A single-cell sequencing kit and detection method based on PIP-seq technology
By using an adjustable osmotic pressure single-cell sequencing kit and a high-concentration proteinase K and Klenow exo-two-chain synthesis system, the osmotic pressure adaptability problem in existing aquatic organism sequencing technologies has been solved, enabling high-fidelity sequencing of live cells from marine and freshwater organisms and improving the integrity and flexibility of sequencing.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- ZHEJIANG UNIV
- Filing Date
- 2026-05-21
- Publication Date
- 2026-06-23
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
(I) Technical Field
[0002] This invention belongs to the field of single-cell transcriptomics and molecular biology technology, specifically relating to a single-cell sequencing microparticle, sequencing method, and matching reagent kit that is based on a deeply improved particle templated instantaneous partitioning (PIP-seq) technology, with flexibly adjustable osmotic pressure suitable for live cells of freshwater and marine organisms. (II) Background Technology
[0004] Single-cell RNA sequencing (scRNA-seq) technology plays an irreplaceable role in revealing the microscopic heterogeneity of life. However, existing single-cell sequencing platforms and standard PIP-seq technology face a series of insurmountable technical obstacles when dealing with aquatic biological samples with extremely large osmotic pressure differences.
[0005] For marine organisms (such as cnidarians, sea squirts, and echinoderms), their tissues are constantly exposed to high salinity and high osmotic pressure (approximately 1000 mOsm / kg), and are rich in highly cross-linked collagen networks and complex polysaccharide mucus. Conventional cell dissociation solutions and oil-water mixed-phase systems based on isotonic buffers (approximately 300 mOsm / kg) are inadequate for these extreme physicochemical conditions: hypotonic buffers easily cause living cells to absorb water, swell, and rupture, and the release of cell contents further disrupts the stability of emulsion droplets, leading to compartmental collapse. Similarly, the osmotic pressure of body fluids in many freshwater organisms (such as freshwater hydras, certain mollusks, and fish gill epithelium) is significantly lower than the isotonic level of mammals, even below 200 mOsm / kg. The standard phosphate buffer system used in commercially available kits has a high osmotic pressure, causing freshwater cells to lose water, shrink, suffer membrane damage, or exhibit stress responses, which also severely impairs cell viability and the authenticity of transcripts.
[0006] Due to the aforementioned technical limitations, current single-cell sequencing of aquatic organisms almost universally employs pre-fixation of samples using chemical reagents such as methanol. However, the fixation process introduces RNA cross-linking and degradation, leading to the significant loss of highly sensitive and fragile special cell populations (such as stinging cells, some immune cells, and progenitor cells). This results in severely distorted cell maps reconstructed through sequencing, failing to reflect the true living state of the cells. Furthermore, conventional cell lysis, reverse transcription, and second-strand synthesis systems exhibit low amplification efficiency when faced with nucleic acid templates containing high levels of mucopolysaccharides and complex secondary structures, failing to effectively synthesize full-length cDNA.
[0007] In summary, there is an urgent need in this field for a high-fidelity single-cell sequencing method, microparticle carrier, and complete reagent system that can break free from the "fixed" limitation and adapt to real living cells of marine and freshwater organisms by actively adjusting osmotic pressure. (III) Summary of the Invention
[0009] To overcome the shortcomings of existing technologies that rely on chemical fixation and cannot flexibly adjust osmotic pressure, resulting in high library construction failure rates and severe cell type loss in live cell sequencing of marine and freshwater organisms, this invention provides a single-cell sequencing kit and its application that can adjust osmotic pressure and is suitable for live cells of freshwater / marine organisms.
[0010] The technical solution adopted in this invention is:
[0011] This invention provides an adjustable osmotic pressure single-cell sequencing kit based on PIP-seq technology. The kit includes covalently coupled microparticles with complete barcodes, single-cell digestion solution, single-cell encapsulation buffer, emulsified oil, oil-breaking agent, TESDS reagent, TET reagent, reverse transcription reagent, SPI magnetic beads, second-strand synthesis reagent, cDNA amplification reagent, and library construction and sequencing reagent.
[0012] The covalently coupled microparticles with complete barcodes refer to microspheres whose surface is covalently coupled with cell barcodes, molecular identifiers, and polyT sequences, with a particle size of 35-45 μm. The synthesis of covalently coupled microparticles with complete barcodes is based on the article entitled "Modular barcode beads for microfluidic single cell genomics" published by Cyrille L. Delley et al. in 2021.
[0013] The single-cell digestion solution is divided into a high-osmotic-pressure digestion solution for marine tissues and a low-osmotic-pressure digestion solution for freshwater tissues. The final concentration of the high-osmotic-pressure digestion solution is: 0.02 g / mL cysteine hydrochloride, 10-40 μg / mL Liberase, 10-40 μg / mL Dispase, pH 8.0, and the solvent is a mixture of artificial seawater and ultrapure water (MQ water) at a volume ratio of 6:4, with MQ water added to adjust the osmotic pressure to 850-950 mOsm / kg. The final concentration of the low-osmotic-pressure digestion solution is: 5-20 μg / mL Dispase, and the solvent is a mixture of PBS buffer (pH 7.5) and MQ water at a volume ratio of 1:9, with MQ water added to adjust the osmotic pressure to 25-35 mOsm / kg.
[0014] The single-cell encapsulation buffer is divided into a high-osmotic-pressure encapsulation buffer for marine tissues and a low-osmotic-pressure encapsulation buffer for freshwater tissues. The final concentration of the high-osmotic-pressure encapsulation buffer is: 60-100 U / mL proteinase K, 50-80 mM dithiothreitol (DTT), with 3.3-3.5×DPBS buffer as the solvent, and an osmotic pressure of 950-1030 mOsm / kg. The final concentration of the low-osmotic-pressure encapsulation buffer is: 15-45 U / mL proteinase K, 50-80 mM DTT, with 0.05-0.2×DPBS buffer as the solvent, and an osmotic pressure of 25-35 mOsm / kg.
[0015] The emulsified oil consists of: 1% by mass of a fluorinated surfactant, and the solvent is a fluorinated liquid;
[0016] The oil-breaking agent is 1H,1H,2H,2H-perfluorooctyltrichlorosilane;
[0017] The final TESDS reagent composition is: 10 mM EDTA (ethylenediaminetetraacetic acid), 0.1% SDS (sodium dodecyl sulfate), and the solvent is 10 mM Tris buffer at pH 7.5.
[0018] The final concentration of the TET reagent consists of 10 mM EDTA, 0.1% Tween, and the solvent is 10 mM Tris buffer at pH 7.5.
[0019] The reverse transcription reagent has the following mass concentration composition: 4.8% polyethylene glycol 8000, 4% polysucrose Ficoll PM400, 1 mM dNTPs, 1 U / µL RNase inhibitor and 1 U / µL reverse transcriptase;
[0020] The final concentration composition of the second-chain synthetic reagent is: Klenow exo - 500 U / mL, 10 μM random primers and 1 mM dNTPs;
[0021] The cDNA amplification reagent consists of: universal primers and a high-fidelity DNA polymerase premix;
[0022] Library construction and sequencing reagents consist of i5 / i7 primers and a high-fidelity DNA polymerase premix.
[0023] Furthermore, the final concentration composition of the high osmotic pressure digestion solution is: 0.02 g / mL cysteine hydrochloride, 20 μg / mL Liberase, 20 μg / mL Dispase, pH 8.0, and the solvent is a mixture of artificial seawater and MQ water in a volume ratio of 6:4, with MQ water added to adjust the osmotic pressure to 980 mOsm / kg.
[0024] Furthermore, the low-osmolarity digestion solution consists of: 10 μg / mL Dispase, pH 8.0, and a solvent of PBS buffer (pH 7.5) at a volume ratio of 1:9 and MQ water, with MQ water added to adjust the osmolarity to 30 mOsm / kg.
[0025] Furthermore, the final concentration of the high-osmolarity encapsulation buffer is composed of: 80 U / mL proteinase K, 70 mM dithiothreitol (DTT), and 3.3×DPBS buffer as the solvent, with an osmolarity of 980 mOsm / kg.
[0026] Furthermore, the final concentration of the low osmotic pressure encapsulation buffer is composed of: 29 U / mL proteinase K, 70 mM DTT, 0.1×DPBS buffer as solvent, and osmotic pressure of 30 mOsm / kg.
[0027] Furthermore, the reverse transcription reagent has the following mass concentration composition: 4.8% PEG8000 (polyethylene glycol 8000), 4% Ficoll PM400 (polysaccharide), 1 mM dNTPs (NEB), 1 U / µL RNase inhibitor and 1 U / µL reverse transcriptase (Thermo Fisher, Maxima H-minus EP0751).
[0028] Furthermore, the random primer sequence for the second-strand synthesis reagent is TCAGACGTGTGCTCTTCCGATCTNNNNNNNNN (SEQ ID NO.1), where N represents A / T / C / G.
[0029] Furthermore, the universal primer sequences in the cDNA amplification reagent are: CTCTTTCCCTACACGACGCTC (SEQ ID NO.2) and TCAGACGTGTGCTCTTCCGATCT (SEQ ID NO.3).
[0030] Furthermore, the primer sequences in the library construction and sequencing reagent are: ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO.4) and CAAGCAGAAGACGGCATACGAGATAGGCTATAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO.5).
[0031] The present invention also provides a method for detecting single cells of freshwater / marine organisms using the aforementioned kit, the method comprising the following steps:
[0032] (1) Cell dissociation: Take the freshwater / marine biological tissue to be tested, digest it with single-cell digestion solution at 28°C for 45 minutes, and filter to obtain single cells;
[0033] (2) Single cell encapsulation: Resuspend the single cells from step (1) in single cell encapsulation buffer, add covalently coupled microparticles with complete barcodes, mix, add emulsified oil, and shake horizontally at 3000 rpm for 30 s and vertically for 90 s to generate PIP droplets.
[0034] (3) Sequence capture, reverse and second-strand synthesis: The mixture from step (2) was incubated at 65°C for 45 minutes to release mRNA and capture it by microparticles; an oil-breaking agent was added, and the mixture was shaken at 3000 rpm for 30 seconds. After short-term centrifugation, the aqueous and oil phases outside the microparticles were discarded; the microparticles were washed with TESDS and TET reagents in sequence, and the microparticles were collected for reverse transcription using a reverse transcription reagent; after reverse transcription, the excess primers were removed by treating with Exo I at 37°C for 20 minutes, and the primers were inactivated at 80°C for 15 minutes; after washing with TESDS and TET reagents in sequence, a second-strand synthesis reagent was added, and the mixture was incubated at 25°C for 30 minutes and at 37°C for 60 minutes.
[0035] (4) Amplification and sequencing: The reaction solution in step (3) was washed with 0.01M KOH aqueous solution and purified with 1.8×SPI magnetic beads. The whole transcriptome was amplified with cDNA amplification reagent, the product was purified and quantified; the amplification product was taken and PCR reaction was performed with library construction and sequencing reagent. <200 bp fragments were removed with 0.9×SPI magnetic beads. After the library passed the quality inspection, it was mixed in equimolar amounts and the paired-end 150 bp sequencing was performed on the NovaSeq 6000 platform.
[0036] Further, in step (2), the volume of the single-cell digestion solution is 3-8 mL / g (preferably 5 mL / g) based on the mass of the tissue to be tested; the volume ratio of the cell suspension to the microparticles is 1:3-5 (preferably 1:4), and the volume ratio of the cell suspension to the emulsified oil is 1:20-35 (preferably 1:28); in step (3), the volume ratio of the oil-breaking agent, reverse transcription reagent, and second-strand synthesis reagent to the cell suspension in step (2) is 3-8:1 (preferably 5:1); in step (4), the volume ratio of the cDNA amplification reagent and the library construction and sequencing reagent to the cell suspension in step (2) is 3-8:1 (preferably 5:1).
[0037] Furthermore, the reverse transcription reaction program is as follows: 42℃ for 90 min, 10 cycles: 42℃ for 90 s; 50℃ for 90 s; 72℃ for 5 min.
[0038] Furthermore, the cDNA amplification program is as follows: 98℃ for 3 min; 95℃ for 30 s, 60℃ for 40 s, 72℃ for 1 min, 11-14 cycles; 72℃ for 2 min.
[0039] Furthermore, the PCR reaction program is as follows: 98℃, 3 min; 95℃, 30 s; 60℃, 40 s; 72℃, 1 min, 7-9 cycles; 72℃, 2 min.
[0040] This invention's kit introduces both high-osmolarity and low-osmolarity digestion solutions, enabling covalently coupled microparticles with intact barcodes to resist hydrolysis or structural damage caused by high-salt, low-salt, and drastic osmotic pressure changes. This invention abandons conventional digestion solutions, selecting tissue digestion solutions based on the osmotic pressure of the target species' body fluids. For marine organisms, artificial seawater and ultrapure water are mixed in a specific ratio (55%–65% artificial seawater by volume), with 0.02 g / mL cysteine hydrochloride added as the base solvent. For freshwater organisms, PBS buffer (osmolarity 150–250 mOsm / kg) is mixed with ultrapure water in a specific ratio as the base solvent. The digestion solution, combined with Liberase and Dispase II (Dispase is added for marine organisms), is used for digestion at pH 8.0 to obtain a high-viability single-cell suspension.
[0041] This invention selects encapsulation buffers with different osmotic pressures based on the cell source. Concentrated DPBS basal solution is used, and an osmotic pressure regulator is added to precisely adjust the osmotic pressure of the final mixed buffer within the range of 200–1100 mOsm / kg. This high / low osmotic pressure replicates the original body fluid environment of the cells, ensuring that live cells maintain their morphology and do not rupture before and after entering the oil-water instantaneous partitioning.
[0042] This invention involves injecting a lysis buffer containing an extremely high concentration of proteinase K (final concentration 60-100 U / mL) into an instantaneous partition. The high concentration of proteinase K can instantly degrade matrix proteins and mucus, and completely inactivate endogenous RNases, while not damaging free mRNA, ensuring complete RNA release even under hypertonic or hypotonic conditions.
[0043] Compared with existing fixed-cell sequencing or standard PIP-seq technology, the advantages of this invention are mainly reflected in:
[0044] (1) Completely break the dependence on cell fixation and realize in situ capture of freshwater / marine live cells: Through the use of an adjustable osmotic pressure encapsulation buffer and a non-toxic digestion system, high-throughput sequencing of unfixed marine hypertonic live cells and freshwater hypotonic live cells was achieved for the first time, and the retention rate of sensitive cell populations (such as stinging cells, freshwater ion-regulating cells, etc.) was increased several times.
[0045] (2) The quantity and quality of transcripts detected have increased dramatically: extremely high concentrations of proteinase K and the original novel Klenow exo -The combined use of the two-strand synthesis system significantly eliminates amplification inhibition caused by mucus, matrix, and secondary structures. The median gene count per cell (UMI) is 1-2 times higher than with conventional fixation methods, resulting in accurate UMI counting and a more complete cell atlas.
[0046] (3) Flexible operation and wide range of applications: Only the buffer formulation and digestive enzyme components need to be changed to seamlessly switch between marine and freshwater samples without changing the core reaction process. The kit is highly versatile and has successfully solved the osmotic barrier problem that has long plagued the field of aquatic biology. (iv) Description of the attached drawings
[0048] Figure 1 The flowchart of the single-cell sequencing method with adjustable osmotic pressure of the present invention is as follows: A, cell dissociation step; b, single-cell encapsulation step; c, sequence capture, reversal and two-strand synthesis.
[0049] Figure 2 The images shown are microscopic quality control images of the particles of this invention (size control, polyT concentration control). The left image represents a bright-field microscopic image of the particles of this invention, and the right image represents a microscopic image after incubation with the FAM-PolyA probe and the particles.
[0050] Figure 3 This is a UMAP image of the marine organism Staghorn Coral from Example 1.
[0051] Figure 4 The image shows the UMI distribution of various cell types in the marine organism Staghorn Coral (Example 1).
[0052] Figure 5 This is a heatmap of the marine organism Staghorn Coral from Example 1.
[0053] Figure 6 This is a UMAP diagram of the freshwater organism hydra from Example 2.
[0054] Figure 7 This is a heatmap of the freshwater organism hydra in Example 2. (V) Detailed Implementation Methods
[0056] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:
[0057] The artificial seawater described in this embodiment of the invention consists of 33g of sea salt dissolved in 1L of MQ water. MQ water refers to ultrapure water with a resistivity as high as 18.2 MΩ·cm, and contains almost no impurities, ions, or microorganisms.
[0058] The synthesis of the covalently coupled microparticles with complete barcodes used in this invention is based on the article published in 2021 by Cyrille L. Delley et al. (Delley, CL, Abate, AR Modular barcode beads for microfluidic single cell genomics). Sci Rep 11, 10857 (2021). https: / / doi.org / 10.1038 / s41598-021-90255-x).
[0059] The FAM-PolyA probe sequence is: FAM (fluorescent label)-AAAAAAAAAAAAAAA (SEQ ID NO. 6).
[0060] Example 1: Adjustable Osmoothness Single-Cell Sequencing Kit Based on PIP-seq Technology
[0061] 1. Kit Components
[0062] The PIP-seq-based adjustable osmolarity single-cell sequencing kit consists of covalently coupled microparticles with complete barcodes, single-cell digestion solution, single-cell encapsulation buffer, emulsified oil, oil-breaking agent, reverse transcription reagent, TESDS reagent, TET reagent, SPI magnetic beads and second-strand synthesis reagent, cDNA amplification reagent, and library preparation and sequencing reagent.
[0063] The covalently coupled microparticles with complete barcodes were detected under a fluorescence microscope before and after incubation with the FAM-PolyA probe. The results are shown in [Figure number missing]. Figure 2 As shown, the diameter of the particles is about 40 μm; the particles are intact and of good quality, with a high density and uniformly distributed polyT sequence to capture mRNA.
[0064] The single-cell digestion solution is divided into a high-osmotic-pressure digestion solution for marine tissues and a low-osmotic-pressure digestion solution for freshwater tissues. The final concentration of the high-osmotic-pressure digestion solution consists of: 0.02 g / mL cysteine hydrochloride, 20 μg / mL Liberase (Roche, catalog number 5401119001), 20 μg / mL Dispase (Millipore Sigma, catalog number D4693-1G), pH 8.0, and is a mixture of artificial seawater and MQ water at a volume ratio of 6:4, with MQ water added to adjust the osmotic pressure to 980 mOsm / kg. The final concentration of the low-osmotic-pressure digestion solution consists of: 10 μg / mL Dispase (Millipore Sigma, catalog number D4693-1G), and is a mixture of PBS buffer (pH 7.5) and MQ water at a volume ratio of 1:9, with MQ water added to adjust the osmotic pressure to 30 mOsm / kg.
[0065] The single-cell encapsulation buffer is divided into a high-osmotic-pressure encapsulation buffer for marine tissues and a low-osmotic-pressure encapsulation buffer for freshwater tissues. The final concentration of the high-osmotic-pressure encapsulation buffer is composed of 80 U / mL proteinase K, 70 mM dithiothreitol (DTT), and 3.3×DPBS buffer, with an osmotic pressure of 980 mOsm / kg. The final concentration of the low-osmotic-pressure encapsulation buffer is composed of 29 U / mL proteinase K, 70 mM DTT, and 0.1×DPBS buffer, with an osmotic pressure of 30 mOsm / kg.
[0066] The emulsified oil consists of: 1% by mass of a fluorinated surfactant (item number 008-Fluoro-surfactant, detergent), and a fluorinated liquid (item number HFE 7500) as the solvent.
[0067] The oil-breaking agent is 1H,1H,2H,2H-perfluorooctyltrichlorosilane (Aladdin, T162729);
[0068] The final TESDS reagent composition is: 10 mM EDTA (ethylenediaminetetraacetic acid), 0.1% SDS (sodium dodecyl sulfate), and the solvent is 10 mM Tris buffer at pH 7.5.
[0069] The final TET reagent composition is: 10 mM EDTA, 0.1% Tween, in a 10 mM Tris buffer solution at pH 7.5.
[0070] The reverse transcription reagent composition is as follows: 4.8% PEG8000 (polyethylene glycol 8000), 4% Ficoll PM400 (sucrose), 1 mM dNTPs (NEB), 1 U / µL RNase inhibitor and 1 U / µL reverse transcriptase (ThermoFisher, Maxima H-minus EP0751); the specific formula (100µL) is: 56.5µL DEPC water, 10µL 48% PEG8000, 20µL 20% PM400, 10µL 10mM dNTP, 2.5µL 40U / mL RNase inhibitor, and 1µL 100 U / µL reverse transcriptase.
[0071] The final concentration composition of the second-chain synthetic reagent is: Klenow exo - 500 U / mL, 10 μM random primers and 1 mM dNTPs. Specific formulation (100 µL): 10 µL 5000 U / mL Klenow exo-, 10 µL 100 mM random primers, 10 µL 10 mM dNTPs and 70 µL MQ water;
[0072] Random primer sequence: TCAGACGTGTGCTCTTCCGATCTNNNNNNNNN (SEQ ID NO.1), where N represents A / T / C / G;
[0073] cDNA amplification reagent composition: universal primers and KAPA HiFi Mix (high-fidelity DNA polymerase premix);
[0074] Universal primer sequences: CTCTTTCCCTACACGACGCTC (SEQ ID NO.2) and TCAGACGTGTGCTCTTCCGATCT (SEQ ID NO.3);
[0075] Library construction and sequencing reagent composition: i5 / i7 primers and KAPA HiFi Mix (high-fidelity DNA polymerase premix);
[0076] The i5 / i7 primer sequences are as follows:
[0077] ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO.4);
[0078] CAAGCAGAAGACGGCATACGAGATAGGCTATAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO. 5).
[0079] 2. Instructions for use of the reagent kit
[0080] (1) Cell dissociation: Take the tissue to be tested, digest it at 28°C for 45 minutes using single-cell digestion solution, and filter to obtain single cells; the volume of the single-cell digestion solution used is 5 mL / g based on the mass of the tissue to be tested;
[0081] (2) Single-cell encapsulation: The single cells obtained in step (1) are resuspended in single-cell encapsulation buffer, covalently coupled microparticles with complete barcodes are added, and after mixing, emulsified oil is added. The mixture is then shaken horizontally at 3000 rpm for 30 s and vertically for 90 s to generate PIP droplets. The volume ratio of the cell suspension to the microparticles is 1:4, and the volume ratio of the cell suspension to the emulsified oil is 1:28.
[0082] (3) Sequence capture, reverse and second-strand synthesis: The mixture in step (2) was incubated at 65°C for 45 minutes to release mRNA and be captured by microparticles; Demulsification process: Add oil-breaking agent, shake at 3000 rpm for 30 seconds on a shaker, centrifuge for a short time, and discard the aqueous and oil phases outside the microparticles; After washing the microparticles with TESDS and TET reagents in sequence, collect the microparticles and reverse transcribe them with reverse transcription reagent; After reverse transcription, treat with Exo I at 37°C for 20 minutes to remove excess primers, and inactivate at 80°C for 15 minutes; After washing with TESDS and TET reagents in sequence, add second-strand synthesis reagent, and incubate at 25°C for 30 minutes and 37°C for 60 minutes; The volume ratio of the oil-breaking agent to the cell suspension in step (2) is 5:1;
[0083] Reverse transcription reaction program: 42℃ for 90 min, 10 cycles: 42℃ for 90 s; 50℃ for 90 s; 72℃ for 5 min;
[0084] (4) Amplification and sequencing: The reaction solution from step (3) was eluted with 0.01M KOH aqueous solution and purified with 1.8×SPI magnetic beads. The whole transcriptome was amplified using cDNA amplification reagent, and the product was purified and quantified. 2 ng of the amplified product was taken and subjected to PCR reaction using library construction and sequencing reagents. Fragments <200 bp were removed using 0.9×SPI magnetic beads. After the library passed quality control, it was mixed in equimolar amounts and sequenced at 150 bp paired ends on the NovaSeq6000 platform.
[0085] cDNA amplification program: 98℃, 3 min; 11-14 cycles (95℃, 30 s; 60℃, 40 s; 72℃, 1 min); 72℃, 2 min;
[0086] PCR reaction program: 98℃, 3 min; 8 cycles (95℃, 30 s; 60℃, 40 s; 72℃, 1 min); 72℃, 2 min.
[0087] Example 2: High-fidelity sequencing of live cells from marine organisms (high osmotic pressure mode)
[0088] Reference Figure 1 Marine single-cell high-fidelity sequencing was performed using the kit from Example 1 as follows:
[0089] (1) Cell dissociation: Take 1g of fresh staghorn coral tissue (including skeleton), digest it with 5mL of hyperosmolar digestion solution at 28℃ for 45 minutes, filter to obtain single cells, and the viability of trypan blue staining reached 92%.
[0090] (2) Single-cell encapsulation: The coral single cells dissociated in step (1) were resuspended in hyperosmolar encapsulation buffer, the cells were counted, and the cells were diluted to 1000 cells / µL with hyperosmolar encapsulation buffer. Finally, 10µL of cell dilution (containing 10,000 cells) was added to 40µL of covalently coupled microparticles with complete barcodes, mixed, and then 280µL of emulsified oil was added. The mixture was shaken horizontally at 3000rpm for 30s and vertically for 90s to generate PIP droplets.
[0091] (3) Sequence capture, reverse transcription, and second-strand synthesis: The mixture from step (2) was incubated at 65°C for 45 minutes to release mRNA, which was then captured by microparticles. After capture, 50 µL of oil-breaking agent was added, and the mixture was shaken at 3000 rpm for 30 seconds. After short-term centrifugation, the aqueous and oil phases outside the microparticles were discarded. The microparticles were washed with washing buffer, collected, and 40 µL of reverse transcription reagent was added for reverse transcription. After reverse transcription, the excess primers were removed by treatment with Exo I at 37°C for 20 minutes, and then inactivated at 80°C for 15 minutes. After washing with TESDS and TET reagents in sequence, 50 µL of second-strand synthesis reagent was added, and the mixture was incubated at 25°C for 30 minutes and 37°C for 60 minutes.
[0092] (4) Amplification and sequencing: The reaction solution from step (3) was eluted with 0.1M KOH aqueous solution and purified with 1.8×SPI magnetic beads. The whole transcriptome was amplified using cDNA amplification reagent (13-14 cycles), and the product was purified and quantified. 2 ng of the amplified product was taken and subjected to 8 rounds of index PCR using library construction and sequencing reagents. Fragments <200 bp were removed using 0.9×SPI magnetic beads. After the library passed quality control, it was mixed in equimolar amounts and sequenced at 150 bp paired ends using the NovaSeq 6000 platform. Based on the sequencing results, a UMAP diagram was drawn using Seurat (…). Figure 3 ), using pheatmap to draw heatmap diagrams ( Figure 5 ). Figure 4 It can be seen that the average median number of genes per cell is over 1200. Figure 3 It can be seen that cell groups such as stinging cells, symbiotic cells, and calcified cells are clearly distinguishable.
[0093] Example 3: Freshwater organism live cell sequencing (low osmotic pressure mode)
[0094] Using the kit from Example 1, and employing hypotonic digestion solution and hypotonic encapsulation buffer, freshwater hydra (Hydra vulgaris) tissue was detected according to the conditions and steps of Example 2. Trypan blue staining viability reached 90%. Sequencing results ( Figure 6 and Figure 7 It can be seen that the prickle cells and mesenchymal stem cell populations are completely preserved. Figure 6 ), and heatmap( Figure 7 The characteristic genes of each cell group are clearly visible.
[0095] Comparative Example 1: Conventional Fixation Method (Marine Organisms)
[0096] Coral tissue from the same batch as in Example 1 was used, and cells were dissociated and fixed in one step using the ACME method: the tissue was minced and added to premixed ACME working solution (distilled water:methanol:glacial acetic acid:glycerol, volume ratio 13:3:3:2), and fixed and incubated at room temperature (approximately 25°C) for 10-15 min, during which time gentle pipetting or mechanical homogenization was used to dissociate the cells. After dissociation, the cells were passed through a 40 μm cell sieve, centrifuged, and the supernatant was discarded. The cells were washed with 1× PBS and resuspended. After counting, the concentration was adjusted to an appropriate level, and the cells were loaded into a 10x Genomics microfluidic chip. Subsequent reverse transcription, library construction, and sequencing were performed according to the standard procedure of the Chromium Single Cell 3' kit. The results showed that the average median number of genes per cell was only 200-400, and the nematocyst population was almost completely lost.
[0097] Comparative Example 2: Osmotic pressure mismatch treatment (freshwater organisms)
[0098] The freshwater hydra cells from Example 3 were treated with conventional mammalian isotonic encapsulation buffer (1×DPBS, ~300 mOsm / kg), with other operations the same as in Example 3. After encapsulation, the cells shrank significantly, the number of median genes in sequencing decreased to 200, stress-related genes were abnormally highly expressed, and cell clustering was disordered.
[0099] As can be seen from the above comparison, the adjustable osmotic pressure strategy provided by the present invention plays a decisive role in maintaining the natural state of living cells in aquatic organisms and improving the quality of single-cell transcriptome data.
Claims
1. A PIP-seq technology-based adjustable osmotic pressure single cell sequencing kit, characterized in that, The kit includes covalently coupled microparticles with complete barcodes, single-cell digestion solution, single-cell encapsulation buffer, emulsified oil, oil-breaking agent, TESDS reagent, TET reagent, reverse transcription reagent, SPI magnetic beads, second-strand synthesis reagent, cDNA amplification reagent, and library construction and sequencing reagent. The single-cell digestion solution is divided into a high-osmotic-pressure digestion solution for marine tissues and a low-osmotic-pressure digestion solution for freshwater tissues. The final concentration of the high-osmolarity digestion solution consists of: 0.02 g / mL cysteine hydrochloride, 10-40 μg / mL Liberase, 10-40 μg / mL Dispase, pH 8.0, and a solvent of artificial seawater and ultrapure water at a volume ratio of 6:4, with ultrapure water added to adjust the osmolarity to 850-950 mOsm / kg; the final concentration of the low-osmolarity digestion solution consists of: 5-20 μg / mL Dispase, pH 8.0, and a solvent of PBS buffer and ultrapure water at a volume ratio of 1:9, with ultrapure water added to adjust the osmolarity to 25-35 mOsm / kg. The single-cell encapsulation buffer is divided into a high-osmotic-pressure encapsulation buffer for marine tissues and a low-osmotic-pressure encapsulation buffer for freshwater tissues. The final concentration of the high-osmotic-pressure encapsulation buffer is: 60-100 U / mL proteinase K, 50-80 mM dithiothreitol, with 3.3-3.5×DPBS buffer as the solvent, and an osmotic pressure of 950-1030 mOsm / kg. The final concentration of the low-osmotic-pressure encapsulation buffer is: 15-45 U / mL proteinase K, 50-80 mM dithiothreitol, with 0.05-0.2×DPBS buffer as the solvent, and an osmotic pressure of 25-35 mOsm / kg. The emulsified oil consists of: 1% by mass of a fluorinated surfactant, and the solvent is a fluorinated liquid; The oil-breaking agent is 1H,1H,2H,2H-perfluorooctyltrichlorosilane; The final TESDS reagent composition is: 10 mM EDTA, 0.1% SDS, in a 10 mM Tris buffer solution at pH 7.
5. The final TET reagent composition is: 10 mM EDTA, 0.1% Tween, and the solvent is 10 mM Tris buffer at pH 7.
5. The reverse transcription reagent has the following mass concentration composition: 4.8% polyethylene glycol 8000, 4% polysucrose Ficoll PM400, 1 mMdNTPs, 1 U / µL RNase inhibitor and 1 U / µL reverse transcriptase; The second strand synthesis reagent final concentration composition is: Klenow exo - 500 U / mL, 10 μM random primer, and 1 mM dNTP; The cDNA amplification reagent consists of: universal primers and a high-fidelity DNA polymerase premix; Library construction and sequencing reagents consist of i5 / i7 primers and a high-fidelity DNA polymerase premix.
2. The kit of claim 1, wherein The final concentration of the high-osmolarity digestion solution consists of: 0.02 g / mL cysteine hydrochloride, 20 μg / mL Liberase, 20 μg / mL Dispase, pH 8.0, and is a mixture of artificial seawater and ultrapure water at a volume ratio of 6:4, with ultrapure water added to adjust the osmolarity to 980 mOsm / kg. The low-osmolarity digestion solution consists of: 10 μg / mL Dispase, and is a mixture of PBS buffer and ultrapure water at a volume ratio of 1:9, with ultrapure water added to adjust the osmolarity to 30 mOsm / kg.
3. The kit of claim 1, wherein The high-osmolarity encapsulation buffer has the following final concentration composition: 80 U / mL proteinase K, 70 mM dithiothreitol, and 3.3×DPBS buffer as the solvent, with an osmolarity of 980 mOsm / kg; the low-osmolarity encapsulation buffer has the following final concentration composition: 29 U / mL proteinase K, 70 mM dithiothreitol, and 0.1×DPBS buffer as the solvent, with an osmolarity of 30 mOsm / kg.
4. The kit of claim 1, wherein The reverse transcription reagent has the following mass concentration composition: 4.8% PEG8000, 4% Ficoll PM400, 1 mM dNTPs, 1 U / µL RNase inhibitor and 1 U / µL reverse transcriptase.
5. The kit of claim 1, wherein The random primer sequence for the second-strand synthesis reagent is shown in SEQ ID NO.1; the universal primer sequences for the cDNA amplification reagent are shown in SEQ ID NO.2 and SEQ ID NO.
3.
6. The kit of claim 1, wherein The primer sequences in the library construction and sequencing reagent are shown in SEQ ID NO.4 and SEQ ID NO.
5.
7. A method for detecting single cells of live freshwater / marine organisms using the kit of claim 1, characterized in that, The method is performed according to the following steps: (1) Cell dissociation: Take the freshwater / marine biological tissue to be tested, digest it with single-cell digestion solution at 28°C for 45 minutes, and filter to obtain single cells; (2) Single cell encapsulation: Resuspend the single cells from step (1) in single cell encapsulation buffer, add covalently coupled microparticles with complete barcodes, mix, and then add emulsified oil. Shake horizontally at 3000 rpm for 30 s and vertically for 90 s on a shaker to generate microdroplets. (3) Sequence capture, reverse and second-strand synthesis: The mixture from step (2) was incubated at 65°C for 45 minutes to release mRNA and capture it by microparticles; an oil-breaking agent was added, and the mixture was shaken at 3000 rpm for 30 seconds. After short-term centrifugation, the aqueous and oil phases outside the microparticles were discarded; the microparticles were washed with TESDS and TET reagents in sequence, and the microparticles were collected for reverse transcription using a reverse transcription reagent; after reverse transcription, the excess primers were removed by treating with Exo I at 37°C for 20 minutes, and the primers were inactivated at 80°C for 15 minutes; after washing with TESDS and TET reagents in sequence, a second-strand synthesis reagent was added, and the mixture was incubated at 25°C for 30 minutes and at 37°C for 60 minutes. (4) Amplification and sequencing: The reaction solution in step (3) was washed with 0.01M KOH aqueous solution and purified with 1.8×SPI magnetic beads. The whole transcriptome was amplified with cDNA amplification reagent, and the product was purified and quantified. The amplified product was taken and PCR reaction was performed with library construction and sequencing reagent. <200 bp fragments were removed with 0.9×SPI magnetic beads. After the library passed the quality inspection, it was mixed in equimolar amounts and the paired-end 150 bp sequencing was performed on the NovaSeq 6000 platform.
8. The method as described in claim 7, characterized in that, The volume of the single-cell digestion solution used in step (2) is 3-8 mL / g based on the mass of the tissue to be tested; the volume ratio of the cell suspension to the microparticles is 1:3-5, and the volume ratio of the cell suspension to the emulsified oil is 1:20-35; the volume ratio of the oil-breaking agent in step (3) to the cell suspension in step (2) is 3-8:
1.
9. The method as described in claim 7, characterized in that, The reverse transcription reaction program was as follows: 42℃ for 90 min, 10 cycles: 42℃ for 90 s; 50℃ for 90 s; 72℃ for 5 min.
10. The method as described in claim 7, characterized in that, The cDNA amplification program is 98℃ for 3 min; 95℃ for 30 s, 60℃ for 40 s, 72℃ for 1 min, 11-14 cycles; 72℃ for 2 min. The PCR reaction program is 98℃ for 3 min; 95℃ for 30 s, 60℃ for 40 s, 72℃ for 1 min, 7-9 cycles; 72℃ for 2 min.