A high geraniol tea tree molecular marker, marker primer, kit and application and identification method thereof
By developing molecular markers based on MITE insertion and deletion structural variations in the CsTPS15 gene promoter region, and using PCR amplification fragment length to distinguish high-geraniol tea germplasm, the problem of identification difficulties in existing technologies has been solved, enabling rapid and accurate germplasm identification and early screening, and improving the efficiency of tea breeding.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- NORTHWEST A & F UNIV
- Filing Date
- 2026-04-24
- Publication Date
- 2026-06-19
Smart Images

Figure CN122235356A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular biology, specifically relating to a molecular marker, marker primer, reagent kit, and its application and identification method for a high-geraniol tea plant. Background Technology
[0002] tea tree( Camellia sinensis Tea is one of the world's most important economic crops, and its processed products are highly favored by consumers for their unique aroma and flavor. The aroma of tea is composed of a variety of volatile compounds, among which monoterpenes play a crucial role in the formation of floral tea aromas. Geraniol is a typical monoterpene alcohol aroma compound with a fresh rose fragrance and is one of the important characteristic aroma components in many high-quality teas. Therefore, screening and cultivating tea germplasm resources with high geraniol content is of great significance for the breeding of high-quality, highly aromatic tea varieties.
[0003] Currently, the evaluation of aroma quality traits in tea mainly relies on volatile component detection techniques, such as gas chromatography-mass spectrometry (GC-MS). While these methods can accurately determine the content of volatile compounds like geraniol, they typically require harvesting fresh tea leaves and undergoing complex sample processing and instrumental analysis, resulting in a long testing cycle and high costs. The identification results are easily affected by multiple factors, including the cultivation environment, necessitating repeated testing. Furthermore, tea is a perennial woody plant with a long breeding cycle; from hybridization to variety identification, it often takes more than ten years. Relying solely on mature plants for aroma component determination would significantly reduce breeding efficiency.
[0004] With the development of molecular biology and genomics technologies, molecular marker technologies based on DNA polymorphism have been widely used in crop germplasm identification and molecular-assisted breeding. Among them, insertion-deletion (InDel) structural variations caused by transposon insertions have attracted widespread attention in crop genetic research due to their high stability and ease of detection. Miniature inverted transposons (MITEs) are a common type of transposon element, and their insertions can often affect gene expression, thereby leading to phenotypic differences.
[0005] By identifying genetic loci closely associated with target traits and developing molecular markers, target traits can be predicted and screened during the seedling or early growth stages, significantly improving breeding efficiency. However, current research on molecular markers for the geraniol content trait in tea is still relatively limited, especially the lack of stable molecular markers for rapidly identifying high-geraniol tea germplasm. Therefore, developing a molecular marker that can rapidly and accurately identify high-geraniol tea germplasm is of great significance for improving the breeding efficiency of high-aroma tea varieties and accelerating the screening and utilization of high-quality germplasm resources. Summary of the Invention
[0006] To address the aforementioned technical problems, this invention provides a molecular marker, marker primer, reagent kit, and its application and identification method for high-geraniol tea plants.
[0007] A molecular marker for identifying geraniol content in tea plants, the sequence of which is shown in SEQ ID NO.1; tea plant material with the molecular marker is a high-geraniol material.
[0008] SEQ ID NO.1 is: GTGGTGTTTTGGGAAGTTGGTTCCCAAATTTTTTTCTCATTTTTTTCACTAAAAGATAAAAGTTTTGCAAAACCAAAAAAAAACACATCCAAACAAAATATCACATTCAACCCCATAATCATTTCACTTTTTCTCTCACAAACATCACATCCAACCACATAAAAACTCAACTATCTTCCCAAACACCAAAATTTTTTTATCTCATAAAAACCTACATCTACTAAAATCTACATAAAAACTCACTTCCCAAACACCATCTAAG.
[0009] This invention compares the genome sequences of tea plant materials with different geraniol contents and finds that the high geraniol tea plant material has a 261 bp MITE transposon insertion sequence in the promoter region of the CsTPS15 gene, while the ordinary tea plant material lacks this sequence at this position. This MITE insertion forms a stable insertion-deletion structural variation and is significantly correlated with the geraniol content of tea plants.
[0010] Based on this structural variation site, the present invention designs specific PCR primers to amplify DNA fragments containing the MITE insertion site, and distinguishes different genotypes based on the difference in the length of the PCR amplification products, thereby achieving rapid identification of high-aroma chlorophyll tea germplasm.
[0011] The marker primers used to identify the geraniol content in tea plants have nucleotide sequences as shown in SEQ ID NO.2~SEQ ID NO.3.
[0012] A kit comprising the labeled primers described above.
[0013] The application of the aforementioned marker primers in identifying geraniol content in tea plants.
[0014] A method for identifying the geraniol content in tea plants includes the following steps: Using the DNA of the tea plant genome as a template, PCR amplification was performed using the labeled primers to obtain PCR products; Detecting the length of PCR amplification products; If a 422bp electrophoretic band is obtained, the geraniol content in the tea plant is high; if a 116bp electrophoretic band is obtained, the geraniol content in the tea plant is low.
[0015] Preferably, each 25 μL of the PCR amplification system consists of: 50 ng template DNA, 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, 12.5 μL of 2X Apex HF FS PCR Master Mix, and the remainder is sterile water.
[0016] Preferably, the PCR amplification conditions are as follows: 94℃ pre-denaturation for 30 s; 98℃ denaturation for 10 s, 55℃ annealing for 15 s, 72℃ extension for 20 s, repeated for 35 cycles; 72℃ extension for 5 min, and storage at 12℃.
[0017] The application of the marker primers in the breeding of highly aromatic tea varieties.
[0018] Compared with the prior art, the beneficial effects of the present invention are as follows: (1) Molecular markers developed using structural variations formed by MITE insertion of the CsTPS15 promoter exhibit high stability; (2) The detection method is simple, requiring only PCR amplification to complete the identification; (3) Testing can be conducted during the tea seedling stage to achieve early screening of superior materials; (4) Applicable to identification of tea germplasm resources and molecular marker-assisted breeding. Attached Figure Description
[0019] Figure 1 This is a schematic diagram of the CsTPS15 gene structure and the MITE insertion site.
[0020] Figure 2 The results of sequence alignment of the CsTPS15 promoter region for different tea plant materials.
[0021] Figure 3 Electrophoresis diagrams for molecular marker PCR detection of different tea plant resources.
[0022] Figure 4 Geraniol content of different tea tree resources. Detailed Implementation
[0023] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods.
[0024] The different tea tree varieties involved in the various embodiments of this invention include: The samples included: ZMD, Purple Peony; HJG, Golden Osmanthus; JX, Golden Xuan; JGY, Golden Guanyin; HGY, Yellow Guanyin; SCZ, Shucha Zao; LJCY, Longjing Changye; TGY, Tieguanyin; YS, Yingshuang; WNZ, Wuniuzao; FDDB, Fuding Dabai; YC1, Yuncha No. 1; YC8, Yuncha No. 8; YK37, Yunkang No. 37; MHDY, Menghai Daye; CYBH, Changye Baihao; ZJ, Zijuan; YCPR, Yuncha Purui; BMC, Baimaocha; DLC, Dali Tea.
[0025] Example 1: Screening and Geraniol Content Determination of High Geraniol Tea Tree Materials Zijuan and Shuchazao tea germplasm resources with different genetic backgrounds were selected as materials. Fresh leaf samples with one bud and two leaves were collected from each material, quick-frozen in liquid nitrogen, and stored at −80℃ for later use.
[0026] The geraniol content in fresh tea leaves was determined using gas chromatography-mass spectrometry (GC-MS). The specific steps are as follows:
[0027] (1) Grind the fresh leaf samples into powder and add organic solvent to extract volatile components; (2) The extract was centrifuged and filtered; (3) Inject the sample into the GC-MS system for separation and detection; (4) Establish a quantitative curve based on geraniol standard and calculate the geraniol content in each sample.
[0028] The test results showed that there was a significant difference in geraniol content between Ziju and Shuchazao, with Shuchazao having a significantly higher geraniol content than Ziju, and it can be used as a high-geraniol germplasm material for subsequent analysis.
[0029] Example 2: Discovery and Cloning Verification of Differential Sequences of the TPS15 Promoter 1. Analysis of tea tree genome data (Shucha Zao and Zijuan) revealed that the TPS15 promoter in Shucha Zao contains a 261 bp transposon sequence, while the TPS15 promoter in the low-amyrin Zijuan tea tree does not contain this 261 bp insertion sequence. Figure 1 ).
[0030] 2. Cloning and Validation of CsTPS15 Promoter Region Structural Variations: Genomic DNA was extracted from each tea plant material in Example 1. DNA extraction was performed using a modified CTAB method, and the main steps are as follows:
[0031] (1) Take about 100 mg of fresh leaf tissue and grind it thoroughly in liquid nitrogen; (2) Add CTAB extraction buffer and incubate in a 65°C water bath; (3) Proteins were removed by chloroform / isoamyl alcohol extraction; (4) Precipitate DNA with isopropanol and wash with 70% ethanol; (5) Dissolve the DNA and detect its concentration.
[0032] Using the CsTPS15 gene promoter region as the target sequence, PCR amplification and sequencing analysis were performed on different tea plant materials. Sequence alignment results showed that a 261 bp miniature inverted repeat transposon (MITE) insertion sequence was indeed present in the CsTPS15 promoter region of Gaoxiangyechunshu tea, while ordinary materials lacked this sequence at this position, thus forming a stable insertion-deletion (InDel) structural variation.
[0033] Example 3: Molecular Marker Development PCR primers were designed based on the conserved sequences flanking the MITE insertion site in the CsTPS15 promoter region. Figure 2 The primer sequences are as follows:
[0034] Forward primer P1: 5'-CATCGGAAAGAAAGGCATGGT-3', denoted as SEQ ID NO.2; Reverse primer P2: 5'-TATTTTCACCATTTCTTGTCT-3', denoted as SEQ ID NO.3.
[0035] The primers can amplify DNA fragments containing the MITE insertion site.
[0036] When the sample genome contains the MITE insert sequence, the PCR amplification fragment is 422 bp; when the sample genome does not contain this insert sequence, the PCR amplification fragment is approximately 161 bp. Figure 3 ).
[0037] Therefore, different genotypes can be quickly distinguished by amplifying the difference in fragment length.
[0038] Example 4: Molecular marker PCR detection method The primer pair designed in Example 3 was used to perform PCR detection on tea plant samples.
[0039] The PCR reaction system (25 μL) is as follows: Template DNA: 50 ng; Forward primer (10 μM): 1 μL; Reverse primer (10 μM): 1 μL; 2X ApexHF FS PCR Master Mix: 12.5 μL; Add sterile water to a final volume of 25 μL.
[0040] The PCR reaction procedure is as follows: 94℃ pre-denaturation for 30 s, 98℃ denaturation for 10 s, 55℃ annealing for 15 s, 72℃ extension for 20 s, repeat steps 2–4 for a total of 35 cycles, 72℃ extension for 5 min, and store at 12℃.
[0041] The PCR amplification products were detected by electrophoresis on a 2% agarose gel.
[0042] Example 5: Validation of Molecular Marker Effectiveness The molecular markers described above were used to detect the geraniol content of the tea germplasm materials, and GC-MS was used to determine the geraniol content of the tea germplasm materials to verify the accuracy of the method of the present invention.
[0043] The results show that ( Figure 3 In high-geraniol materials, a 422 bp amplified fragment was detected; in ordinary materials, only about 161 bp amplified fragment was detected. Statistical analysis results showed that this molecular marker was significantly correlated with geraniol content. Figure 4 ).
[0044] It should be noted that when numerical ranges are mentioned in the claims of this invention, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, the present invention describes preferred embodiments.
[0045] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.
[0046] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.
Claims
1. A molecular marker for identifying geraniol content in tea plants, characterized in that, The sequence of the molecular marker is shown in SEQ ID NO.1; The tea plant material with the aforementioned molecular marker is a high-geraniol material.
2. A marker primer for identifying the geraniol content in tea plants, characterized in that, The nucleotide sequences of the labeled primers are shown in SEQ ID NO.2~SEQ ID NO.
3.
3. A kit comprising the labeled primers of claim 2.
4. The application of the marker primers according to claim 2 in identifying the geraniol content in tea plants.
5. A method for identifying the geraniol content in tea plants, characterized in that, Includes the following steps: Using tea plant genome DNA as a template, PCR amplification reaction was performed using the marker primers described in claim 2 to obtain PCR products; Detecting the length of PCR amplification products; If a 422bp electrophoretic band is obtained, the geraniol content in the tea plant is high; if a 116bp electrophoretic band is obtained, the geraniol content in the tea plant is low.
6. The method according to claim 5, characterized in that, The PCR amplification system for each 25 μL volume consists of: 50 ng template DNA, 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, 12.5 μL of 2X Apex HF FSPCR Master Mix, and the remainder is sterile water.
7. The method according to claim 6, characterized in that, The PCR amplification conditions were as follows: 94℃ pre-denaturation for 30 s; 98℃ denaturation for 10 s, 55℃ annealing for 15 s, 72℃ extension for 20 s, repeated for 35 cycles; 72℃ extension for 5 min, and storage at 12℃.
8. The application of the marker primers described in claim 2 in the breeding of highly aromatic tea varieties.