 3' portion.
[0045] Sequence alignment can be performed on the full length of the relevant sequences described in this paper using standard algorithms, such as GAP, BLAST (using Altschul et al., (1990)). J. Mol. Biol The methods in 215: 405-410), FASTA (using Pearson and Lipman (1988)). PNAS USA The methods in 85: 2444-2448), the Smith-Waterman algorithm (Smith and Waterman (1981)). J. Mol Biol. 147: 195-197), or the TBLASTN program in the aforementioned literature Altschul et al. (1990), usually using the default parameters.
[0046] In some cases, the length of the bridging sequence corresponds to the length of the 3' (or 5') portion removed from the ribozyme, but this is not mandatory. Differences in length between the deleted 3' (and 5') portion and the bridging sequence are permissible. For example, the deleted 3' (and 5') portion may be 1, 2, 3, 4, 5, 10, or more nucleotides longer or shorter than the bridging sequence.
[0047] Bridge sequence As described in this article, bridging sequences are typically added to a target gene to facilitate circularization.
[0048] The bridging sequence may contain a sequence corresponding to the 3' portion of the ribozyme (e.g., the 3' terminal portion of the ribozyme). This may be referred to as the 3' bridging sequence or the first bridging sequence. The bridging sequence may also contain a sequence corresponding to the 5' portion of the ribozyme (e.g., the 5' terminal portion of the ribozyme). This may be referred to as the 5' bridging sequence or the second bridging sequence.
[0049] For the first bridging sequence (corresponding to the 3' portion of the ribozyme), the bridging sequence is connected (directly or indirectly) to the 5' end of the target gene.
[0050] The length of the first bridging sequence may vary depending on the ribozyme from which it originates. The length of the first bridging sequence is typically at least two nucleotides. The first bridging sequence is typically shorter than the full length of any given intron. The length of the first bridging sequence can range from 2 to 1500 nucleotides. The length of the first bridging sequence can range from 2 to 1000, 2 to 750, 2 to 500, 2 to 450, 2 to 400, 2 to 350, 2 to 300, 2 to 250, 2 to 200, 2 to 150, 2 to 100, 2 to 50, or 2 to 30 nucleotides. The length of the first bridging sequence can range from 5 to 1500, 5 to 1000, 5 to 750, 5 to 500, 5 to 450, 5 to 400, 5 to 350, 5 to 300, 5 to 250, 5 to 200, 5 to 150, 5 to 100, or 5 to 50 nucleotides. In many cases, the length of the first bridging sequence can be between 5 and 30 nucleotides.
[0051] For example, when using Ana I introns, the length of the first bridging sequence can be between 2 and 248 nucleotides. Alternatively, the length of the first bridging sequence can be between 5 and 30 nucleotides. The length of the first bridging sequence can be 8 nucleotides. Or, the length of the first bridging sequence can be 23 nucleotides.
[0052] The function of the bridging sequence is to facilitate interaction with modified ribozymes as described herein. The first bridging sequence typically contains a portion capable of base-complementary pairing with the 3' portion of the ribozyme, for example, a portion of 1 to 10 nucleotides in length. The first bridging sequence may be capable of forming a pairing fragment with the modified ribozyme or the 3' portion of the ribozyme described herein. The first bridging sequence may be capable of forming a P9 region with the 3' portion of the ribozyme. The first bridging sequence may contain a portion capable of base-complementary pairing with nucleotides 207-212 of SEQ ID NO:1 or SEQ ID NO:49 or a variant thereof. It should be understood that the precise nucleotide sequence of the first bridging sequence is not critical to the present invention, provided that the nucleotide sequence of the first bridging sequence can interact with the modified ribozyme.
[0053] As described above, the sequence corresponding to the 3' portion of the ribozyme in the first bridging sequence may be the same as or different from the sequence of the corresponding wild-type ribozyme 3' portion that is missing or absent in the truncated ribozyme.
[0054] The first bridging sequence may comprise the sequence corresponding to nucleotides 207-212 of SEQ ID NO: 1 or SEQ ID NO: 49 or a variant thereof. The first bridging sequence may comprise the nucleotide sequence shown in SEQ ID NO: 14 or a variant thereof. The first bridging sequence may comprise the sequence corresponding to nucleotides 227-249 of SEQ ID NO: 1 or SEQ ID NO: 49 or a variant thereof. The first bridging sequence may comprise the nucleotide sequence shown in SEQ ID NO: 15 or a variant thereof.
[0055] For the second bridging sequence (corresponding to the 5' portion of the ribozyme), this bridging sequence is connected (directly or indirectly) to the 3' end of the target gene.
[0056] The length of the second bridging sequence may vary depending on the ribozyme from which it originates. The length of the second bridging sequence is typically at least two nucleotides. The length of the second bridging sequence is typically less than 1500 nucleotides. The length of the second bridging sequence can be between 2 and 1000, 2 and 750, 2 and 500, 2 and 450, 2 and 400, 2 and 350, 2 and 300, 2 and 250, 2 and 200, 2 and 150, 2 and 100, 2 and 50, or 2 and 30 nucleotides. The length of the second bridging sequence can be between 5 and 1500, 5 and 1000, 5 and 750, 5 and 500, 5 and 450, 5 and 400, 5 and 350, 5 and 300, 5 and 250, 5 and 200, 5 and 150, 5 and 100, or 5 and 50 nucleotides. In many cases, the length of the second bridging sequence can be between 5 and 30 nucleotides.
[0057] The second bridging sequence may include a portion that can perform base complementarity pairing with the 5' portion of the modified ribozyme.
[0058] Although bridging sequences are generally described herein as equivalent portions “corresponding” to ribozyme sequences, they need not be identical to those sequences. Any bridging sequence capable of interacting with a modified ribozyme to achieve circularization may be used. For example, a bridging sequence “corresponding” to a portion of the ribozyme sequence may have at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% sequence identity to the portion of the ribozyme sequence as defined herein.
[0059] The following explanation uses the Ana type I intron as an example of a modified ribozyme. The wild-type Ana ribozyme is modified by removing a 23-nucleotide 3' portion corresponding to residues 227-249 of SEQ ID NO: 1 or SEQ ID NO: 49 (wild-type Ana) or its variants. This modified ribozyme contains residues 1-226 of SEQ ID NO: 1 or SEQ ID NO: 49 or its variants. Subsequently, a corresponding first bridging sequence containing residues 227-249 of SEQ ID NO: 1 is added to the 5' end of the target gene. When the modified ribozyme is bound to the target gene under circularization conditions, the first bridging sequence can interact with the remaining portion of the ribozyme (i.e., perform base pairing), for example, forming... Figure 2 Region P9 is shown in Figure A. Simultaneously, the modified ribozyme's IGS can form P1 and P10 regions with the target gene. These interactions enable the modified ribozyme to splice and circularize the target gene.
[0060] Target gene This article provides nucleic acid molecules containing the target gene. The target gene (GOI) is the sequence to be circularized. GOIs can contain coding sequences that encode peptides or proteins, or they can be non-coding sequences. GOIs can also contain combinations of coding and non-coding sequences.
[0061] It should also be understood that, as used herein, the term “target gene” encompasses sequences containing additional sequence elements, such as internal ribosome entry site (IRES) sequences, multiple siRNA target sites (msiTS), spacer sequences (such as polyAC sequences), start codons, stop codons, and any other sequence elements known in the art that can be used to generate circular RNA.
[0062] The IRES applicable to this invention include CVB3, CroV, and CSFV, whose DNA sequences are shown below.
[0063] CVB3-IRES TTAAAACAGCCTGTGGGTTGATCCCACCCACAGGCCCATTGGGCGCTAGCACTCTGGTATCACGGTACCTTTGTGCGCCTGTTTTATACCCCCTCCCCCAACTGTAACTTAGAAGTAACACACACCGATCAACAGTCAGCGTGGCACACCAGCCACGTTTTGATCAAGCACTTCTGTTACCCCGGACTGAGTATCAATAGACTGCTCACGCGGTTGAAGGAGAAAGCGTTCGTTATCCGGCCAACTACTTCGAAAAACCTAGTAACACCGTGGAAGTTGCAGAGTGTTTCGCTCAGCACTACCCCAGTGTAGATCAGGTCGATGAGTCACCGCATTCCCCACGGGCGACCGTGGCGGTGGCTGCGTTGGCGGCCTGCCCATGGGGAAACCCATGGGACGCTCTAATACAGACATGGTGCGAAGAGTCTATTGAGCTAGTTGGTAGTCCTCCGGCCCCTGAATGCGGCTAATCCTAACTGCGGAGCACACACCCTCAAGCCAGAGGGCAGTGTGTCGTAACGGGCAACTCTGCAGCGGAACCGACTACTTTGGGTGTCCGTGTTTCATTTTATTCCTATACTGGCTGCTTATGGTGACAATTGAGAGATCGTTACCATATAGCTATTGGATTGGCCATCCGGTGACTAATAGAGCTATTATATATCCCTTTGTTGGGTTTATACCACTTAGCTTGAAAGAGGTTAAAACATTACAATTCATTGTTAAGTTGAATACAGCAAA (SEQ ID NO:16)。
[0064] CroV-IRES: GTATAAGAGACAGGTGTTTGCCTTGTCTTCGGACTGGCATCTTGGGACCAACCCCCCTTTTCCCCAGCCATGGGTTAAATGGCAATAAAGGACGTAACAACTTTGTAACCATTAAGCTTTGTAATTTTGTAACCACTAAGCTTTGTGCACATAATGTAACCATCAAGCTTGTTAGTCCCAGCAGGAGGTTTGCATGCTTGTAGCCGAAATGGGGCTCGACCCCCCATAGTAGGATACTTGATTTTGCATTCCATTGTGGACCTGCAAACTCTACACATAGAGGCTTTGTCTTGCATCTAAACACCTGAGTACAGTGTGTACCTAGACCCTATAGTACGGGAGGACCGTTTGTTTCCTCAATAACCCTACATAATAGGCTAGGTGGGCATGCCCAATTTGCAAGATCCCAGACTGGGGGTCGGTCTGGGCAGGGTTAGATCCCTGTTAGCTACTGCCTGATAGGGTGGTGCTCAACCATGTGTAGTTTAAATTGAGCTGTTCATATACC (SEQ ID NO: 17)。
[0065] CSFV-IRES: GTATACGAGGTTAGTTCATTCTCGTATACACGATTGGACAAATCAAAATTATAATTTGGTTCAGGGCCTCCCTCCAGCGACGGCCGAACTGGGCTAGCCATGCCCATAGTAGGACTAGCAAACGGAGGGACTAGCCGTAGTGGCGAGCTCCCTGGGTGGTCTAAGTCCTGAGTACAGGACAGTCGTCAGTAGTTCGACGTGAGCAGAAGCCCACCTCGAGATGCTACGTGGACGAGGGCATGCCCAAGACACACCTTAACCCTAGCGGGGGTCGCTAGGGTGAAATCACACCACGTGATGGGAGTACGACCTGATAGGGCGCTGCAGAGGCCCACTATTAGGCTAGTATAAAAATCTCTGCTGTACATGGCAC(SEQ ID NO: 18)。
[0066] The TERIC method is applicable to target genes of any length. TERIC is particularly suitable for long target genes. In this context, "long" usually refers to a sequence of at least 500 nucleotides. Therefore, the length of the target gene can be at least 100, at least 250, at least 500, at least 1000, at least 2000, at least 3000, at least 4000, at least 5000, at least 6000, at least 7000, or at least 8000 nucleotides.
[0067] Extended anticodon arm sequence The target gene may also contain an extended anticodon arm (eACA) sequence. The eACA may be part of the target gene sequence (e.g., it may be naturally present in the target gene), but for clarity, it is mentioned separately here.
[0068] Extended anticodon arm (eACA) sequences are sequences capable of forming stem-loop structures (also known as hairpin structures or hairpin loops). A stem-loop structure forms when regions of two normally complementary (when read from opposite sides) single-stranded RNAs pair with each other. Base pairing produces a double helix structure ending with an unpaired loop. The natural tendency of eACA sequences to form stem-loop structures can be used to achieve and enhance the circularization of target genes.
[0069] Before circularization, the nucleic acid molecule to be circularized contains an eACA sequence located in two separate parts. The first part of the eACA sequence is located at or near the 5' end of the target gene, and the second part of the eACA sequence is located at or near the 3' end of the target gene, such as... Figure 2 B and Figure 7 As shown. During cyclization, ribozyme splicing covalently links the first and second parts of the eACA sequence, forming a circular target gene. In the resulting circular molecule, the first and second parts are linked to form the eACA sequence, which typically forms a shape like... Figure 2 B and Figure 7 The stem-ring structure shown.
[0070] The first part of the eACA sequence may include a first eACA stem and a first eACA loop. The second part of the eACA sequence may include a second eACA stem and a second eACA loop. The "stem" refers to the portion of the first (or second) part of the eACA sequence that can form the stem in a stem-loop structure. The "loop" refers to the portion of the first (or second) part of the eACA sequence that can form the loop in a stem-loop structure. Structures capable of forming stem-loop structures can be identified in the target gene, and the target gene can be rearranged so that the first portion capable of forming the stem-loop structure is located at one end, and the second portion is located at the other end. Subsequently, the target gene can be used for circularization. Therefore, in the nucleic acid molecule described herein, the stem and loop of the eACA sequence can form a stem-loop structure.
[0071] The specific nucleotide sequence of the eACA is not important to TERIC and does not determine whether cyclization occurs. Instead, the structure of the eACA, rather than its sequence, is important. Therefore, the eACA can be any nucleotide sequence. In some preferred embodiments, the last nucleotide of the second eACA loop is a nucleotide capable of forming a wobbling base pair with the corresponding nucleotide in the internal guide sequence described herein. Typically, the last nucleotide of the second eACA loop is uracil, forming a wobbling base pair with the corresponding guanine in the internal guide sequence. However, the last nucleotide of the second eACA loop can also be cytosine, forming a wobbling base pair with adenine. In other embodiments, the last nucleotide of the second eACA loop is a nucleotide capable of forming a standard base pair with the corresponding nucleotide in the internal guide sequence, or a nucleotide that cannot form a wobbling or standard base pair with the corresponding nucleotide in the internal guide sequence.
[0072] The first and second eACA stems can be complementary to each other, but this is not absolutely necessary, and some non-complementarity is also acceptable.
[0073] The length of the first and second eACA stems is typically at least 5 nucleotides each, but can be as short as 1 nucleotide each. The stem length can be adjusted according to the target gene to be circularized. For example, if a long (>500 nt) target gene is to be circularized, a longer stem length (e.g., greater than 15 nt) may be more advantageous.
[0074] Therefore, the lengths of the first and second stems can each be at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 15, at least 20, at least 25, or at least 30 nucleotides. In particular, the lengths of the first and second stems can each be at least 15 or at least 25 nucleotides.
[0075] The lengths of the first and second stems do not have to be the same. For example, as long as a stem-ring structure can still be formed, one stem may be one or two nucleotides shorter than the other.
[0076] The natural length of the anticodon loop of Ana tRNA type I introns is 7 nucleotides. Therefore, in the circular RNAs described herein, the loop length of the stem-loop structure can be 7 nucleotides, especially when the ribozyme used is or is derived from Ana type I introns. If other type I introns are used, the loop length of the stem-loop structure may vary. The loop length of the stem-loop structure is typically between 3 and 10 nucleotides. In many cases, the loop length of the stem-loop structure is at least 5 nucleotides, especially when the ribozyme is or is derived from Ana type I introns.
[0077] Typically, if the ring portion of the stem-loop structure contains 7 nucleotides, then the first eACA ring portion contains 4 nucleotides and the second eACA ring portion contains 3 nucleotides.
[0078] Accordingly, the length of the first and second eACA stems can each be at least 15 nucleotides, the length of the first eACA loop can be 4 nucleotides, and the length of the second eACA loop can be 3 nucleotides. In the formed circular RNA molecule, this will produce an eACA sequence capable of forming a stem-loop structure, wherein the stem contains at least 15 base pairs and the loop is 7 nucleotides long.
[0079] Generally, the first part of the eACA sequence may contain as few as 5 nucleotides (e.g., 1 stem nucleotide and 4 cyclic nucleotides). The second part of the eACA sequence may contain as few as 4 nucleotides (e.g., 1 stem nucleotide and 3 cyclic nucleotides). Alternatively, the first part of the eACA sequence may contain, for example, 19 nucleotides (e.g., 15 stem nucleotides and 4 cyclic nucleotides), or 29 nucleotides (e.g., 25 stem nucleotides and 4 cyclic nucleotides). The second part of the eACA sequence may contain, for example, 18 nucleotides (e.g., 15 stem nucleotides and 3 cyclic nucleotides), or 28 nucleotides (e.g., 25 stem nucleotides and 3 cyclic nucleotides).
[0080] An exemplary first part of the eACA sequence, comprising a stem of 1 nucleotide and a loop of 4 nucleotides, may contain the nucleotide sequence 5'-NNNNN-3', where N is any nucleotide; an exemplary second part of the eACA sequence, comprising a stem of 1 nucleotide and a loop of 3 nucleotides, may contain the nucleotide sequence 5'-NNNU-3', where N is any nucleotide. Taking nanoluciferase (NLuc) as an example, a possible ACA sequence is GATCACCACTTTAAGGTGATC (SEQ ID NO: 19). For circularization, the NLuc GOI is rearranged such that the ACA sequence is provided in two parts (a first part at the 5' end and a second part at the 3' end). The first part of the eACA sequence contains the sequence TTAAGGTGATC (SEQ ID NO: 20). The second part of the eACA sequence contains the sequence GATCACCACT (SEQ ID NO: 21). It should be recognized that providing thymine in the DNA precursor molecule will convert it to uracil in the posttranscribed RNA molecule to be circularized.
[0081] The first and second eACA loops pair with the internal guide sequence (IGS) bases to form the P1 and P10 regions, which are crucial for ribozyme activity. The first eACA loop, located at the 5' end of the target gene, pairs with the IGS bases to form the P10 region. Not all nucleotides in the first eACA loop are required to participate in the formation of the P10 region; in some cases, only two nucleotides in the first eACA loop participate in its formation. The second eACA loop, located at the 3' end of the target gene, pairs with the IGS bases to form the P1 region.
[0082] As described above, for cyclization to occur, the last nucleotide of the second eACA loop (i.e., the nucleotide located at the 3' end of the second eACA loop) can form a wobbling base pair with the corresponding nucleotide in the IGS. Typically, this wobbling base pair is a GU wobbling base pair, where G is located in the IGS and U is located in the second eACA loop. This wobbling base pair provides a cyclization site, such that once cyclization occurs, the nucleotide located at the 3' end of the second eACA loop becomes the third nucleotide in the eACA stem-loop structure. This process is as follows... Figure 8 As shown. In other embodiments, the last nucleotide of the second eACA loop may form a standard base pair with the corresponding nucleotide in the internal guide sequence. In still other embodiments, the last nucleotide of the second eACA loop may not form a wobbling or standard base pair with the corresponding nucleotide in the internal guide sequence.
[0083] The P1 region can also be formed by base pairing between IGS and the adjacent region along the 3' direction of the second eACA loop (called the "P1 extension region"). If present, the P1 extension region typically contains 2 to 4 nucleotides paired with IGS bases. Therefore, the P1 region can be formed by the P1 extension region and the second eACA loop together pairing with IGS bases, as shown below. Figure 2 B and Figure 7 As shown. Therefore, in some embodiments, the second portion of the eACA sequence and the P1 extension region together can form the P1 region. If the P1 extension region is absent, the P1 region is formed solely by the second eACA loop and IGS base pairing. The P1 extension region has been described in Olson and Muller (2012) RNA 18:581-589, the contents of which are incorporated herein by reference. Typically, if an extension guide sequence (EGS) is used, the P1 extension region is present.
[0084] A key advantage of the TERIC method is its ability to utilize pre-existing eACA sequences in the target gene. For example, if a stem-loop-forming eACA sequence is found in the target gene, the gene can be efficiently circularized without introducing any additional sequences. This, in turn, means that the resulting circular RNA is unlikely to be immunogenic. First, the eACA sequence (i.e., the stem-loop-forming structure) in the target gene is identified. Then, the target gene is rearranged so that the eACA sequence is split into two parts, located at opposite ends of the target gene. This rearranged gene is then cloned into the TERIC construct for circularization. An example of this is the protein-coding circular RNA T2A nanoluciferase. The natural sequence of this circular RNA already contains the eACA sequence. This means that a circularization site can be introduced using a naturally occurring eACA sequence without mutation or the introduction of additional sequences.
[0085] If the natural coding sequence (CDS) does not contain an eACA sequence, a selective mutation can be performed to create one. Codon degeneracy means that the nucleotide sequence of the GOI can be mutated without affecting the resulting peptide sequence. Therefore, an eACA sequence can be provided in the GOI without introducing an additional sequence. Instead, selective mutations can be performed on an existing sequence according to codon degeneracy rules.
[0086] If the non-coding RNA does not contain eACA, or if the circularization site is located in the untranslated region (UTR) of the protein-coding RNA, a circularization site can be created by introducing additional nucleotides. For example, as... Figure 8 As shown, five nucleotides (light gray nt) can be introduced to create the stem of the eACA sequence, while the remaining part of the eACA is provided using the existing sequence of GOI (black nt).
[0087] For example, when the eACA is located in the coding sequence to be circularized, the GOI from 5' to 3' may contain: a stop codon, a polyAC sequence, a multiple siRNA targeting site (msiTS), an IRES, a start codon, and the coding sequence containing the eACA. When the eACA is located in the untranslated region of the sequence to be circularized, the GOI from 5' to 3' may contain: a multiple siRNA targeting site (msiTS), an IRES, a start codon, a coding sequence, a stop codon, a polyAC sequence, and the eACA.
[0088] Therefore, in the nucleic acid molecules described herein, the first and / or second portions of the eACA sequence can naturally exist in the target gene. In other words, they can be part of the target gene and thus exist without mutating the existing sequence or introducing additional sequences.
[0089] Alternatively, in the nucleic acid molecules described herein, all or part of the eACA sequence may be derived from human ribosomal RNA (rRNA). Using human rRNA may provide circular RNA with lower immunogenicity.
[0090] The positions of the first and second portions of the eACA sequence within the target gene have little effect on circularization. One portion of the eACA sequence may be located within or placed in the coding sequence, while the other portion may be located within or placed in the untranslated region. For example, it is not required that both portions be located within the coding sequence or both portions be located within the untranslated region.
[0091] Therefore, this paper describes a nucleic acid molecule containing a target gene, wherein the nucleic acid molecule comprises, from the 5' to the 3' direction: a) A first bridging sequence, wherein the first bridging sequence comprises a sequence corresponding to the 3' portion of the ribozyme, and b) Target gene.
[0092] In some cases, the nucleic acid molecule comprises, from 5' to 3', the following: a) A first bridging sequence, wherein the first bridging sequence comprises a sequence corresponding to the 3' portion of the ribozyme. b) Extend the first part of the anticodon arm (eACA) sequence. c) Target gene, and d) The second part of the eACA sequence.
[0093] This article also describes a nucleic acid molecule containing the target gene, wherein the nucleic acid molecule comprises, from the 5' to the 3' direction: a) A first bridging sequence, wherein the first bridging sequence comprises a sequence corresponding to the 3' portion of the ribozyme. b) Target gene, and c) A second bridging sequence, wherein the second bridging sequence comprises a sequence corresponding to the 5' portion of the ribozyme.
[0094] In some cases, the nucleic acid molecule comprises, from 5' to 3', the following: a) A first bridging sequence, wherein the first bridging sequence comprises a sequence corresponding to the 3' portion of the ribozyme. b) Extend the first part of the anticodon arm (eACA) sequence. c) Target gene, d) The second part of the eACA sequence, and e) A second bridging sequence, wherein the second bridging sequence comprises a sequence corresponding to the 5' portion of the ribozyme.
[0095] Other components may also be included in the nucleic acid molecule, such as extension guide sequences and circular sequences, as described below.
[0096] The nucleic acid molecules, bridging sequences, target genes, ribozymes, partial or truncated ribozymes, extension guide sequences, circular sequences, homologous arms, extended anticodon arm (eACA) sequences, or other sequences described herein may comprise or consist of the amino acid sequences of the reference sequences listed herein, or may be mutants of the reference sequences listed herein. For example, the mutant sequence may have at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99%, or 100% sequence identity with the reference sequence. In some embodiments, the mutant sequence may differ from the reference sequence due to the insertion, addition, substitution, or deletion of one, two, three, four, five, six, seven, eight, nine, ten, or more nucleotides.
[0097] Modification One key advantage of the TERIC method is its ability to circularize modified RNA. Therefore, the target gene can contain at least one modified nucleotide.
[0098] The target gene may contain any number of modified nucleotides deemed useful for the intended application of the circular RNA (e.g., therapeutic or research applications). Therefore, the percentage of modified nucleotides in the target gene can vary from 0% to 100%. In some cases, the target gene may be fully modified, meaning 100% of the nucleotides are modified. The target gene may contain at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of the modified nucleotides.
[0099] The modification may be a base modification. For example, the modification may be a ribose modification. In some embodiments, the modification may be selected from the group consisting of: m 5 C(5-methylcytidine); m 5 U(5-methyluridine); m 6 A(N) 6 -methyladenosine); s 2 U (2-thiouridine); Ψ (pseudouridine); N 1 Ψ(N) 1 -Methylpseudouridine); Um(2′-O-methyluridine); m 1 A (1-methyladenosine); m 2 A (2-methyladenosine); Am (2′-O-methyladenosine); ms 2 m6 A(2-methylthio-N) 6 -methyladenosine); i 6 A(N) 6 -Isopentenyl adenosine); ms 2 i 6 A(2-methylthio-N) 6 -Isopentenyl adenosine); io 6 A(N) 6 -(cis-hydroxyisopentenyl)adenosine); ms 2 io 6 A(2-methylthio-N) 6 -(cis-hydroxyisopentenyl)adenosine); g 6 A(N) 6 -glycylcarbamoyladenosine); t 6 A(N) 6 -Threonylcarbamoyladenosine); ms 2 t 6 A(2-methylthio-N) 6 -Threonylcarbamoyladenosine); m 6 t 6 A(N) 6 -Methyl-N 6 -Threonylcarbamoyladenosine); hn 6 A(N) 6 -hydroxypentylcarbamoyladenosine); ms 2 hn 6 A(2-methylthio-N) 6 -hydroxypentylcarbamoyladenosine); Ar(p) (2′-O-ribosyladenosine (phosphate)); I (inosine); m 1 I(1-methylinosine); m 1 Im (1,2′-O-dimethylinosine); m 3 C(3-methylcytidine); Cm(2′-O-methylcytidine); s 2 C(2-thiocytidine); ac 4 C(N4-acetylcytidine); f 5 C(5-formylcytidine); m 5 Cm(5,2′-O-dimethylcytidine); ac 4 Cm(N) 4 -acetyl-2′-O-methylcytidine); k 2 C (lysicin); m 1 G(1-methylguanosine); m 2 G(N) 2 -methylguanosine); m 7 G(7-methylguanosine); Gm(2′-O-methylguanosine); m 22G(N) 2 N 2 -dimethylguanosine); m 2 Gm(N2,2′-O-dimethylguanosine); m 2 2Gm(N) 2 N 2 ,2′-O-trimethylguanosine); Gr(p) (2′-O-ribosylguanosine (phosphate)); yW (huaitin); o2yW (peroxyhuaitin); OHyW (hydroxyhuaitin); OhyW0 (incompletely modified hydroxyhuaitin); imG (huaoside); mimG (methylhuaoside); Q (Q nucleoside); oQ (epoxy Q nucleoside); galQ (galactosyl-Q nucleoside); manQ (mannosyl-Q nucleoside); preQ0 (7-cyano-7-deazoguanosine); preQ1 (7-aminomethyl-7-deazoguanosine); G + (Ancient purine); D (dihydrouridine); m 5 Um(5,2′-O-dimethyluridine); s 4 U (4-thiouridine); m 5 s 2 U (5-methyl-2-thiouridine); s 2 Um (2-thio-2′-O-methyluridine); acp 3 U (3-(3-amino-3-carboxypropyl)uridine); ho 5 U (5-hydroxyuridine); mo 5 U (5-methoxyuridine); cmo 5 U (uridine 5-oxyacetic acid); mcmo 5 U (uridine 5-oxyacetic acid methyl ester); chm 5 U (5-(carboxyhydroxymethyl)uridine); mchm 5 U (5-(carboxyhydroxymethyl)uridine methyl ester); mcm 5 U (5-methoxycarbonylmethyluridine); mcm 5 Um (5-methoxycarbonylmethyl-2′-O-methyluridine); mcm 5 s 2 U (5-methoxycarbonylmethyl-2-thiouridine); nm 3 S 2 U (5-aminomethyl-2-thiouridine); mnm 5 U (5-methylaminomethyluridine); mnm 5 s 2 U (5-methylaminomethyl-2-thiouridine); mnm 5 se 2 U (5-methylaminomethyl-2-selenouridine); ncm 5U (5-carbamoylmethyluridine); ncm 5 Um (5-carbamoylmethyl-2′-O-methyluridine); cmnm 5 U (5-Carboxymethylaminomethyluridine); cmnm 5 Um (5-carboxymethylaminomethyl-2′-O-methyluridine); cmnm 5 s 2 U (5-carboxymethylaminomethyl-2-thiouridine); m 6 2A(N) 6 N 6 -dimethyladenosine); Im(2′-O-methylinosine); m 4 C(N4-methylcytidine); m 4 Cm(N) 4 ,2′-O-dimethylcytidine); hm 3 C(5-hydroxymethylcytidine); m 3 U (3-methyluridine); cm 5 U(5-carboxymethyluridine); m 6 Am(N) 6 ,2′-O-dimethyladenosine); m 6 2Am(N) 6 N 6 (O-2′-trimethyladenosine); m 2,7 G(N2,7-dimethylguanosine); m 2,2,7 G(N) 2 N 2 ,7-Trimethylguanosine); m 3 Um (3,2′-O-dimethyluridine); m 3 D (5-methyldihydrouridine); f 5 Cm (5-formyl-2′-O-methylcytidine); m 1 Gm(1,2′-O-dimethylguanosine); m 1 Am(1,2′-O-dimethyladenosine); τm 5 U(5-Taurine methyluridine); τm 5 s 2 U (5-Tauratemethyl-2-thiouridine); imG-14 (4-Demethylwoyoside); imG2 (Isowoyoside); or ac 6 A(N) 6 α-acetyladenosine (A-acetyladenosine), or any combination thereof.
[0100] The target gene may contain at least one modified nucleotide, wherein the modification is m 6 A(N) 6 (-methyladenosine) modification. The target gene may contain at least 95% modified nucleotides, wherein the modification is m6 A(N) 6 (-methyladenosine) modification. The target gene may contain 100% modified nucleotides, wherein the modification is m 6 A(N) 6 α-methyladenosine (MAA) modification.
[0101] The target gene may contain at least one modified nucleotide, wherein the modification is N. 1 Ψ(N) 1 α-methylpseuuridine) modification. The target gene may contain at least 95% modified nucleotides, wherein the modification is N-methylpseuuridine. 1 Ψ(N) 1 α-methylpseudouridine (-methylpseudouridine) modification. The target gene may contain 100% modified nucleotides, wherein the modification is N... 1 Ψ(N) 1 Modification with methylpseuuridine (-methylpseuuridine).
[0102] The target gene may contain at least one modified nucleotide, wherein the modification is m 5 C(5-methylcytidine) modification. The target gene may contain at least 95% modified nucleotides, wherein the modification is m 5 C(5-methylcytidine) modification. The target gene may contain 100% modified nucleotides, wherein the modification is m 5 C(5-methylcytidine) modification.
[0103] When circularizing RNA containing modified bases using the methods described herein, the internal guide sequence of the ribozyme and the sequence of the target gene (especially the eACA sequence) can be adjusted to minimize the disruptive effects of the modification on the interaction between the ribozyme and the GOI. In some cases, the IGS can be adjusted to be CG-rich, for example, containing 60% or higher, 80% or higher, or 100% CG. Those skilled in the art will understand that the sequence of the target gene should be adjusted accordingly to maintain complementary base pairing. The specific form of sequence alteration or adjustment will depend on the nucleotide modifications required for the final circular RNA.
[0104] Extended Wizard Sequence The nucleic acid molecules and modified ribozymes described herein may further each contain extension guide sequences (EGS). Specifically, the modified ribozyme may contain a first EGS, while the nucleic acid molecule containing the target gene may contain a second EGS. The first and second EGS are complementary to each other. The function of the EGS is generally to increase the length of the complementary base pairing region between the ribozyme and the nucleic acid molecule containing the target gene.
[0105] The modified ribozyme described herein may contain a first EGS located at the 5' end of the truncated ribozyme. The nucleic acid molecule containing the target gene described herein may contain a second EGS located at the 3' end of the nucleic acid molecule. Typically, there is a circular sequence between the first EGS and the truncated ribozyme, as described in detail below. Similarly, there is usually a circular sequence between the second EGS and the target gene.
[0106] The first EGS and the second EGS can be partially or completely complementary to each other. Generally, mismatch is permissible and does not substantially affect cyclization. Therefore, the first EGS can be at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100% complementary to the second EGS. Typically, the first EGS can be substantially complementary to the second EGS, for example, at least 70% complementary.
[0107] If present, the length of each of the first and second EGS can be between 1 and 500 nucleotides. For example, the length of each of the first and second EGS can be between 10 and 50 nucleotides. The length of each of the first and second EGS can be 20, 30, or 40 nucleotides.
[0108] An exemplary first EGS sequence is GGUCAAUCGGUUGGCUUCCG (SEQ ID NO: 22).
[0109] An exemplary second EGS sequence is CGGAAGCCAACCGAUUGACC (SEQ ID NO: 23).
[0110] Extending the P1 region of base pairing may adversely affect cyclization. To avoid this, the ribozymes and nucleic acid molecules described herein may further include circular sequences, such as a first circular sequence and a second circular sequence.
[0111] The first and second circular sequences can be configured to serve as spacer sequences. For example, in a ribozyme, the first circular sequence can serve as a spacer sequence between an inner guide sequence (IGS) and a first extension guide sequence (EGS); in a nucleic acid molecule containing a target gene, the second circular sequence can serve as a spacer sequence between the target gene and a second EGS. Preferably, the circular sequences are not complementary to each other, such that there is little or no base-pairing interaction between the first and second circular sequences. Due to the low complementarity or non-complementarity between the two circular sequences, the P1 region of base pairing remains a fixed length. Typically, the circular sequences are substantially non-complementary. For example, the circular sequences may have complementarity of less than 30%, less than 20%, less than 10%, or less than 5%.
[0112] The lengths of the first and second circular sequences can each be between 1 and 10 nucleotides. The first and second circular sequences do not need to have the same number of nucleotides; in fact, the TERIC method works well even when the lengths of the first and second circular sequences are different. The length of the first circular sequence can be 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. The length of the second circular sequence can be 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. A preferred combination is a 6-nucleotide first circular sequence and a 5-nucleotide second circular sequence. Another preferred combination is a 3-nucleotide first circular sequence and a 2-nucleotide second circular sequence.
[0113] The first circular sequence is located at the 3' end of the first EGS and the 5' end of the truncated ribozyme; in other words, it is located between the first EGS and the truncated ribozyme. In a nucleic acid molecule containing the target gene, the second circular sequence is located at the 3' end of the target gene and the 5' end of the second EGS; in other words, it is located between the target gene and the second EGS. If a P1 extension region is present, the second circular sequence is located at the 3' end of the P1 extension region.
[0114] Two circular sequences are not always required. Circularization can be achieved using only the first circular sequence located between the first EGS and the truncated ribozyme, without the second circular sequence. Alternatively, only the circular sequence located between the second part of the target gene and the second EGS can be used.
[0115] An exemplary sequence of the first circular sequence is AAAAAA.
[0116] An exemplary sequence of the second circular sequence is ACACC.
[0117] Therefore, this paper describes a modified ribozyme that contains the following from the 5' to 3' direction: a) Extended Guide Sequence (EGS) b) Circular sequences, and c) A truncated ribozyme, wherein the truncated ribozyme does not contain the 3' portion of the corresponding wild-type ribozyme.
[0118] This article also describes a modified ribozyme that includes the following from the 5' to 3' direction: a) Extended Guide Sequence (EGS) b) Circular sequences, and c) A truncated ribozyme, wherein the truncated ribozyme does not contain the 3' portion of the corresponding wild-type ribozyme, and does not contain the 5' portion of the corresponding wild-type ribozyme.
[0119] This article also describes a nucleic acid molecule containing a target gene, wherein the nucleic acid molecule containing the target gene comprises, from the 5' to the 3' direction: a) A bridging sequence comprising a sequence corresponding to the 3' portion of the ribozyme. b) Target gene, c) Circular sequences, and d) Extend the wizard sequence.
[0120] This article also describes a nucleic acid molecule containing a target gene, wherein the nucleic acid molecule containing the target gene comprises, from the 5' to the 3' direction: a) A first bridging sequence, the first bridging sequence comprising a sequence corresponding to the 3' portion of the ribozyme. b) Target gene, c) A second bridging sequence, which contains a sequence corresponding to the 5' portion of the ribozyme. d) Circular sequences, and e) Extend the wizard sequence.
[0121] This article also describes a nucleic acid molecule containing a target gene, wherein the nucleic acid molecule containing the target gene comprises, from the 5' to the 3' direction: a) A bridging sequence comprising the 3' portion of the ribozyme. b) Extend the first part of the anticodon arm (eACA) sequence. c) Target gene, d) The second part of the eACA sequence; e) Circular sequences, and f) Extend the wizard sequence.
[0122] This article also describes a nucleic acid molecule containing a target gene, wherein the nucleic acid molecule containing the target gene comprises, from the 5' to the 3' direction: a) A first bridging sequence, the first bridging sequence comprising a sequence corresponding to the 3' portion of the ribozyme. b) Extend the first part of the anticodon arm (eACA) sequence. c) Target gene, d) A second bridging sequence, which contains a sequence corresponding to the 5' portion of the ribozyme. e) The second part of the eACA sequence. f) Circular sequences, and g) Extend the wizard sequence.
[0123] Homologous arm sequences As part of the cyclization method described herein, homologous arms can also be provided for ribozymes and nucleic acid molecules containing GOI. The purpose of the homologous arms is to enable the 5' end of GOI to interact with the 3' end of the ribozyme, such as... Figure 2 As shown in B. Figure 2 B labeled the homologous arm on the GOI as "HR-G" and the homologous arm on the ribozyme as "HR-R".
[0124] Homologous arms function similarly to EGS by extending the complementary base pairing region between the GOI and the ribozyme. Therefore, the first and second homologous arms can be partially or completely complementary to each other. Typically, mismatches are permissible and do not substantially affect cyclization. Accordingly, the first and second homologous arms can be at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100% complementary. Typically, the homologous arms are substantially complementary to each other, for example, at least 70% complementary.
[0125] Homologous arms can be of any length that promotes cyclization and do not necessarily have to be the same length. For example, homologous arms on GOIs can be longer or shorter than those on ribozymes. The length of each homologous arm can be at least 1, 2, 3, 4, 5, 10, 15, 20, 30, 50, 100, 150, 200, 250, 300, or 500 nucleotides. The length of each homologous arm can be between 1 and 50, 1 and 40, 1 and 30, 1 and 20, 5 and 50, 5 and 40, 5 and 30, 5 and 20, 10 and 50, 10 and 40, 10 and 30, or 10 and 20 nucleotides. In some cases, the length of each homologous arm is 20 nucleotides.
[0126] Here is a pair of exemplary homologous arm sequences: HR-R (ribozyme): CAGGACAACAGCATCACTAG (SEQ ID NO: 47), HR-G (GOI): CTAGTGATGCTGTTGTCCTG (SEQ ID NO: 48).
[0127] For modified ribozymes, the homologous arm is typically located at its 3' end. For nucleic acid molecules containing the target gene, the homologous arm is typically located at its 5' end. Therefore, the modified ribozymes described herein can include, from 5' to 3', the following: a) First Extended Guide Sequence (EGS) b) First circular sequence, c) Truncated ribozymes, wherein the truncated ribozyme does not contain the 3' portion of the corresponding wild-type ribozyme, and d) Homologous arm sequences.
[0128] The nucleic acid molecules containing the target gene described in this article may include, from the 5' to 3' direction: a) Homologous arm sequences, b) A bridging sequence comprising a sequence corresponding to the 3' portion of the ribozyme sequence. c) Target gene, d) Circular sequences, and e) Extend the wizard sequence.
[0129] Methods for producing circular RNA This document describes a method for producing a circular target gene. The method typically includes providing a bridging sequence (as described herein) at the 5' end of the gene to be circularized, and optionally also providing a second bridging sequence at the 3' end of the gene. The bridging sequences can be added to the target gene using methods known in the art. For example, a DNA template can be synthesized containing a bridging sequence linked to the 5' end of the target gene, and / or a bridging sequence linked to the 3' end of the target gene. As described elsewhere herein, the first bridging sequence contains a sequence corresponding to the 3' portion of a ribozyme, and the second bridging sequence contains a sequence corresponding to the 5' portion of a ribozyme.
[0130] The method further includes providing a modified ribozyme as described elsewhere in this document. Typically, the modified ribozyme is a ribozyme whose 3' portion has been removed. Therefore, the modified ribozyme may comprise a truncated ribozyme, wherein the truncated ribozyme does not contain the 3' portion of the corresponding wild-type ribozyme. For example, for Ana I introns, the modified ribozyme may correspond to nucleotides 1-226 or 1-242 of SEQ ID NO:1, with nucleotides 227-249 or 243-249 removed, respectively. The modified ribozyme may also comprise a truncated ribozyme, wherein the truncated ribozyme does not contain the 5' portion of the corresponding wild-type ribozyme. Compared to the wild-type ribozyme, the truncated ribozyme may be truncated at both the 5' and 3' ends.
[0131] Typically, the method involves combining a target gene and a modified ribozyme under conditions suitable for cyclization. Cycling protocols are generally known in the art. Advantageously, this step can be performed for 10 to 60 minutes, and in some cases 20 to 40 minutes. Cycling can be achieved by co-heating the target gene and the modified ribozyme, for example, to 50°C to 60°C. Cycling can also be achieved by heating the mixture of the target gene and the modified ribozyme to approximately 55°C for about 20 minutes. The target gene and the modified ribozyme can be combined and / or co-heated in any suitable cyclization buffer known in the art.
[0132] Methods for generating circular target genes may include: a) Provide a nucleic acid molecule, wherein the nucleic acid molecule contains a first bridging sequence and a target gene in the 5' to 3' direction, wherein the first bridging sequence contains a sequence corresponding to the 3' portion of the ribozyme. b) Provide a modified ribozyme comprising a truncated ribozyme, wherein the truncated ribozyme does not contain the 3' portion of the corresponding wild-type ribozyme, and c) Combining the nucleic acid molecule and the modified ribozyme under conditions suitable for cyclization.
[0133] The ratio of modified ribozyme to target gene is typically 1:1 or higher. For example, the ratio can be 2:1, 3:1, 4:1, 5:1, 6:1 or higher. In particular, the ratio can be 4:1.
[0134] The concentration of the target gene is typically between about 100 nM and about 500 nM. In some embodiments, the concentration of the target gene may be between 200 nM and 400 nM.
[0135] The steps described herein may include providing a DNA template encoding any of the modified ribozyme or target gene prior to the steps described herein. Such methods may also include an in vitro transcription of the DNA template to provide an RNA precursor. The methods may further include a step of refolding the modified ribozyme and target gene after in vitro transcription and before the addition of a circularization buffer.
[0136] Because the TERIC method allows for the reuse of TER, the method described herein may further include a step of recovering the modified ribozyme. The recovered modified ribozyme can then be used for subsequent reactions. Suitable methods for recovering the modified ribozyme include separation and purification by gel filtration or gel extraction. In some cases, the modified ribozyme can be recovered and / or purified simultaneously with the recovery of the desired circular RNA. In other cases, the TER can be immobilized on a solid surface, such as covalently attached to magnetic beads or plates, or other suitable surfaces known in the art. The target gene can be added, circularized, and eluted to recover the circular RNA, while the TER remains bound to the solid surface and can be reused for second and subsequent rounds of circularization reactions with new target genes.
[0137] This article also discloses the circular RNA obtained by the above method.
[0138] The present invention also provides circular RNA comprising a sequence encoding a target gene, wherein the circular RNA comprises at least one modified nucleotide residue as described herein, and wherein the circular RNA does not contain exogenous exon sequences, and / or does not contain any sequences derived from ribozymes.
[0139] The present invention also provides circular RNA comprising a sequence encoding a target gene, wherein the circular RNA comprises an eACA sequence, and wherein the circular RNA comprises at least one modified nucleotide residue. In some cases, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% of the nucleotide residues in the circular RNA may be modified.
[0140] Reagent test kit This invention provides a kit for circularizing a target gene. Typically, the kit of this invention comprises a modified ribozyme as described herein and a nucleic acid molecule containing the target gene.
[0141] A kit for cyclizing a target gene may comprise a modified ribozyme and a nucleic acid molecule containing the target gene, wherein the modified ribozyme comprises a truncated ribozyme that does not contain the 3' portion of the corresponding wild-type ribozyme, and the nucleic acid molecule containing the target gene comprises, from the 5' to the 3' direction: a) A bridging sequence comprising a sequence corresponding to the 3' portion of the ribozyme, and b) Target gene.
[0142] A kit for cyclizing a target gene may contain a modified ribozyme and a nucleic acid molecule containing the target gene, wherein the modified ribozyme comprises, from the 5' to 3' direction: a) First Extended Guide Sequence (EGS) b) First circular sequence, c) Internal Guide Sequence (IGS), and d) Truncated ribozymes, wherein the truncated ribozyme does not contain the 3' portion of the corresponding wild-type ribozyme, and The nucleic acid molecule containing the target gene contains, from the 5' to 3' direction: a) A bridging sequence comprising a sequence corresponding to the 3' portion of the ribozyme. b) Extend the first part of the anticodon arm (eACA) sequence. c) Target gene, d) The second part of the eACA sequence, e) The second circular sequence, and f) Second EGS.
[0143] This disclosure also covers DNA precursor molecules encoding any modified ribozymes, target genes, and nucleic acid molecules containing target genes as described herein. Figure 7As shown, any ribozyme or nucleic acid molecule as described herein can be provided as a DNA template, followed by in vitro transcription (IVT) to provide a ribozyme and a circularizable RNA molecule. Kits comprising a first DNA molecule and a second DNA molecule, the first DNA molecule encoding a modified ribozyme and the second DNA molecule encoding a nucleic acid molecule, are also disclosed herein.
[0144] The present invention can also be further described with reference to the following non-limiting numbered embodiments.
[0145] 1. A method for producing a circular target gene, the method comprising: a) Provide a nucleic acid molecule, wherein the nucleic acid molecule contains a first bridging sequence and a target gene in the 5' to 3' direction, wherein the first bridging sequence contains a sequence corresponding to the 3' portion of the ribozyme. b) Provide a modified ribozyme comprising a truncated ribozyme, wherein the truncated ribozyme does not contain the 3' portion of the corresponding wild-type ribozyme, and c) Combining the nucleic acid molecule and the modified ribozyme under conditions suitable for cyclization.
[0146] 2. The method of Clause 1, wherein the nucleic acid molecule further comprises a second bridging sequence located at the 3' end of the target gene, wherein the second bridging sequence comprises a sequence corresponding to the 5' portion of the ribozyme, and wherein the truncated ribozyme does not comprise the 5' portion of the corresponding wild-type ribozyme.
[0147] 3. The method as described in Clause 1 or 2, wherein at least a portion of the first bridging sequence is capable of base complementary pairing with the 3' portion of the modified ribozyme.
[0148] 4. The method as described in any of the preceding clauses, wherein at least a portion of the first bridging sequence is capable of forming a P9 region with the 3' portion of the modified ribozyme.
[0149] 5. The method as described in any of the preceding clauses, wherein the length of the first bridging sequence is between 1 and 249 nucleotides.
[0150] 6. The method as described in any of the preceding clauses, wherein the length of the first bridging sequence is between 1 and 30 nucleotides.
[0151] 7. The method as described in any of the preceding clauses, wherein the length of the first bridging sequence is 8 nucleotides.
[0152] 8. The method of any one of clauses 1-7, wherein the first bridging sequence comprises a sequence corresponding to nucleotide residues 242-249 of SEQ ID NO: 1 or 49.
[0153] 9. The method of any one of Clauses 1-6, wherein the first bridging sequence is 23 nucleotides in length.
[0154] 10. The method of any one of clauses 1-6 or 9, wherein the first bridging sequence comprises a sequence corresponding to nucleotide residues 227-249 of SEQ ID NO:1 or 49.
[0155] 11. The method as described in any of the preceding clauses, wherein the 3' portion of the corresponding wild-type ribozyme is between 1 and 249 nucleotides in length.
[0156] 12. The method as described in any of the preceding clauses, wherein the 3' portion of the corresponding wild-type ribozyme is between 1 and 30 nucleotides in length.
[0157] 13. The method as described in any of the preceding clauses, wherein the 3' portion of the corresponding wild-type ribozyme is 8 nucleotides in length.
[0158] 14. The method of any one of clauses 1-12, wherein the 3' portion of the corresponding wild-type ribozyme is 23 nucleotides in length.
[0159] 15. The method of any one of clauses 1-13, wherein the truncated ribozyme comprises the nucleotide sequence of SEQ ID NO:13.
[0160] 16. The method of any one of clauses 1-12 or 14, wherein the truncated ribozyme comprises the nucleotide sequence of SEQ ID NO:12.
[0161] 17. The method of any one of Clauses 2-16, wherein at least a portion of the second bridging sequence is capable of base complementary pairing with the 5' portion of the modified ribozyme.
[0162] 18. The method of any one of Clauses 2-17, wherein at least a portion of the second bridging sequence is capable of serving as an internal guide sequence.
[0163] 19. The method of any one of Clauses 2-18, wherein the length of the second bridging sequence is between 1 and 1500 nucleotides.
[0164] 20. The method of any one of clauses 2-19, wherein the second bridging sequence comprises a sequence corresponding to residues 1-10 of SEQ ID NO: 1 or 49.
[0165] 21. The method of any one of Clauses 2-20, wherein the 5' portion of the corresponding wild-type ribozyme is between 1 and 1500 nucleotides in length.
[0166] 22. The method of any one of clauses 2-21, wherein the 5' portion of the corresponding wild-type ribozyme comprises a sequence corresponding to residues 1-10 of SEQ ID NO: 1 or 49.
[0167] 23. The method as described in any of the preceding clauses, wherein the target gene comprises at least one modified nucleotide.
[0168] 24. The method as described in Clause 23, wherein the modification is a base modification.
[0169] 25. The method as described in Clause 23 or 24, wherein at least one modified nucleotide is selected from N6-methyladenosine, N1-methylpseuuridine, or a combination thereof.
[0170] 26. The method as described in any of the preceding clauses, wherein the modified ribozyme further comprises a first extension guide sequence (EGS) at its 5' end, and the nucleic acid molecule further comprises a second EGS at its 3' end.
[0171] 27. The method as described in Clause 26, wherein the first and second EGS are substantially complementary to each other.
[0172] 28. The method as described in clause 26 or 27, wherein the modified ribozyme comprises, from the 5' to 3' direction: a first EGS, a first circular sequence, and a truncated ribozyme; and The nucleic acid molecule described therein comprises, from 5' to 3', a first bridging sequence, a target gene, a second circular sequence, and a second EGS.
[0173] 29. The method as described in Clause 28, wherein the first and second circular sequences are substantially non-complementary.
[0174] 30. The method as described in Clause 29 or 30, wherein the first and second circular sequences are configured to serve as spacer sequences.
[0175] 31. The method as described in any of the preceding clauses, wherein the modified ribozyme further comprises a first homologous arm sequence at the 3' end, and the nucleic acid molecule further comprises a second homologous arm sequence at the 5' end.
[0176] 32. The method as described in Clause 31, wherein the first and second homologous arm sequences are substantially complementary to each other.
[0177] 33. The method described in any of the preceding clauses, wherein the ratio of the modified ribozyme to the nucleic acid molecule is 1:1 or higher.
[0178] 34. The method described in any of the preceding clauses, wherein the ratio of the modified ribozyme to the nucleic acid molecule is approximately 4:1.
[0179] 35. The method as described in any of the preceding clauses, wherein the concentration of the nucleic acid molecule is between about 200 nM and about 400 nM.
[0180] 36. The method as described in any of the preceding clauses, wherein step (c) is performed for 20 to 40 minutes.
[0181] 37. The method as described in any of the preceding clauses, wherein step (c) comprises heating the mixture of the nucleic acid molecule and the modified ribozyme.
[0182] 38. The method as described in any of the preceding clauses, wherein step (c) comprises heating the mixture of the nucleic acid molecule and the modified ribozyme to between 50°C and 60°C.
[0183] 39. The method as described in any of the preceding clauses, wherein step (c) comprises heating the mixture of the nucleic acid molecule and the modified ribozyme to about 55°C for about 20 minutes.
[0184] 40. A circular RNA obtained by any one of clauses 1 to 39.
[0185] 41. A modified ribozyme for a method of circularizing RNA molecules, said modified ribozyme comprising, from the 5' to 3' direction: a) First Extended Guide Sequence (EGS) b) The first circular sequence, and c) A truncated ribozyme, wherein the truncated ribozyme does not contain the 3' portion of the corresponding wild-type ribozyme.
[0186] 42. The modified ribozyme as described in Clause 41, wherein the truncated ribozyme further does not contain the 5' portion of the corresponding wild-type ribozyme.
[0187] 43. A nucleic acid molecule containing a target gene, and a method for circularizing the target gene, wherein the nucleic acid molecule comprises, from the 5' to the 3' direction: a) A bridging sequence comprising a sequence corresponding to the 3' portion of the ribozyme sequence. b) Target gene, c) Circular sequences, and d) Extend the wizard sequence.
[0188] 44. The nucleic acid molecule as described in Clause 43, further comprising a second bridging sequence at its 3' end, wherein the second bridging sequence comprises a sequence corresponding to the 5' portion of the ribozyme sequence.
[0189] 45. A kit for circularizing a target gene, said kit comprising a modified ribozyme and a nucleic acid molecule containing the target gene. The modified ribozyme comprises a truncated ribozyme that does not contain the 3' portion of the corresponding wild-type ribozyme, and The nucleic acid molecule containing the target gene comprises, from the 5' to the 3' direction: a) A bridging sequence comprising the 3' portion of the ribozyme, and b) Target gene.
[0190] 46. A kit comprising a first DNA molecule and a second DNA molecule, the first DNA molecule encoding a modified ribozyme in a kit as described in Clause 41 or 42, and the second DNA molecule encoding a nucleic acid molecule containing a target gene in a kit as described in Clause 43 or 44.
[0191] 47. A DNA molecule encoding a modified ribozyme as described in any of the preceding clauses.
[0192] 48. A DNA molecule that encodes a nucleic acid molecule containing a target gene as described in any of the preceding clauses.
[0193] 49. A circular RNA comprising a sequence encoding a target gene, wherein the circular RNA comprises at least one modified nucleotide residue, and wherein the circular RNA does not contain an exogenous exon sequence.
[0194] 50. A circular RNA comprising a sequence encoding a target gene, wherein the circular RNA comprises an eACA sequence, and wherein the circular RNA comprises at least one modified nucleotide residue.
[0195] Any aspect or embodiment described herein that uses the term "comprising" may include other features or steps within its scope. Wherever they appear herein, the term "comprising" or "including" may be replaced by the terms "consisting of," "consisting of," "substantially consisting of," or "substantially consisting of," and vice versa.
[0196] Wherever they appear in this text, the phrase “selected from the group containing…” can be replaced with the phrase “selected from the group consisting of…” and vice versa.
[0197] It should also be understood that this application discloses all combinations of any of the foregoing aspects and embodiments unless the context otherwise requires. Similarly, this application discloses all combinations of preferred and / or optional features, whether individually or in combination with any other aspect, unless the context otherwise requires.
[0198] Modifications to the above embodiments, further embodiments, and their modifications will be apparent to those skilled in the art upon reading this disclosure; therefore, all such modifications and embodiments are within the scope of this invention. Those skilled in the art will understand that this invention is defined by the appended claims, and not by the description of the embodiments or other specific embodiments included herein.
[0199] For all purposes, all documents and sequence databases mentioned in this specification are incorporated herein by reference in their entirety.
[0200] Similarly, unless the context explicitly specifies otherwise, the singular forms “a,” “one,” and “the” contain plural references.
[0201] As used herein, “and / or” should be understood as a specific disclosure of each of the two specified features or components, whether or not the other is included. For example, “A and / or B” should be regarded as a specific disclosure of each of (i) A, (ii) B, and (iii) A and B, as if each were listed separately herein.
[0202] Unless otherwise defined above, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Any methods and materials similar to or equivalent to those described herein may also be used in the practice or testing of this invention. Generally, the nomenclature and techniques related to cell and tissue culture, molecular biology, immunology, genetics, and protein and nucleic acid chemistry described herein are those well known and commonly used in the art, or used in accordance with the manufacturer's instructions.
[0203] The present invention will now be further described with reference to the accompanying drawings and through the following embodiments, which are intended to help those skilled in the art to implement the present invention and are not intended to limit the scope of the present invention in any way.
[0204] Example Materials and methods DNA template: Plasmids TRIC V1-CVB3-EGFP (SEQ ID NO: 24), TRIC V2-CVB3-EGFP (SEQ ID NO: 25), TRIC V2-circZnf609 (SEQ ID NO: 26), PIE-CVB3-EGFP (SEQ ID NO: 27), and PIE-circZnf609 (SEQ ID NO: 28) were prepared according to the description in GB2308675.4. To obtain these plasmids, the inventors amplified them in TOP10 competent cells and purified them using the QIAGEN Maxi Plus plasmid purification kit. Subsequently, the purified plasmids were linearized using EcoR V enzyme and washed by phenol:chloroform:isoamyl alcohol extraction. For the TERIC constructs, the inventors amplified the templates from the corresponding TRIC plasmids by PCR using the primers specified in Table 1.
[0205] Table 1. DNA primers for TERIC In vitro transcription (IVT): In vitro transcription (IVT) was performed using a DNA template at a concentration of 50 ng / μl. The IVT reaction mixture consisted of 14 μg / μl of homemade T7 polymerase, 0.04 U / μl of RNase inhibitor (Promega), 6 mM of each nucleoside triphosphate (NTP), and 1X IVT buffer. For TERIC, the 1X IVT buffer consisted of 80 mM HEPES-K (pH 7.5), 2 mM spermidine, 40 mM DTT, and 24 mM MgCl2. On the other hand, for TRIC and PIE, the MgCl2 concentration in the 1X IVT buffer was adjusted to 14 mM.
[0206] The IVT reaction was incubated at 37 °C for 3–5 h, followed by digestion with RNase-free DNase I for 20 min. To remove the precipitate, 100 mM EDTA was added to bring the final concentration to 25 mM. Subsequently, an equal volume of 7.5 M lithium chloride was added to precipitate the RNA. This precipitation step was carried out at -20 °C for 30 min to overnight. The resulting precipitate was centrifuged at 13,000 rpm / min for at least 20 min, the RNA precipitate was washed with 75% ethanol, air-dried, and dissolved in DEPC-treated water.
[0207] Circular RNA synthesis: First, all RNAs underwent a refolding process. They were denatured at 95 °C for 2 minutes and then annealed on ice for 3 minutes. The circularization step was performed in a 10 μl reaction volume and terminated by adding 2 μl of 100 mM EDTA.
[0208] For TRIC and PIE precursors, refolded RNA to a final concentration of 200 nM was mixed with 10X circularization buffer (consisting of 500 mM Tris-HCl, pH 7.4, 100 mM MgCl2, 10 mM DTT, and 20 mM GTP). The mixture was heated at 55 °C for 8 minutes for circularization.
[0209] For TERIC, two protocols were used. In Protocol A, TER and pG were mixed in DEPC-treated water and recombinated as described above. Then, cyclization buffer was added, and the cyclization reaction was carried out at 55 °C for 20 minutes. In Protocol B, TSR and pG were directly recombinated in cyclization buffer, then mixed and cyclized at 55 °C for 20 minutes. The splicing conditions, such as GTP concentration, the ratio of TER to pG, pG concentration, and reaction duration, were optimized accordingly.
[0210] RT-PCR and Sanger sequencing: The reverse transcriptase and DNA polymerase used here were SuperScript IV reverse transcriptase (ThermoFisher) and Q5 high-fidelity DNA polymerase (NEB), respectively. Reverse transcription and PCR were performed according to the manufacturer's manual. RT-PCR_Reverse (GTGAACCGCATCGAGCTG, SEQ ID NO: 43) was used as the reverse primer, with TERIC V2 pG and circularized pG as templates for reverse transcription. Subsequently, RT-PCR_Forward (TTTGCTGTATTCAACTTAACAATGAATTGTAATG, SEQ ID NO: 44) and RT-PCR_Reverse were used to PCR the reverse transcription products. The RT-PCR products were gel recovered and sent for Sanger sequencing.
[0211] Natural agarose gel electrophoresis: 100 ml of 1.0% agarose gel was prepared using 1X TBE (89 mM Tris, 89 mM boric acid, 3 mM EDTA) containing 10 μl of SYBR Safe (Thermo Fisher). The gel was run for 40–60 minutes at a constant power of 25 W at room temperature using an Owl Easy Cast B2 mini-gel electrophoresis system (Thermo Scientific) with 1X TBE as the run buffer. For loading, each RNA sample (~500 ng) was mixed with an equal volume of formamide loading buffer (Thermo Fisher) and denatured at 95 °C for 2 minutes. All gels (including those described below) were imaged using a Bio-Rad ChemiDoc XRS+ imaging system.
[0212] Urea agarose gel electrophoresis: Vertical gel electrophoresis was performed using the Bio-Rad Mini-PROTEAN Tetra vertical electrophoresis system. First, agarose was boiled in DEPC water, mixed with urea, and brought to a final volume with 10X TBE and DEPC water. This mixture was then poured into gel plates with 1.5 mm septa. To prevent the gel from slipping during electrophoresis, a 0.75 mm baffle was attached to the bottom edge of the bottom plate. The gel was placed at 4°C for several hours to solidify. Before removing the comb, the cover plate should be slid down to expose it, as pulling the comb directly will damage the gel. The wells were then cleaned with a pipette tip, and the cover plate was slid back into place. The gel was electrophoresed at 20 W for 30 minutes at room temperature. For sample loading, each RNA sample (approximately 100 ng) was mixed with an equal volume of urea loading buffer (NEB) and denatured at 95°C for 2 minutes. Before imaging, the gel was stained for 10 minutes in 10 ml of 1X TBE containing SYBR Safe.
[0213] Example 1 Type I introns utilize internal guide sequences (IGS) to form P1 and P10 structures with flanking exons, bringing the exons closer together to facilitate splicing. Figure 2A). For trans-cleaving ribozymes (TERs, a class of ribozymes lacking exons and IGS), tertiary interactions enable them to recognize substrates containing exons and IGS, thereby cleaving the bridging sequence between exons (Sargueil B and Tanner NK (1993) J Mol Biol. 233:639-643). Further studies have shown that preserving IGS and restoring the P9.0 interaction between TER and the 3' bridging sequence in TSRs can improve TSR efficiency (Bell MA, Johnson AK and Testa SM (2002) Biochemistry, 41:15327-33; Bell MA, Johnson AK and Testa SM (2004) Biochemistry, 43:4323-31).
[0214] To develop a system capable of trans-circularizing a target gene, the inventors utilized type I introns containing the IGS sequence (i.e., cyanobacteria). Anabaena tRNA Leu Introns, hereinafter referred to as "Ana"). To enable this ribozyme to excise a fragment from the target gene independently, the inventors repositioned the 3' portion of the intron to the 5' end of the target gene. Figure 2 B). The inventors hypothesize that this 3' portion (also known as the 3' bridging sequence) will form the P9.0 region with the trans-cutting ribozyme, thereby enhancing the interaction between the ribozyme and the target gene to promote splicing.
[0215] Furthermore, the inventors discovered that introducing extension guide sequences (EGS) onto both the ribozyme and the target gene can further enhance the interaction between them to promote splicing. Finally, the inventors integrated the finding that bacterial exons can be replaced by extended anticodon arm (eACA) sequences. This invention utilizes both EGS and eACA sequence elements to provide a trans-cleaving ribozyme capable of efficiently circularizing the target gene. This method is named Trans-Cleavage-Based Circularization (TERIC).
[0216] Based on the above, the inventors constructed two Ana-based trans-cleavage ribozymes, named TER V1 (containing nucleotides 1 to 241 of Ana, SEQ ID NO: 13) and TER V2 (containing nucleotides 1 to 226 of Ana, SEQ ID NO: 12). Figure 2Simultaneously, the precursor (pG) of the corresponding target gene was generated. For TER V1, nucleotides 242-249 of Ana (SEQ ID NO: 14) were used as the 3' bridging sequence, and for TER V2, nucleotides 227-249 of Ana (SEQ ID NO: 15) were used as the 3' bridging sequence. Figure 2 B). These 3' bridging sequences are linked to the 5' end of the target gene encoding EGFP, which also contains other sequence elements such as CVB3 (IRES), a stop codon, a start codon, and polyAC.
[0217] Successful circularization of these constructs yields 1593 nt of circCVB3-EGFP. Previous studies have shown that *Pneumocystis carinii* (…) P. carinii Type I intron TER does not require GTP cofactor for function (Bell MA, Johnson AK, and Testa SM (2002)). To investigate whether the same applies to Ana TSR, the inventors performed splicing reactions in 10 μL reaction volumes using GTP at final concentrations of 0.1, 0.5, and 2 mM. Two splicing reaction setups were used. In Setup A, the in vitro transcribed TER and pG were first mixed and refolded in a 5:1 ratio, then added to splicing buffer and heated at 55°C for 20 minutes. In Setup B, TSR and pG were first refolded separately in splicing buffer, then mixed and heated at 55°C for 20 minutes. The final concentration of pG was 200 nM. The splicing reaction was terminated with 2 μL of 100 mM EDTA, and the sample was loaded onto a 0.8% natural agarose gel.
[0218] like Figure 3 As shown in Figure A, TERIC V2 exhibits the highest splicing efficiency at 2 mM GTP when using scheme A, although TER V1 also achieves efficient splicing under scheme A. Splicing is also achieved using scheme B, but with lower efficiency than scheme A. The bands marked with hollow circles represent circCVB3-EGFP.
[0219] To verify the presence of circCVB3-EGFP, the inventors loaded pG samples, both before and after circularization, onto a 1.5% agarose gel containing 6M urea. The results showed that circular RNA was present in the spliced sample, but not in the pG sample. Figure 3 B). Use Figure 2 RT-PCR using primers shown in B further confirmed the circularization. As expected, a 1236 bp RT-PCR product was amplified from the circularization reaction product, while this product was not observed in the pG sample. Figure 3 C). In summary, TERIC can efficiently synthesize circular RNA.
[0220] Example 2 Subsequently, the inventors optimized the ratio between TER and pG. Initially, they maintained the pG concentration at 200 nM and gradually increased the TER concentration from 200 nM to 1600 nM. Figure 4 A showed that when the TER / pG ratio was in the range of 1-4, increasing the TER concentration improved the cyclization efficiency. However, when the TER / pG ratio exceeded 4, the cyclization efficiency did not show a significant change. Subsequently, the inventors fixed the TER to pG ratio at 4 and investigated the effects of pG concentration and cyclization time. Figure 4 As shown in B and 4C, the highest cyclization efficiency can be obtained when the pG concentration range is 200 nM to 400 nM and the cyclization time is 20-40 minutes, while maintaining a relatively low level of nicking.
[0221] Example 3 Previous research by the inventors has demonstrated that, compared to TRIC V1 (as described in GB2308675.4 and PCT / EP2024 / 065837, the entire contents of which are incorporated herein by reference) and substitution-type intron-exon (PIE) methods (which rely on bacterial tRNA exon sequences), including the eACA sequence is crucial for improving the efficiency of TRIC V2. To investigate whether the same principle applies to TRIC, the inventors synthesized a pG in which the eACA is replaced by a native tRNA sequence ( Figure 5 B). The pG sequence is shown in SEQ ID NO: 9, wherein the tRNA sequences are shown in SEQ ID NO: 45 (5' end) and SEQ ID NO: 46 (3' end). Figure 5 As shown in Figure A, circular RNA was observed in samples containing tRNA precursors; however, the regimen containing eACA produced significantly superior results in terms of circularization efficiency.
[0222] Example 4 It is known that substitutional intron-exon methods cannot circularize modified circular RNAs because base modifications can disrupt ribozyme structures (Wesselhoeft, RA et al. (2019) Mol Cell 74:508-520 e504). The inventors hypothesized that TRIC activity would also be eliminated. To investigate this, the inventors synthesized PIE-CVB3-EGFP and TRIC V2-CVB3-EGFP precursors (SEQ ID NO: 27 and 25, respectively) with or without m6A or N1Ψ modifications (N6-methyladenosine and N1-methylpseuuridine, respectively), and tested the ability of the PIE and TRIC methods to circularize these base-modified target genes.
[0223] like Figure 6 As shown in Figure A, unmodified PIE and TRIC precursors were efficiently converted into circular RNA, while no circular RNA was observed for the modified PIE or TRIC mutants. To assess whether the TERIC method could circularize modified pG, the inventors synthesized a modified pG precursor, but kept the ribozyme unmodified. Consistent with previous observations, unmodified TERIC V2 successfully circularized unmodified pG. However, surprisingly, no circular RNA was observed for the modified pG. The inventors identified two potential reasons for the failure of modified pG circularization. First, although the TER was unmodified, the 3' bridging sequence at the 5' end of pG could be modified, and this 3' bridging sequence spans nucleotides 227-249 of the Ana intron. Modification of m6A or N1Ψ within this short 3' bridging sequence may eliminate TERIC activity. Secondly, IGS (UUGAG) in TER V2 is an AU-rich sequence, and the corresponding m6A or N1Ψ modifications in eACA may weaken the P1 and P10 structures, thereby disrupting TER activity.
[0224] To test these hypotheses, the inventors replaced IGS in TER V2 with CCGCC (e.g., Figure 6 As shown in Figure C, IGS is indicated by underlined shaded text. Correspondingly, pG was also mutated, and pG cyclization yields circZnf609. Since IGS is now CCGCC, the only U in the GU wobbling base pair in the P1 structure will be modified by N1Ψ. We synthesized pG with or without modification of PIE-circZnf609 (SEQ ID NO: 28), TRIC V2-circZnf609 (SEQ ID NO: 26), and TERICV2-circZnf609 (SEQ ID NO: 11), as well as unmodified TER (SEQ ID NO: 10). Figure 6 As shown in Figure B, as expected, no circularization of the modified circular RNA was observed in the PIE construct. Interestingly, no circularization was also observed for TRIC V2-circZnf609, indicating that removing AU from the P1 and P10 structures did not restore ribozyme activity. However, for TERIC V2, circularized modified RNA was clearly observed ( Figure 6 B). Replacing IGS with CCGCC restored the cyclization of both the N1Ψ-modified and m6A-modified precursors, although only the cyclization efficiency of the N1Ψ-modified precursor was restored to a level comparable to that of the unmodified pG.
[0225] Example 5 We have demonstrated that 3'-truncated ribozymes can function as TERs for RNA circularization. To assess whether further 5'-truncated ribozymes can also function as TERs, we shortened the 5' end of the 3'-truncated ribozyme. Figure 9 As shown, the ribozyme with both 5' and 3' ends truncated (TER-trunc; SEQ ID NO: 52) successfully converted pG into circular RNA, with an efficiency comparable to that of the 3' truncated ribozyme.
[0226] The purpose of repositioning the 3' portion of the ribozyme to the 5' end of the target gene is to reconstruct the ribozyme structure between the ribozyme and GOI. For the reconstruction of ribozyme function, the structure itself, rather than the sequence or length, is crucial. To confirm this, we introduced mutations (SEQ ID NOs: 53 and 54) into the 3' portion of the ribozyme moved to the 5' end of the target gene. In the TERIC method, mutations in the GOI 3' bridging sequence, whether altering the sequence or the length, did not prevent circularization. Figure 9 In summary, in TERIC, ribozymes can be truncated at both the 5' and 3' ends, and the bridging sequence on the GOI does not need to be identical to the truncated portion of the ribozyme.
[0227] In summary, these results demonstrate that the TERIC method provides an alternative for circularizing unmodified RNA. Advantageously, TERIC can also be used to circularize modified RNA when previous methods such as PIE and TRIC are not applicable.
[0228] sequence list
Claims
1. A method for producing a circular target gene, the method comprising: a) Provide a nucleic acid molecule, wherein the nucleic acid molecule includes a first bridging sequence and a target gene in the 5' to 3' direction, wherein the first bridging sequence contains a sequence corresponding to the 3' portion of the ribozyme; b) Provide a modified ribozyme comprising a truncated ribozyme, wherein the truncated ribozyme does not contain the 3' portion of the corresponding wild-type ribozyme; and c) Combining the nucleic acid molecule and the modified ribozyme under conditions suitable for cyclization.
2. The method as described in claim 1, characterized in that, The nucleic acid molecule further includes a second bridging sequence located at the 3' end of the target gene, wherein the second bridging sequence includes a sequence corresponding to the 5' portion of the ribozyme, and wherein the truncated ribozyme does not include the 5' portion of the corresponding wild-type ribozyme.
3. The method as described in claim 1 or 2, characterized in that, At least a portion of the first bridging sequence is capable of base complementary pairing with the 3' portion of the modified ribozyme.
4. The method as described in any of the preceding claims, characterized in that, The length of the first bridging sequence is between 1 and 1500 nucleotides.
5. The method as described in any of the preceding claims, characterized in that, The 3' portion of the corresponding wild-type ribozyme is between 1 and 1500 nucleotides in length.
6. The method according to any one of claims 2-5, characterized in that, At least a portion of the second bridging sequence is capable of base complementary pairing with the 5' portion of the modified ribozyme.
7. The method according to any one of claims 2-6, characterized in that, The length of the second bridging sequence is between 1 and 1500 nucleotides.
8. The method according to any one of claims 2-7, characterized in that, The 5' portion of the corresponding wild-type ribozyme is between 1 and 1500 nucleotides in length.
9. The method as claimed in any of the preceding claims, characterized in that, The target gene contains at least one modified nucleotide.
10. The method as claimed in any of the preceding claims, characterized in that, The nucleotides of the target gene are 100% modified nucleotides.
11. The method as claimed in any of the preceding claims, characterized in that, The modified ribozyme further includes a first extension guide sequence (EGS) at the 5' end, and the nucleic acid molecule further includes a second EGS at the 3' end.
12. The method as described in claim 11, characterized in that, The modified ribozyme comprises, from 5' to 3', a first EGS, a first circular sequence, and a truncated ribozyme; and The nucleic acid molecule described therein comprises, from 5' to 3', a first bridging sequence, a target gene, a second circular sequence, and a second EGS.
13. The method as claimed in any of the preceding claims, characterized in that, The modified ribozyme further includes a first homologous arm sequence at the 3' end, and the nucleic acid molecule further includes a second homologous arm sequence at the 5' end.
14. The method as claimed in any of the preceding claims, characterized in that, The ratio of modified ribozymes to nucleic acid molecules is 1:1 or higher.
15. The method as claimed in any of the preceding claims, characterized in that, The ratio of modified ribozymes to nucleic acid molecules is approximately 4:
1.
16. The method as claimed in any of the preceding claims, characterized in that, The concentration of the nucleic acid molecules is between approximately 200 nM and approximately 400 nM.
17. The method as claimed in any of the preceding claims, characterized in that, Step (c) should be performed for 20 to 40 minutes.
18. The method as claimed in any of the preceding claims, characterized in that, Step (c) involves heating the mixture of the nucleic acid molecule and the modified ribozyme to between 50°C and 60°C.
19. The method as claimed in any of the preceding claims, characterized in that, Step (c) involves heating the mixture of the nucleic acid molecule and the modified ribozyme to approximately 55°C for approximately 20 minutes.
20. A circular RNA obtained by the method according to any one of claims 1 to 19.
21. A modified ribozyme for a method of circularizing RNA molecules, said modified ribozyme comprising, from the 5' to 3' direction: a) First Extended Guide Sequence (EGS) b) The first circular sequence, and c) A truncated ribozyme, wherein the truncated ribozyme does not contain the 3' portion of the corresponding wild-type ribozyme.
22. The modified ribozyme according to claim 21, characterized in that, The truncated ribozyme further excludes the 5' portion of the corresponding wild-type ribozyme.
23. The modified ribozyme according to claim 21 or 22, characterized in that, The corresponding wild-type ribozymes are type I or type II introns.
24. A nucleic acid molecule containing a target gene for a method of circularizing a target gene, wherein the nucleic acid molecule comprises, from the 5' to the 3' direction: a) A bridging sequence comprising a sequence corresponding to the 3' portion of the ribozyme sequence. b) The target gene, c) Circular sequences, and d) Extend the wizard sequence.
25. The nucleic acid molecule of claim 24, further comprising a second bridging sequence at the 3' end, wherein the second bridging sequence comprises a sequence corresponding to the 5' portion of the ribozyme sequence.
26. A kit for circularizing a target gene, the kit comprising a modified ribozyme and a nucleic acid molecule containing the target gene. The modified ribozyme comprises a truncated ribozyme that does not contain the 3' portion of the corresponding wild-type ribozyme, and The nucleic acid molecule containing the target gene includes, from the 5' to the 3' direction: a) A bridging sequence comprising the 3' portion of the ribozyme, and b) The target gene.
27. A kit comprising a first DNA molecule encoding a modified ribozyme as described in the kit of claim 6, and a second DNA molecule encoding a target gene nucleic acid molecule as described in the kit of claim 26.
28. The kit as described in claim 26 or 27, characterized in that, The target gene contains at least one modified nucleotide.
29. The kit according to any one of claims 26-28, characterized in that, The nucleotides of the target gene are 100% modified nucleotides.
30. A DNA molecule encoding a modified ribozyme as defined in any of the preceding claims.
31. A DNA molecule encoding a nucleic acid molecule as defined in any of the preceding claims, wherein the nucleic acid molecule comprises a target gene.
Citation Information
Patent Citations
Circular rnas and methods for making the same
GB202308675D0