A method for instant transformation of hygroryza verticillata and its application

Abstract

The application discloses a transient transformation method of Hydrilla verticillata and application thereof. The transformation method comprises the following steps: after an explant of the Hydrilla verticillata is subjected to disinfection treatment, the explant is inoculated into a sterile bud induction culture medium to culture, and sterile seedlings are obtained; a codon-optimized Cry1Ac gene is cloned into a pCAMBIA3301 plant expression vector to obtain a recombinant expression vector pCAMBIA3301-Cry1Ac; the recombinant expression vector pCAMBIA3301-Cry1Ac is introduced into agrobacterium, and the obtained recombinant agrobacterium is used to infect stem tips of the sterile seedlings of the Hydrilla verticillata, and the Hydrilla verticillata is obtained through co-culture. The obtained transgenic Hydrilla verticillata can significantly reduce the survival rate of the larvae of the Crambus leucogonus, effectively reduces the feeding damage of the larvae to the Hydrilla verticillata, and provides a new technical approach for genetic engineering improvement of the submerged plant and biological control of the aquatic pest.

Description

Technical Field

[0001] This application relates to the field of plant genetic engineering technology, specifically to a method for the instantaneous transformation of *Hydrilla verticillata* and its application. Background Technology

[0002] *Hydrilla verticillata* is a perennial submerged plant widely distributed in freshwater areas of my country. This plant is highly adaptable, capable of growing in environments with insufficient light, turbid water, and either oligotrophic or eutrophic conditions. It also possesses a strong ability to accumulate pollutants, making it an ideal plant material for water purification. Furthermore, *Hydrilla verticillata* is high in protein, and its roots, stems, and leaves serve as palatable green fodder for herbivorous fish, shrimp, and crabs. It is easy to cultivate and has a high reproductive rate, enabling it to build stable ecosystems in aquaculture waters and playing an important role in aquaculture. Therefore, *Hydrilla verticillata* possesses both ecological and economic value and is one of the species receiving significant attention in aquatic ecosystem restoration and aquaculture.

[0003] However, *Hydrilla verticillata* is frequently plagued by pests during its natural growth and artificial cultivation. Among these, the small-tubed water borer is one of the main pests affecting *Hydrilla verticillata*. This pest feeds on the leaves and stems of *Hydrilla verticillata* as larvae, and in severe cases, can lead to plant death, significantly impacting the population size and ecological function of *Hydrilla verticillata*. Currently, the control of the small-tubed water borer mainly relies on chemical pesticides, but the long-term use of chemical pesticides has many drawbacks: first, it pollutes the aquatic environment, affecting aquatic ecological safety; second, it causes non-target toxicity to aquatic organisms (such as fish, shrimp, and crabs), threatening the economic benefits of aquaculture; and third, it easily leads to pesticide resistance in pests, resulting in a gradual decline in control effectiveness. Therefore, developing an environmentally friendly, highly targeted, safe, and efficient method for controlling pests affecting *Hydrilla verticillata* is a pressing technical problem that needs to be solved in this field.

[0004] Plant genetic engineering technology offers a new approach to solving the aforementioned problems. By introducing exogenous genes into plants and enabling them to express related proteins, it is hoped that pest control can be achieved. Currently, the use of Agrobacterium-mediated transformation to introduce exogenous genes into plants to obtain transgenic plants has been successfully reported in various terrestrial plants (such as pear, bermudagrass, peanut, cotton, and corn).

[0005] However, the existing technology has the following shortcomings:

[0006] First, there is a lack of genetic transformation methods applicable to submerged plants. Existing plant genetic transformation technologies primarily target terrestrial plants, and their tissue culture conditions, Agrobacterium infection parameters, and screening systems are all based on the physiological characteristics of terrestrial plants. As a submerged plant, *Hydrilla verticillata* exhibits significant differences in physiological structure, tissue culture conditions, and regeneration capacity compared to terrestrial plants, making it difficult to directly apply terrestrial plant transformation methods to *Hydrilla verticillata*. Currently, there are no reports on genetic transformation methods for *Hydrilla verticillata*.

[0007] Second, existing transformation methods pose a risk of contamination by selection markers. Most plant genetic transformation methods rely on antibiotic or herbicide resistance genes as selection markers. These exogenous selection marker genes may pose potential risks to the environment through horizontal gene transfer or pollen dispersal. For submerged plants used in aquatic environments, the ecological safety risks of selection marker genes are even more prominent.

[0008] Third, there is a lack of effective control proteins against pests affecting *Hydrilla verticillata*. For the specific pest *Salmonella spp.*, existing technologies have not identified which exogenous proteins possess insecticidal activity, and there are no research reports on using genetic engineering to improve the insect resistance of *Hydrilla verticillata*. Therefore, screening for candidate genes with insecticidal activity against *Salmonella spp.* and establishing transformation methods suitable for *Hydrilla verticillata* are crucial for improving the insect resistance of *Hydrilla verticillata*.

[0009] In summary, there is an urgent need to establish a simple and efficient genetic transformation method suitable for *Hydrilla verticillata*, and on this basis, to screen and verify exogenous proteins with insecticidal activity against *Salmonella spp.*, so as to achieve specific control of the pest and thus solve the technical problem of *Salmonella spp.* damage during the cultivation and breeding of *Hydrilla verticillata*. Summary of the Invention

[0010] In view of this, the purpose of this application is to provide a method for the transient transformation of *Hydrilla verticillata* and its application, to solve the technical problems of the lack of genetic transformation methods for *Hydrilla verticillata* and the difficulty in controlling the small-bottle water borer pest in the prior art. This application establishes a sterile seedling culture system for *Hydrilla verticillata* and uses Agrobacterium-mediated transformation to introduce the codon-optimized Cry1Ac gene into the shoot tip of *Hydrilla verticillata*, achieving transient expression of the exogenous gene in *Hydrilla verticillata*. The resulting transgenic *Hydrilla verticillata* can significantly reduce the survival rate of small-bottle water borer larvae, effectively mitigating the feeding damage to *Hydrilla verticillata* caused by the pest, and providing a new technical approach for the genetic engineering improvement of submerged plants and the biological control of aquatic pests.

[0011] To achieve the above objectives, this application provides the following technical solution:

[0012] In a first aspect, this application provides a method for the transient transformation of *Hydrilla verticillata*, comprising the following steps:

[0013] (1) Sterile seedling culture: After disinfection, the explants of *Hydrilla verticillata* were inoculated into a sterile bud induction medium to obtain sterile seedlings;

[0014] (2) Expression vector construction: The codon-optimized Cry1Ac gene was cloned into the pCAMBIA3301 plant expression vector to obtain the recombinant expression vector pCAMBIA3301-Cry1Ac;

[0015] (3) Agrobacterium-mediated transformation: The recombinant expression vector pCAMBIA3301-Cry1Ac was introduced into Agrobacterium, and the resulting recombinant Agrobacterium was used to infect the stem tip of the sterile seedling of *Hydrilla verticillata* obtained in step (1), and *Hydrilla verticillata* was obtained through co-culture.

[0016] In some embodiments, the nucleotide sequence of the codon-optimized Cry1Ac gene described in step (2) is shown in SEQ ID NO:8.

[0017] In some embodiments, in step (2), the recombinant expression vector pCAMBIA3301-Cry1Ac further contains a maize Ubi promoter, which drives the expression of the Cry1Ac gene, and the nucleotide sequence of the recombinant expression vector pCAMBIA3301-Cry1Ac is shown in SEQ ID NO:9.

[0018] In some embodiments, in step (1), the aseptic bud induction medium is MS medium, with 3% sucrose, 0.5 mg / L 6-aminopurine, 0.1 mg / L naphthaleneacetic acid added, and pH 5.8-6.0; the explant is the stem tip or bud segment of *Hydrilla verticillata*.

[0019] In some embodiments, in step (3), the Agrobacterium is strain EHA105; the infection conditions are: Agrobacterium bacterial suspension concentration OD 600 =0.6-0.8, co-culture time was 14 days, co-culture temperature was 25±1℃, photoperiod was 12 h / d, and light intensity was 30 μE / (m²·s).

[0020] In some embodiments, in step (3), before the infection, the leaves of the stem tip of *Hydrilla verticillata* are peeled off, cut to a length of 1 cm, and the growth cone is wounded.

[0021] Secondly, this application provides a recombinant expression vector, pCAMBIA3301-Cry1Ac, which contains a maize Ubi promoter and a codon-optimized Cry1Ac gene. The nucleotide sequence of the codon-optimized Cry1Ac gene is shown in SEQ ID NO:8, and the nucleotide sequence of the recombinant expression vector is shown in SEQ ID NO:9.

[0022] Thirdly, this application provides the application of the transformed *Hydrilla verticillata* obtained by the method described in the first aspect in the control of *Spodoptera litura*.

[0023] Fourthly, this application provides a method for controlling the pest of Hydrilla verticillata and the small tube borer, comprising planting transformed Hydrilla verticillata obtained according to the method described in the first aspect, and using the Cry1Ac protein expressed by the transformed Hydrilla verticillata to kill the small tube borer larvae.

[0024] Fifthly, the application of the recombinant expression vector described in the second aspect of this application in the preparation of transgenic *Hydrilla verticillata*.

[0025] Compared with the prior art, this application has at least the following advantages and beneficial effects:

[0026] 1. This application establishes a complete sterile seedling culture system and an Agrobacterium-mediated transient transformation method for the submerged plant *Hydrilla verticillata*. By optimizing key parameters such as explant disinfection, culture medium formulation, and Agrobacterium infection conditions, transient expression of exogenous genes in *Hydrilla verticillata* was successfully achieved. The Cry1Ac protein expressed by the transformed *Hydrilla verticillata* was used to control the lepidopteran leafminer moth, avoiding problems such as chemical pesticide pollution of the aquatic environment, toxicity to non-target aquatic organisms, and pest resistance. This method is highly targeted, having a toxic effect only on the lepidopteran pest *Hydrilla verticillata*, without adverse effects on *Hydrilla verticillata* itself, and exhibits high ecological safety.

[0027] 2. This application optimizes infection conditions, including Agrobacterium bacterial concentration (OD). 600 The conversion efficiency was improved by adjusting parameters such as the concentration of *Hydrilla verticillata* (0.6-0.8 μg / m²·s), co-culture time (14 days), temperature (25±1℃), and light intensity (30 μE / (m²·s)). Simultaneously, shoot tip wound treatment further enhanced the infection efficiency of *Agrobacterium*, ensuring the reproducibility and stability of the conversion method. Virulence assays demonstrated that the Cry1Ac protein expressed by *Hydrilla verticillata* transformed in this application had a significant toxic effect on the larvae of *Hydrilla verticillata*. Seven days after feeding on the transformed *Hydrilla verticillata*, the survival rate of *Hydrilla verticillata* larvae was only 56.67%, while the survival rate of the control group feeding on wild-type *Hydrilla verticillata* was 86.67%, showing a significant difference.

[0028] 3. This application constructs a recombinant expression vector pCAMBIA3301-Cry1Ac, containing a maize Ubi promoter and a codon-optimized Cry1Ac gene. The maize Ubi promoter has the characteristic of efficiently driving the expression of exogenous genes in monocotyledonous plants, and codon optimization makes the Cry1Ac gene more suitable for the expression system of *Hydrilla verticillata*. This vector can not only be used for transient transformation of *Hydrilla verticillata*, but also provide an effective transformation tool for the genetic engineering improvement of other submerged plants or monocotyledonous plants. The codon-optimized Cry1Ac gene and maize Ubi promoter carried by this vector are expected to achieve efficient expression in other plants, and have broad application prospects. Attached Figure Description

[0029] Figure 1 The process of cultivating sterile seedlings of *Hydrilla verticillata*, including... Figure 1 A-1D are the state diagrams for days 3, 7, 15, and 20, respectively. Figure 1 E is a diagram of rooting culture.

[0030] Figure 2 This is a schematic diagram of the construction of pCAMBIA3301-Cry1Ac.

[0031] Figure 3 This is an agarose gel electrophoresis image of the PCR amplification products of the Ubi promoter.

[0032] Figure 4 This is a schematic diagram of the structure of the expression vector pCAMBIA3301-Cry1Ac.

[0033] Figure 5 Electrophoresis image of the pCAMBIA3301-Cry1Ac recombinant expression vector plasmid.

[0034] Figure 6 A flowchart illustrating the genetic transformation of *Hydrilla verticillata* mediated by *Agrobacterium*.

[0035] Figure 7 Image 10 (×10) shows the stained leaf of *Hydrilla verticillata* under an optical microscope. Figure 7 A represents the leaf of *Hydrilla verticillata* from the control group (untransformed); 7B-7F represent the leaf of *Hydrilla verticillata* from the transformed group.

[0036] Figure 8 The images show the staining of stem segments of *Hydrilla verticillata* transformed with Cry1Ac under a stereomicroscope. 8A and 8B are stem segments of *Hydrilla verticillata* from the control group (untransformed); 8C and 8D are stem segments of *Hydrilla verticillata* from the transformed group.

[0037] Figure 9 Results of total protein content in *Hydrilla verticillata* infected with *Agrobacterium*.

[0038] Figure 10Results of Cry1AC protein content in *Hydrilla verticillata* infected with *Agrobacterium*.

[0039] Figure 11 The image shows the results of a Western blot analysis of *Hydrilla verticillata* (Cry1Ac).

[0040] Figure 12 The survival rate of small tube borer larvae within 7 days of feeding on Cry1Ac Hydrilla verticillata. Detailed Implementation

[0041] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application.

[0042] The materials used in the following embodiments are not limited to those listed below, and other similar materials may be used instead. Unless otherwise specified, the instruments shall be used under conventional conditions or as recommended by the manufacturer. Those skilled in the art should have relevant knowledge of the use of conventional materials and instruments.

[0043] To better understand this teaching and without limiting its scope, all figures and other numerical values ​​used in the specification and claims to express quantities, percentages, or proportions should, in all cases, be understood to be modified by the term "about." Therefore, unless otherwise stated, the numerical parameters set forth in the following specification and appended claims are approximate values ​​that may vary depending on the desired properties sought. At a minimum, each numerical parameter should be interpreted based at least on the reported significant figures and by applying common rounding techniques.

[0044] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the subject matter of this application pertains. For ease of understanding, some terms are explained below:

[0045] 1. Transient transformation: This refers to the process by which a foreign gene, after being introduced into plant cells, is expressed within the cells for a short period without integration into the host chromosome. Unlike stable transformation, transient transformation does not require selection markers, has a short operation cycle, and is suitable for rapid validation of gene function and transient protein expression.

[0046] 2. Codon optimization: This refers to improving the translation efficiency of foreign genes in host cells by replacing synonymous codons in a gene to match the codon preferences of the host organism without altering the amino acid sequence. In this application, the Cry1Ac gene, after codon optimization, is better suited to the expression system of *Hydrilla verticillata*.

[0047] The following are specific examples:

[0048] Example 1: Obtaining sterile seedlings of *Hydrilla verticillata*

[0049] 1.1 Experimental Materials

[0050] The *Hydrilla verticillata* was collected from ponds around Wuhan, Hubei Province.

[0051] 1.2 Explant disinfection

[0052] Take healthy shoot tips from *Hydrilla verticillata*, soak them in soapy water for about 0.5 hours, and then rinse and soak them under tap water for 1 hour. Take shoot segments about 2 cm long, soak them in 70% ethanol for 30 seconds on a sterile operating table, then surface disinfect them with 10% sodium hypochlorite (by mass) for 10 minutes, rinse them repeatedly with sterile water 3 times, then disinfect them with 0.1% mercuric chloride (by mass) for 2 minutes, and rinse them repeatedly with sterile water 5 times.

[0053] 1.3 Aseptic bud induction culture

[0054] After sterilization, the stems of *Hydrilla verticillata* were cut into 5-10 mm lengths and inoculated into tissue culture flasks containing 40 mL of aseptic bud induction medium for static incubation. The aseptic bud induction medium was formulated as follows: Murashige-Skoog (MS) medium supplemented with 3% sucrose, 0.5 mg / L 6-aminopurine (6-BA), and 0.1 mg / L naphthaleneacetic acid (IAA), with the pH adjusted to 5.8-6.0.

[0055] Culture conditions: Cultured in a tissue culture room with an average light intensity of 30 μE / (m²·s), a photoperiod of 12 h / d, and an indoor temperature of 25±1℃.

[0056] 1.4 Subculture and Rooting Culture

[0057] After about 7 days of cultivation, lateral buds at the shoot tip or between the stems begin to sprout; after about 15 days, the plant grows to 1.0 cm, with 1-2 additional stem nodes, and produces lateral buds and leaves. The sprouted new shoots are transferred to 1 / 2 MS liquid subculture medium (containing 0.5 mg / L 6-BA, 0.1 mg / L IAA, pH 5.8-6.0) for 15 days of subculture, and then transferred to 1 / 2 MS liquid rooting medium (containing 0.1 mg / L IAA, pH 5.8-6.0) for 7 days of rooting culture to obtain complete sterile seedlings.

[0058] 1.5 Experimental Results

[0059] Figure 1 This demonstrates the cultivation process of sterile seedlings of *Hydrilla verticillata*, including... Figure 1 A-1D are the state diagrams for days 3, 7, 15, and 20, respectively. Figure 1E shows the rooting culture diagram. As can be seen from the diagram, on day 3, the explants turned white except for the stem nodes, where the color deepened to brown. Figure 1 A); After about 7 days, new buds begin to sprout from the stem tip ( Figure 1 B); After about 15 days, the plant grows 1-2 stem nodes and produces lateral buds and leaves; after being transferred to the proliferation medium and cultured for 20 days, multiple lateral buds are produced ( Figure 1 D); Transfer to MS liquid proliferation medium for rooting culture to obtain complete tissue culture seedlings ( Figure 1 E).

[0060] Example 2 Construction of plant expression vector

[0061] This embodiment demonstrates the construction process of the plant expression vector pCAMBIA3301-Cry1Ac, and its construction diagram is shown below. Figure 2 As shown.

[0062] 2.1 Amplification of the Ubi promoter in maize

[0063] Genomic DNA was extracted from maize (Zea mays) using a genomic DNA extraction kit (FastClean Plant Genomic DNA Kit, Kangwei Century CW0571). The Ubi gene sequence (accession number: DQ141598) was obtained from NCBI, with the upstream promoter (Ubi) sequence shown in SEQ ID NO:1.

[0064] Ubi promoter sequence (SEQ ID NO:1):

[0065] GTGCAGCGTGACCCGGTCGTGCCCCTCTCTAGAGATAAAGAGCATTGCATGTCTAAAGTATAAAAAATTACCACATATTTTTTGTCACACTTATTTGAAGTGTAGTTTATCTATCTCTATACATATATTTAAACTTCACTCTACAAATAATATAGTCTATAATACTAAAATAATATTAGTGTTTTAGAGGATCATATAAATAAACTGCTAGACATGGTCTAAAGGATAATTGAATATTTTGACAATCTACAGTTTTATCTTTTTAGTGTGCATGTGATCTCTCTGTTTTTTTTGCAAATAGCTTGACCTATATAATACTTCATCCATTTTATTAGTACATCCATTTAGGATTTAGGGTTGATGGTTTCTATAGACTAATTTTTAGTACATCCATTTTATTCTTTTTAGTCTCTAAATTTTTTAAAACTAAAACTCTATTTTAGTTTTTTTATTTAATAATTTAGATATAAAATGAAATAAAATAAATTGACTACAAATAAAACAAATACCCTTTAAGAAATAAAAAAACTAAGGAAACATTTTTCTTGTTTCGAGTAGATAATGCCAGCCTGTTAAACGCCGTCGACGAGTCTAACGGACACCAACCAGCGAACCAGCAGCGTCGCGTCGGGCCAAGCGAAGCAGACGGCACGGCATCTCTGTCGCTGCCTCTGGACCCCTCTCGAGAGTTCCGCTCCACCGTTGGACTTGCTCCGCTGTCGGCATCCAGAAATTGCGTGGCGGAGCGGCAGACGTGAGCCGGCACGGCAGGCGGCCTCCTCCTCCTCTCACGGCACCGGCAGCTACGGGGGATTCCTTTCCCACCGCTCCTTCGCTTTCCCTTCCTCGCCCGCCGTAATAAATAGACACCCCCTCCACACCCTCT.

[0066] Primers Ubi-F and Ubi-R were designed using Primer Premier 5.0 primer design software based on the upstream promoter (Ubi) sequence. Homologous arm sequences of plasmid pCAMBIA3301 were added to the 5' end of each primer. The primers were synthesized by Sangon Biotech. The primer sequences are shown in Table 1 below (underlined sequences are homologous arm sequences):

[0067] Table 1 Primers for Ubi promoter amplification

[0068]

[0069] Using maize DNA as a template, PCR amplification was performed using primers Ubi-F / Ubi-R. The amplification system is shown in Table 2 below:

[0070] Table 2 PCR amplification system

[0071]

[0072] The PCR reaction program was as follows: 30 cycles, each cycle consisting of denaturation at 98 °C for 5 seconds, annealing at 55 °C for 5 seconds, and extension at 72 °C for 30 seconds. After the reaction, the PCR products were analyzed by agarose gel electrophoresis. The results are as follows. Figure 3 As shown, the amplification products of all six independent clones exhibited a single, clear band at approximately 886 bp, consistent with the expected Ubi promoter fragment size, indicating successful amplification of the Ubi promoter. The target fragment was recovered and purified for subsequent vector construction.

[0073] 2.2 Construction of pCAMBIA3301-Ubi intermediate vector

[0074] The pCAMBIA3301 vector was digested with EcoRI and XmaI restriction endonucleases (Takara) at 37 °C for 3 h. The digestion system is shown in Table 3.

[0075] Table 3 Enzyme digestion system

[0076]

[0077] After enzyme digestion, the large target vector fragment was recovered. The Ubi gene promoter was ligated to the intended site on the pCAMBIA3301 vector using a seamless cloning kit (Kangwei Century). The ligation system is shown in Table 4.

[0078] Table 4 Connection System

[0079]

[0080] The recombinant expression vector was transformed into *E. coli* Trans-T1 competent cells by heat shock at 42 °C for 90 s. Positive clones were selected and colony PCR was performed using the pCAMBIA3301 universal primers M13F / M13R. The primer sequences are as follows:

[0081] M13F: 5'-CAGGAAACAGCTATGAC-3' (SEQ ID NO: 4);

[0082] M13R: 5'-ACTGGCCGTCGTTTTAC-3' (SEQ ID NO: 5).

[0083] The colony PCR reaction system is shown in Table 5:

[0084] Table 5 Colony PCR Reaction System

[0085]

[0086] The PCR reaction program was as follows: denaturation at 98 ℃ for 5 s, annealing at 55 ℃ for 5 s, extension at 72 ℃ for 30 s, for a total of 30 cycles. Positive clones were sent to Qingke Company for sequencing verification. The plasmid with correct sequencing was named pCAMBIA3301-Ubi and stored at -20 ℃. The nucleotide sequence of pCAMBIA3301-Ubi is shown in SEQ ID NO:6.

[0087] 2.3 Construction of pCAMBIA3301-Cry1Ac expression vector

[0088] 2.3.1 Carrier Construction Strategy

[0089] The structure of the plant expression vector pCAMBIA3301-Cry1Ac used in this embodiment is as follows: Figure 4 As shown. This vector uses pCAMBIA3301 as its backbone and contains the maize Ubi promoter, the codon-optimized Cry1Ac gene, the OCS terminator, and a selection marker gene.

[0090] 2.3.2 Codon-optimized Cry1Ac gene

[0091] The Cry1Ac gene sequence (accession number: U63372.1) was downloaded from NCBI and sent to GenScript Biotech for codon optimization to adapt it to in vivo expression in *Hydrilla verticillata*. The original and optimized Cry1Ac gene nucleotide sequences are shown in SEQ ID NO:7 and 8, respectively.

[0092] Original Cry1Ac (SEQ ID NO:7):

[0093]

[0094] Optimized Cry1Ac (SEQ ID NO:8):

[0095]

[0096] 2.3.3 Vector linearization and target fragment ligation

[0097] The plasmid pCAMBIA3301-Ubi was double-digested with XmaI and HindIII restriction endonucleases (Takara) at 37 °C for 3 h. The digestion system is shown in Table 6.

[0098] Table 6 Enzyme digestion system

[0099]

[0100] After enzyme digestion, the large target vector fragment was recovered. The linearized pCAMBIA3301-Ubi was ligated to the optimized Cry1Ac gene using a seamless cloning kit (Kangwei Century). The ligation system is shown in Table 7.

[0101] Table 7 Connection System

[0102]

[0103] 2.3.4 Transformation and Colony PCR Identification

[0104] The recombinant expression vector was transformed into *E. coli* Trans-T1 competent cells by heat shock at 42 °C for 90 s. Positive clones were picked and colony PCR was performed using the pCAMBIA3301 universal primers M13F / M13R (system as shown in Table 5). The PCR reaction program was: 98 °C denaturation for 5 s, 55 °C annealing for 5 s, and 72 °C extension for 45 s, for a total of 30 cycles. The amplified products were verified by agarose gel electrophoresis. The results are as follows: Figure 5 As shown, the plasmid DNA of the six independent clones all showed a clear band at approximately 3141 bp, consistent with the expected migration position of the supercoiled plasmid DNA.

[0105] 2.3.5 Sequencing Validation

[0106] Clones that tested positive by both colony PCR and plasmid electrophoresis were selected, and their plasmids were sent to Keenon for sequencing verification. The correctly sequenced plasmid was named pCAMBIA3301-Cry1Ac and stored at -20 ℃. The nucleotide sequence of pCAMBIA3301-Cry1Ac is shown in SEQ ID NO:9.

[0107] Example 3: Agrobacterium-mediated transient transformation of *Hydrilla verticillata*

[0108] 3.1 Preparation and transformation of Agrobacterium competent cells

[0109] The recombinant expression vector pCAMBIA3301-Cry1Ac constructed in Example 2 was introduced into EHA105 Agrobacterium competent cells (purchased from Vazyme). The specific operation is as follows:

[0110] (1) Take 0.5 μL of plasmid and add it to 50 μL of EHA105 Agrobacterium competent cells. After gently mixing, incubate on ice for 5 min and freeze in liquid nitrogen for 5 min.

[0111] (2) The mixture was melted at 37 °C, and 500 μL of antibiotic-free YEB liquid culture medium was added. The mixture was then revived at 28 °C and shaken at 180 rpm for 2-4 h until the liquid became turbid.

[0112] (3) Take 20 μL, 40 μL and 80 μL of culture medium respectively and spread them evenly on YEB solid medium containing kanamycin (Kana), and incubate overnight at 28°C with the medium inverted.

[0113] (4) Select single colonies and perform PCR amplification using Cry1Ac-specific primers. The primer sequences are as follows:

[0114] Cry1Ac-F: 5'-CTCCACTTGAGCGTCCTGC-3' (SEQ ID NO: 10);

[0115] Cry1Ac-R: 5'-AGCCCTGATGATGCTGACTGA-3' (SEQ ID NO: 11).

[0116] The PCR products were sent to Qingke Biotechnology Co., Ltd. for sequencing verification.

[0117] (5) Single colonies with correct sequencing were added to YEB liquid medium containing Kana and cultured at 28 ℃ and 180 rpm. The pCAMBIA3301-Cry1Ac plasmid was then extracted and stored at -20 ℃.

[0118] (6) Take a portion of the bacterial solution and store it at -80 ℃ with 25% glycerol.

[0119] 3.2 Agrobacterium activation and infection solution preparation

[0120] Agrobacterium with pCAMBIA3301-Cry1Ac was inoculated onto YEB medium containing Kana and incubated in the dark at 28 °C for 24 h until single colonies grew. Single colonies were picked, added to YEB liquid medium containing Kana, and 50 mg / L rifampin was added. The culture was incubated overnight at 28 °C and 180 rpm. The OD of the bacterial culture was measured. 600=0.6-0.8. Antibiotic-containing bacterial suspensions were inoculated into fresh YEB liquid medium at a ratio of 1%-2% (v / v) (bacterial suspension: medium). Simultaneously, 50 mg / L Rif and 500 μmol / L acetylsylgenone were added for secondary activation. The mixture was incubated at 28 ℃ and 200 rpm for approximately 12 h, and the OD of the bacterial suspension was measured. 600 =0.6-0.8.

[0121] 3.3 Preparation and Infection of *Hydrilla verticillata* Stem Tips

[0122] Select robust, sterile stem tips of *Hydrilla verticillata* cultured in a proliferation medium for about 20 days, remove all leaves, cut the stem tips to a length of about 1 cm under a stereomicroscope, and vertically cut the growth cone with a scalpel.

[0123] Add OD to 200 mL 1 / 2 MS liquid medium 600 400 μL of Agrobacterium tumefaciens (0.6-0.8 g) was added to each culture medium, with 15 shoot tips placed in each medium. The cultures were then incubated in a tissue culture room with an average light intensity of 30 μE / (m²·s), a photoperiod of 12 h / d, and a room temperature of 25 ± 1℃. After 14 days, new shoots and leaves appeared in *Hydrilla verticillata* in 1 / 2 MS liquid medium.

[0124] 3.4 Conversion Process Results

[0125] Figure 6 A complete flowchart of Agrobacterium-mediated genetic transformation of *Hydrilla verticillata* is presented. The diagram shows that after 14 days, *Hydrilla verticillata* sprouted new shoots and leaves in 1 / 2 MS liquid medium.

[0126] Example 4: GUS staining verification of transformation of *Hydrilla verticillata*

[0127] After the leaves of *Hydrilla verticillata* emerged, a portion of leaves or stem segments from half of the MS liquid medium were selected for GUS staining verification. Ready-to-use GUS staining solution was purchased from Shanghai Yuanye Biotechnology Co., Ltd. The leaves and stem segments were placed in 48-well plates, and an appropriate amount of GUS staining solution was added to completely submerge them. The plates were then wrapped in aluminum foil and incubated at 37 °C for 24 h. Chlorophyll was removed from the samples using 70% ethanol until the negative control turned white. The samples were then stored in 70% ethanol and photographed using an optical microscope.

[0128] Experimental results:

[0129] Figure 7 Image 10 (×10) shows the stained leaf of *Hydrilla verticillata* under an optical microscope. Figure 7A represents the control group (untransformed) *Hydrilla verticillata* leaf; 7B-7F represent the transformed *Hydrilla verticillata* leaves, with blue indicating GUS-positive expression areas. As can be seen from the figure, the control group (untransformed) *Hydrilla verticillata* leaves turned white after decolorization. Figure 7 A), while the transformed leaves of *Hydrilla verticillata* showed a very obvious blue color, and the blue color appeared in all areas of the leaves. Figure 7 BF).

[0130] Figure 8 These are images of Cry1Ac-transformed *Hydrilla verticillata* stem segments stained under a stereomicroscope. Segments 8A and 8B are *Hydrilla verticillata* stem segments from the control group (untransformed); segments 8C and 8D are *Hydrilla verticillata* stem segments from the transformed group. As can be seen from the images, the *Hydrilla verticillata* stem segments from the control group showed no blue color after destaining. Figure 8 In the transformed *Hydrilla verticillata* stem segments (A, 8B), some only produced a few blue spots. Figure 8 C), some areas have larger blue areas, and all areas have blue ( Figure 8 D). The results showed that the exogenous gene had been successfully transferred into *Hydrilla verticillata* and expressed in leaves and stem segments.

[0131] Example 5: Determination of Cry1Ac protein content in *Hydrilla verticillata*

[0132] 5.1 Extraction of total protein from leaves

[0133] After transforming *Hydrilla verticillata* and staining with GUS, the cells were cultured for 14-21 days, and protein was extracted from the leaves. The protein extraction kit was purchased from Solarbio. 0.1 g of *Hydrilla verticillata* leaves were weighed, placed in liquid nitrogen, and crushed using a tissue homogenizer. 1 mL of lysis buffer was added, and lysis was performed at 4 °C for 20 min, with shaking every 5 min. The mixture was then centrifuged at 14,000 rpm for 30 min at 4 °C. The supernatant was transferred to a new tube, and the extracted protein was stored at -80 °C.

[0134] 5.2 Determination of total protein content

[0135] The total protein content of plant leaves was determined using the BCA protein quantification kit (Nanjing Novizan Biotechnology Co., Ltd.). The specific procedure was as follows: Prepare the BCA working solution. Dilute the protein sample to be tested with deionized water to an appropriate concentration. Take 20 μL of sample and add 200 μL of BCA working solution. After vortexing and mixing, incubate at 37 ℃ for 20-30 min. Measure the absorbance at A562 nm using a microplate reader. Use the absorbance value without BCA as a blank control. Plot a standard curve with protein content (μg) on ​​the x-axis and absorbance value on the y-axis. Calculate the protein content of the sample based on the measured absorbance values.

[0136] Experimental results:

[0137] Figure 9 The results of total protein content in *Hydrilla verticillata* infected with *Agrobacterium* show that the average total protein content of the control group leaves was 4.79 mg / mL, while the average total protein content of *Hydrilla verticillata* leaves infected with *Agrobacterium* (T-Cry1Ac) was 5.25 mg / mL, with no significant difference between the two.

[0138] 5.3 Cry1Ac protein content determination (ELISA)

[0139] The content of Cry1Ac protein in leaves was determined using a plant Bt-Cry1Ac protein ELISA kit (Shanghai Enzyme-Linked Biotechnology Co., Ltd.). The specific procedure is as follows:

[0140] (1) Add 50 μL of standard of different concentration to each standard well, and add 10 μL of the sample to be tested to the sample well first, and then add 40 μL of sample diluent.

[0141] (2) Add 100 μL of horseradish peroxidase (HRP) labeled detection antibody to each well, seal the reaction well with sealing film, and incubate at 37°C for 60 min.

[0142] (3) Discard the liquid, pat dry on absorbent paper, fill each well with washing liquid, let stand for 1 minute, shake off the washing liquid, pat dry, and repeat the washing process 5 times.

[0143] (4) Add 50 μL of substrate to each well and incubate at 37°C in the dark for 15 min.

[0144] (5) Add 50 μL of stop solution to each well and measure the OD value of each well at a wavelength of 450 nm within 15 min.

[0145] (6) Plot a standard curve with OD value on the x-axis and standard concentration on the y-axis, and calculate the sample concentration according to the curve equation.

[0146] Experimental results:

[0147] Figure 10 The results show the Cry1AC protein content of *Hydrilla verticillata* infected with *Agrobacterium*. As can be seen from the figure, the average Cry1Ac protein content in the control group leaves was 0.81 ng / mL, while the average Cry1Ac protein content in the transformed *Hydrilla verticillata* leaves (T-Cry1Ac) was 21.47 ng / mL, significantly higher than that in the control group. Figure 7 ).

[0148] 5.4 Validation of Cry1Ac protein expression (Western blot)

[0149] 5.4.1 Reagent Preparation (Source: Pages 9-10 of the Disclosure Document)

[0150] (1) Extraction buffer: 0.7 M sucrose (119.81 g), 0.5 M Tris HCl (39.4 g), 50 mM EDTA (9.306 g or 50 mL 0.5 M EDTA), 0.1 M KCl (3.728 g), adjust pH to 9.4 with KOH, and bring volume to 500 mL with ddH2O. Add 2% β-mercaptoethanol and 2% protease inhibitor before use.

[0151] (2) 0.1 M NH4Ac: 7.708 g NH4Ac was diluted to 1 L with methanol.

[0152] (3) Coomassie Brilliant Blue R-250 staining solution (1 L): 0.1% (W / V) Coomassie Brilliant Blue R-250 (1 g), 25% (V / V) isopropanol (250 mL), 10% (V / V) glacial acetic acid (100 mL), add 650 mL ddH2O and stir well. After filtering with filter paper, store at room temperature.

[0153] (4) Coomassie brilliant blue decolorizing solution (1 L): 10% (V / V) acetic acid (100 mL), 5% (V / V) ethanol (50 mL), and diluted to 1 L with ddH2O.

[0154] (5) 10× transfer buffer (1 L): 2 M glycine (154 g), 0.25 M Tris (30.3 g), 0.37% SDS (3.7 g), and bring the volume to 1 L with ddH2O. Use 1× transfer buffer (100 mL 10× transfer buffer + 200 mL methanol + 700 mL ddH2O) for transfer.

[0155] (6) 5×TBS (1 L): 100 mM Tris-HCl (pH 7.5) (100 mL 1M Tris-HCl), 2.5 M NaCl (146.1 g), and bring the volume to 1 L with ddH2O. When using, dilute 5 times with ddH2O, then add 0.05% Tween-20 (v / v) and mix well to prepare 1×TBST.

[0156] 5.4.2 Protein Extraction

[0157] (1) Take 100-200 mg of plant leaves, freeze them quickly with liquid nitrogen, grind them with a grinder, add 500 μL of extraction buffer, and vortex.

[0158] (2) After mixing thoroughly, add 500 μL of phenol (take the lower phenol layer) and vortex.

[0159] (3) Centrifuge at 4 ℃ and 13,000 rpm for 10 min, and take 200 μL of supernatant into a new EP tube.

[0160] (4) Add 1 mL of 0.1 M NH4Ac (prepared with methanol) to the EP tube and place at -20 °C for at least 2 h.

[0161] (5) Centrifuge at 4 ℃ and 13,000 rpm for 5 min.

[0162] (6) Wash with 0.1 M NH4Ac (prepared with methanol), blow the protein with a pipette tip, centrifuge at 4°C and 13,000 rpm for 5 min, and discard the supernatant.

[0163] (7) Repeat step 6 until the impurities are washed away.

[0164] (8) After removing the supernatant, empty the EP tube and use a pipette to remove the excess solution.

[0165] (9) Dry the protein at room temperature (about 30 s), and dissolve the protein in 1% SDS (about 100 μL) preheated at 60°C.

[0166] 5.4.3 SDS-PAGE electrophoresis

[0167] (1) Mix each component by inverting it 6-8 times before use.

[0168] (2) Preparation of the lower layer gel: Take equal volumes of Resolver A and Resolver B, 2.7 mL each, and mix well.

[0169] (3) Preparation of the upper layer gel: Take equal volumes of Stacker A and Stacker B, 0.75 mL each, and mix well.

[0170] (4) Add 60 μL of APS to the mixed solution in step (2), mix well immediately, and pour into the gel glass plate, with the liquid level about 1.5 cm from the upper edge of the short glass plate.

[0171] (5) Add 15 μL of APS to the mixed solution in step (3), mix immediately, and gently inject into the glass plate for making the adhesive without waiting for the lower layer of adhesive to solidify. Insert the comb teeth.

[0172] (6) After the glue has solidified, remove the comb teeth.

[0173] (7) After adding the prepared sample to the loading buffer (purchased from Zhongzai Medical), heat it in a 100 ℃ metal bath for 10 min to fully denature the protein. After cooling, load the sample into the SDS-PAGE gel wells, with a loading volume of at least 2 μg (determined according to the protein expression level). At the same time, load 10 μL of protein marker (180 kDa, purchased from Vazyme).

[0174] (8) Set the voltage to 150 V and stop electrophoresis when the bromophenol blue indicator reaches the bottom edge.

[0175] 5.4.4 Transfer and Immunoassay

[0176] (1) Transfer: After electrophoresis, soak the gel in transfer buffer. Prepare a PVDF membrane, cut it to the same size as the gel, mark the front and back corners, soak it in methanol for 10 s, and then soak it in transfer buffer. Soak the filter paper and sponge in transfer buffer as well. Clamp the gel in the following order: blackboard-sponge-filter paper-gel-membrane-filter paper-sponge-whiteboard, transfer the membrane at 90 V for 1 h on ice.

[0177] (2) Washing the membrane: Wash the membrane with TBST for 2 min.

[0178] (3) Blocking: Block the membrane in 5% blocking buffer (5% skim milk powder, dissolved in 1×TBST) for 1 h at 40 rpm.

[0179] (4) Incubate primary antibody: Dilute the primary antibody (purchased from Abmart) with 5% skim milk powder at a ratio of 1:3000, and incubate it with the membrane at room temperature for 1.5-2 hours, or overnight at 4°C.

[0180] (5) Washing the membrane: Wash the membrane 3 times with TBST, 10 min each time.

[0181] (6) Sealing: Seal with 5% skim milk for 30 min.

[0182] (7) Incubation of secondary antibody: Dilute HRP-labeled secondary antibody (purchased from Abmart) with 5% skim milk powder at a ratio of 1:3000 and incubate with the membrane at room temperature for 1.5 h.

[0183] (8) Washing the membrane: Wash the membrane 3 times with TBST, 10 min each time.

[0184] (9) Color development: Prepare ECL reaction solution (purchased from Vazyme, A:B=1:1, take 500 μL of each and add to a 1.5 ml EP tube. When adding, be careful to change the pipette tip to avoid contamination. Mix well before use). Mix the reaction solution evenly and spread it on the front of the membrane. Treat in the dark for two minutes and display the results using AI600.

[0185] Experimental results:

[0186] Proteins were extracted from three control group *Hydrilla verticillata* and nine transformed *Hydrilla verticillata* (T-Cry1Ac) samples, and Western blot analysis was performed. The results are as follows: Figure 11 As shown in the figure, seven samples in the transformation group exhibited specific bands at a molecular weight of approximately 40 kDa, while the control group showed no obvious bands. These results indicate that the Cry1Ac protein was successfully expressed in *Hydrilla verticillata*.

[0187] Example 6: Toxicity determination of transformed *Hydrilla verticillata* to larvae of *Spodoptera litura*.

[0188] 6.1 Test Insects

[0189] Larvae and adults of the small tube moth were collected from ponds around Wuhan, Hubei Province. After the larvae emerged as adults, they were fed and placed in plastic boxes covered with gauze to prevent escape. The plastic boxes were filled with an appropriate amount of water and *Hydrilla verticillata* for the larvae to feed on and lay eggs. They were then placed in an incubator and cultured at 28℃±1℃ until the egg masses hatched. The experiment was conducted 3-5 days after the larvae began feeding.

[0190] 6.2 Methods for determining toxicity

[0191] Larvae of good growth and uniform age were selected for toxicity testing. 200 mL of water was poured into tissue culture bottles, and 10 small tube moth larvae were added to each bottle. Sterile *Hydrilla verticillata* (control group) and *Hydrilla verticillata* transformed with Cry1Ac (experimental group) were then added for feeding. The experiment was performed in triplicate. Larval growth and survival rates were recorded daily for 7 consecutive days, and the feeding of *Hydrilla verticillata* was observed. Mortality was defined as the larvae remaining motionless when touched with a brush.

[0192] 6.3 Experimental Results:

[0193] Figure 12 The survival rate of *Hydrilla verticillata* larvae fed on Cry1Ac for 7 days was shown in the figure. As can be seen from the figure, after 7 days, the survival rate of *Hydrilla verticillata* larvae fed on Cry1Ac was significantly lower than that of the control group. The survival rate in the experimental group was 56.67%, while the survival rate in the control group was 86.67%. These results indicate that the Cry1Ac protein expressed by *Hydrilla verticillata* has a significant toxic effect on *Hydrilla verticillata* larvae.

[0194] Based on the results of the above embodiments, it is evident that transforming *Hydrilla verticillata* with the recombinant expression vector pCAMBIA3301-Cry1Ac constructed in Example 2 according to the method in Example 3, as verified in Examples 4-6, yields *Hydrilla verticillata* expressing the Cry1Ac protein and exhibiting resistance to *Salmonella spp.* This vector can serve as an effective tool for genetic engineering improvement of *Hydrilla verticillata*, and can also be used for genetic transformation research on other submerged plants or monocotyledonous plants.

[0195] The present application has been described in detail above. Specific examples have been used to illustrate the principles and implementation methods of the present application. The descriptions of the embodiments above are only for the purpose of helping to understand the present application and its core ideas. It should be noted that those skilled in the art can make several improvements and modifications to the present application without departing from the principles of the present application, and these improvements and modifications also fall within the protection scope of the claims of the present application.

Claims

1. A method for the instantaneous transformation of *Hydrilla verticillata*, comprising the following steps: (1) Sterile seedling culture: After disinfection, the explants of *Hydrilla verticillata* were inoculated into a sterile bud induction medium to obtain sterile seedlings; (2) Expression vector construction: The codon-optimized Cry1Ac gene was cloned into the pCAMBIA3301 plant expression vector to obtain the recombinant expression vector pCAMBIA3301-Cry1Ac; (3) Agrobacterium-mediated transformation: The recombinant expression vector pCAMBIA3301-Cry1Ac was introduced into Agrobacterium, and the resulting recombinant Agrobacterium was used to infect the stem tip of the sterile seedling of *Hydrilla verticillata* obtained in step (1), and *Hydrilla verticillata* was obtained through co-culture.

2. According to the method of claim 1, in step (2), the nucleotide sequence of the codon-optimized Cry1Ac gene is as shown in SEQ ID NO:

8.

3. According to the method of claim 1, in step (2), the recombinant expression vector pCAMBIA3301-Cry1Ac further comprises a maize Ubi promoter, the Ubi promoter drives the expression of the Cry1Ac gene, and the nucleotide sequence of the recombinant expression vector pCAMBIA3301-Cry1Ac is shown in SEQ ID NO:

9.

4. According to the method of claim 1, in step (1), the aseptic bud induction medium is MS medium, with 3% sucrose, 0.5 mg / L 6-aminopurine, 0.1 mg / L naphthaleneacetic acid added, and pH 5.8-6.0; the explant is the stem tip or bud segment of *Hydrilla verticillata*.

5. According to claim 1, in step (3), the Agrobacterium is strain EHA105; the infection conditions are: Agrobacterium bacterial suspension concentration OD 600 =0.6-0.8, co-culture time was 14 days, co-culture temperature was 25±1℃, photoperiod was 12 h / d, and light intensity was 30 μE / (m²·s).

6. According to the method of claim 1, in step (3), before the infection, the leaves of the stem tip of *Hydrilla verticillata* are peeled off and cut to a length of 1 cm, and the growth cone is treated with wound treatment.

7. A recombinant expression vector, wherein the recombinant expression vector is pCAMBIA3301-Cry1Ac, which contains a maize Ubi promoter and a codon-optimized Cry1Ac gene, the nucleotide sequence of the codon-optimized Cry1Ac gene is shown in SEQ ID NO:8, and the nucleotide sequence of the recombinant expression vector is shown in SEQ ID NO:

9.

8. The application of the transformed *Hydrilla verticillata* obtained by any one of claims 1-6 in the control of *Spodoptera litura*.

9. A method for controlling the pest of Hydrilla verticillata and the small tube borer, comprising planting transformed Hydrilla verticillata obtained according to any one of the methods described in claims 1-6, and using the Cry1Ac protein expressed by the transformed Hydrilla verticillata to kill the small tube borer larvae.

10. The use of the recombinant expression vector according to claim 7 in the preparation of transgenic *Hydrilla verticillata*.

Images