A kasp marker linked to tomato green stem trait and application thereof
By developing a KASP marker targeting the SlABCC5 gene in tomato and designing specific primers using SNP sites for molecular detection of stem color traits during the seedling stage, the problems of long cycle and low efficiency in breeding have been solved, achieving efficient and low-cost breeding screening and detection.
Patent Information
- Application Number
- CN202610507825.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-16
- Publication Date
- 2026-06-23
AI Technical Summary
In existing technologies, tomato breeding relies on field phenotypic observation, which is time-consuming, inefficient, and easily affected by environmental factors. It cannot efficiently utilize the seedling marker traits of green and purple stems in tomatoes, resulting in high breeding costs and low efficiency.
We developed a KASP marker targeting the SlABCC5 gene in tomato. By designing specific primers and fluorescent adapter sequences, we performed high-throughput and precise genotyping based on SNP sites and used KASP technology to achieve molecular detection of stem color traits in seedlings.
It enables high-throughput, low-cost, and accurate genotyping during the seedling stage, shortens the breeding cycle, improves breeding efficiency, and is suitable for large-scale breeding screening and seed company variety purity testing.
Smart Images

Figure CN122256552A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and more particularly to a KASP marker linked to the green stem trait of tomatoes and its application. Background Technology
[0002] Tomatoes are an important vegetable crop worldwide. In tomato breeding, seedling marker traits are widely used for hybrid purity identification, male sterility line screening, haploid breeding, and directional selection of linked desirable traits because they can be directly, quickly, and accurately distinguished by the naked eye during the seedling stage. This can significantly reduce breeding costs and improve efficiency.
[0003] Green and purple stems are classic, stable seedling-stage marker traits in tomatoes, with phenotypic differences primarily determined by the accumulation of anthocyanins in the stem. Purple stems are dominant, while green stems are recessive. However, at the molecular level, the key genes regulating this trait and their mechanisms of action have long remained unclear, preventing the efficient utilization of this desirable marker trait in modern molecular breeding systems.
[0004] Traditional breeding methods rely on field phenotypic observation, which is time-consuming, inefficient, and easily affected by environmental factors. Molecular marker-assisted selection (MMR) is an effective method to improve breeding efficiency. Among them, KASP (Kompetitive Allele Specific PCR) technology is characterized by low cost, high throughput, and high accuracy. It performs precise bicelestem typing of SNP sites through specific matching of primer terminal bases and is widely used in crop MMR. Developing a KASP marker closely linked to the green stem trait in tomatoes is of great value for improving the accuracy and efficiency of tomato molecular breeding.
[0005] Therefore, those skilled in the art are dedicated to developing a simple, high-throughput KASP marker for the tomato SlABCC5 gene and applying it to the molecular detection of stem color traits in tomato germplasm resources during the seedling stage. Summary of the Invention
[0006] In view of the above-mentioned deficiencies of the prior art, the technical problem to be solved by the present invention is how to develop a simple and high-throughput KASP marker for the SlABCC5 gene of tomato and apply it to the molecular detection of stem color traits in tomato germplasm resources during the seedling stage.
[0007] To achieve the above objectives, the present invention provides a KASP marker linked to the green stem trait of tomato, the nucleotide sequence of which is SEQ ID NO:1.
[0008] This invention also provides a method for developing KASP markers linked to the green stem trait in tomatoes, comprising the following steps: The SNP site of the SlABCC5 gene located at 57816528 bp on chromosome 9 is closely associated with the phenotype; genotype C / C corresponds to green stems, and A / A corresponds to purple stems; specific primers were designed based on the upstream and downstream sequences of this SNP site using the Primer-BLAST function of NCBI.
[0009] Furthermore, the specific primers are an upstream primer and a downstream primer; the upstream primer contains FAM and HEX fluorescent linker sequences, namely ABCC5-KASP-FAM-F and ABCC5-KASP-HEX-F, respectively, with the nucleotide sequence of primer ABCC5-KASP-FAM-F being SEQ ID NO:2 and the nucleotide sequence of primer ABCC5-KASP-HEX-F being SEQ ID NO:3; the downstream primer is a universal reverse primer ABCC5-KASP-R with the nucleotide sequence being SEQ ID NO:4.
[0010] Furthermore, KASP markers were designed based on SNP sites using two specific forward primers with different fluorescent tags at the 5' ends and matching allelic variations at the 3' ends, and one universal reverse primer. During PCR amplification, only the perfectly matched primers extended effectively, enriching the corresponding fluorescent signals; by endpoint detection, homozygous or heterozygous genotypes could be accurately identified based on fluorescence color and intensity. If the SNP is closely linked to the target trait or is a functional mutation, precise genotyping can be achieved without phenotypic identification, significantly improving selection efficiency and accelerating the breeding process.
[0011] This invention also provides an application of KASP markers linked to the green stem trait in tomatoes, comprising the following steps: Step 1: Extract genomic DNA from tomato samples to be tested. Using the genomic DNA as a template, perform PCR amplification using the KASP-labeled primers designed above to obtain PCR amplification products. Step 2: Use an ELISA reader to read the fluorescence data of the PCR amplification products obtained in Step 1 and perform genotyping.
[0012] Further, the PCR amplification system in step 1 is a 10.0 μL reaction system: 10-100 ng of tomato sample DNA template; 5 μL of 2×PARMS Mix; 0.15 μL of ABCC5-KASP-FAM-F (10 μM concentration), 0.15 μL of ABCC5-KASP-HEX-F (10 μM concentration), and 0.4 μL of ABCC5-KASP-R (10 μM concentration); and water is added to a final volume of 10 μL using ddH2O.
[0013] Further, the PCR reaction conditions in step 1 are as follows: 94℃ pre-denaturation for 15 min, 1 cycle; 94℃ denaturation for 20 s, 65℃ annealing for 1 min, decreasing by 0.7℃ for each cycle, 10 cycles; 94℃ denaturation for 20 s, 57℃ annealing for 12 min, 30 cycles; after the cycles are completed, allow to cool naturally to room temperature.
[0014] Furthermore, step 2 also includes uploading the fluorescence data to http: / / www.snpway.com for genotyping.
[0015] In a preferred embodiment of the present invention, the development and application process of KASP markers linked to the green stem trait of tomatoes is described in detail.
[0016] The beneficial technical effects of this invention are as follows: This invention identifies for the first time the key gene SlABCC5, which regulates the green stem trait in tomato seedlings, and develops a KASP molecular marker, KASP_ABCC5, co-segregating with the green stem trait based on a non-synonymous mutation site in this gene. The simple, high-throughput KASP marker designed and developed for the tomato SlABCC5 gene enables molecular detection of stem color traits in tomato germplasm resources during the seedling stage, providing tomato breeders with a tool for marker-assisted selection. Specifically: 1. Breeding effect: High-throughput, low-cost, and precise genotyping of a large number of tomato breeding materials can be performed during the seedling stage without waiting for phenotypic manifestation, which greatly shortens the breeding cycle.
[0017] 2. Application results: In 50 natural population materials, the genotype and phenotype similarity reached 86%, proving that it has broad breeding application potential.
[0018] 3. The KASP_ABCC5 marker developed in this invention relies on the mature, stable, and low-cost KASP technology, is compatible with conventional PCR instruments and fluorescence detection equipment, and requires no additional investment in expensive equipment. Most breeding companies and research institutions can directly apply it. This marker demonstrates excellent performance with 86% consistency in natural populations, sufficient to meet the needs of large-scale breeding screening. It can be seamlessly integrated into existing tomato molecular breeding processes. Breeders only need to extract DNA from the material to be tested and use the primers provided in this invention to complete the KASP reaction. Genotyping of hundreds to thousands of samples can be completed within a day, rapidly screening out individual plants carrying the target genotype of green or purple stems for subsequent hybridization, backcrossing, or pure-line selection. Simultaneously, this technology can directly serve tomato seed companies for variety purity testing, sterile line propagation, and hybrid seed production.
[0019] The following will further explain the concept, specific structure, and technical effects of the present invention in conjunction with the accompanying drawings, so as to fully understand the purpose, features, and effects of the present invention. Attached Figure Description
[0020] Figure 1 This is a phenotypic feature diagram of purple-stemmed tomatoes and green-stemmed tomatoes according to a preferred embodiment of the present invention; Figure 2 This is a graph showing the anthocyanin content of green-stemmed tomato 'Dadu' and purple-stemmed tomato 'Shuangliu', according to a preferred embodiment of the present invention. Figure 3 This is a candidate region map for tomato seedling stage marker localization according to a preferred embodiment of the present invention; Figure 4 This is a KASP scatter plot of a preferred embodiment of the present invention. Detailed Implementation
[0021] The following description, with reference to the accompanying drawings, illustrates several preferred embodiments of the present invention to make its technical content clearer and easier to understand. The present invention can be embodied in many different forms, and the scope of protection of the present invention is not limited to the embodiments mentioned herein.
[0022] Example 1: Development and application of KASP markers linked to the green stem trait in tomatoes
[0023] One SNP variant site of the tomato stem color trait-related gene SlABCC5 was obtained through the following steps: (1) Using the green-stemmed tomato variety 'Dadu' and the purple-stemmed tomato variety 'Shuangliu' provided by Shanghai Funong Seed Industry Co., Ltd. as parents, an F2 genetic segregating population was constructed. The phenotypic characteristics of purple-stemmed tomatoes and green-stemmed tomatoes are as follows: Figure 1 As shown, Part A represents the green-stemmed tomato variety 'Da Du', and Part B represents the purple-stemmed tomato variety 'Shuang Liu'. The anthocyanin content of the green-stemmed tomato 'Da Du' and the purple-stemmed tomato 'Shuang Liu' is as follows: Figure 2 As shown; 21 green-stemmed individuals, 20 purple-stemmed individuals with extreme phenotypes, and one male and one female parent were selected from the F2 population. High-quality DNA was extracted using a kit method, and four pools were constructed. Whole-genome resequencing was performed using the Illumina sequencing platform. The sequencing depth of the parents was 20×, and the sequencing depths of the progeny pools were 34× and 31×, respectively. The tomato reference genome was used as the reference. S _ lycopersicum Using _chromosomes.4.00.fa as a reference, SNP variants were detected through bwa-mem2 software alignment and a combined GATK and Samtools algorithm. After removing low-quality variants, ΔSNP-index association analysis identified a 0.28Mb candidate region on chromosome 9, resulting in 10 candidate genes. Combining functional annotation, homology analysis, transcriptome data, and knockout mutant phenotypic identification, SlABCC5 was ultimately determined as the core candidate gene.
[0024] (2) Sequence cloning and alignment analysis of the SlABCC5 gene revealed that its SNP locus at 57816528 bp on chromosome 9 (genotype C / C corresponds to green stems, and A / A corresponds to purple stems) is closely associated with the phenotype. Candidate regions for marker localization in tomato seedlings are as follows: Figure 3 As shown, Part A represents the initial localization results of seedling marker genes, with a correlation coefficient threshold of 0.667 and a confidence level of 0.99. Part B represents the region and relative position of candidate genes.
[0025] (3) Using NCBI's Primer-BLAST function, specific primers were designed based on the upstream and downstream sequences of the SNP site. The upstream primer contained FAM and HEX fluorescent adapter sequences, respectively, and the downstream primer was a universal reverse primer. The primer sequences are as follows: ABCC5-KASP-FAM-F: GAAGGTGACCAAGTTCATGCTCCATCGTAAACCAACACCACG ABCC5-KASP-HEX-F: AAGGTCGGAGTCAACGGATTCCATCGTAAACCAACACCACA ABCC5-KASP-R:CTGGTAGGAGGAGAGGTGAT Genomic DNA was extracted from the tomato samples to be tested. Using the genomic DNA as a template, PCR amplification was performed using the KASP-labeled primers designed above to obtain the PCR amplification products.
[0026] The amplification system consisted of 10.0 μL reaction volumes: 10-100 ng of tomato sample DNA template; 5 μL of 2×PARMS Mix (reagents purchased from Wuhan Jingtai Biotechnology Co., Ltd.); 0.15 μL of ABCC5-KASP-FAM-F (10 μM), 0.15 μL of ABCC5-KASP-HEX-F (10 μM), and 0.4 μL of ABCC5-KASP-R (10 μM); and water was added to a final volume of 10 μL using ddH2O.
[0027] The reaction conditions were as follows: pre-denaturation at 94℃ for 15 min, 1 cycle; denaturation at 94℃ for 20 s, annealing at 65℃ for 1 min, with the temperature decreasing by 0.7℃ per cycle, 10 cycles; denaturation at 94℃ for 20 s, annealing at 57℃ for 12 min, 30 cycles; after the cycle was completed, the mixture was allowed to cool naturally to room temperature.
[0028] After the reaction is complete, the Tecan Spark microplate reader directly reads the fluorescence data of the PCR reaction products and uploads the data to http: / / www.snpway.com for genotyping.
[0029] (4) Using the above KASP marker primers, 50 natural tomato populations (covering green-stemmed and purple-stemmed phenotypes, all materials were provided by Shanghai Funong Seed Industry Co., Ltd.) were amplified and genotyped on an ELISA reader. The results showed that the molecular marker primers could clearly distinguish between the two genotypes. Among them, 5 green-stemmed materials carried the C / C genotype, 38 purple-stemmed materials carried the A / A genotype, and 7 carried the C / C genotype. The KASP genotyping scatter plots are shown below. Figure 4 As shown in Table 1, the genotype-phenotype match rate among the 50 materials reached 86%. The validation data of the KASP marker for tomato stem color trait in natural populations are also shown. The genotype and tomato stem color phenotype results showed good consistency, making it suitable for rapid screening of green-stemmed and purple-stemmed tomato materials in marker-assisted breeding.
[0030] Table 1. Validation of KASP markers for tomato stem color traits in natural populations.
[0031] The preferred embodiments of the present invention have been described in detail above. It should be understood that those skilled in the art can make numerous modifications and variations based on the concept of the present invention without creative effort. Therefore, all technical solutions that can be obtained by those skilled in the art based on the concept of the present invention through logical analysis, reasoning, or limited experimentation on the basis of existing technology should be within the scope of protection defined by the claims.
Claims
1. A KASP marker linked to the green stem trait of tomato, characterized in that, The nucleotide sequence of the KASP label is SEQ ID NO:
1.
2. A method for developing KASP markers linked to the green stem trait of tomatoes as described in claim 1, characterized in that, The method includes the following steps: The SNP site of the SlABCC5 gene located at 57816528 bp on chromosome 9 is closely associated with the phenotype; genotype C / C corresponds to green stems, and A / A corresponds to purple stems; specific primers were designed based on the upstream and downstream sequences of the SNP site using the Primer-BLAST function of NCBI.
3. The method as described in claim 2, characterized in that, The specific primers are an upstream primer and a downstream primer; the upstream primer contains FAM and HEX fluorescent linker sequences, namely ABCC5-KASP-FAM-F and ABCC5-KASP-HEX-F, respectively, with the nucleotide sequence of primer ABCC5-KASP-FAM-F being SEQ ID NO:2 and the nucleotide sequence of primer ABCC5-KASP-HEX-F being SEQ ID NO:3; the downstream primer is a universal reverse primer ABCC5-KASP-R with the nucleotide sequence being SEQ ID NO:
4.
4. The application of a KASP marker linked to the green stem trait of tomato as described in claim 1, characterized in that, Includes the following steps: Step 1: Extract genomic DNA from tomato samples to be tested. Using the genomic DNA as a template, perform PCR amplification using the KASP-labeled primers designed above to obtain PCR amplification products. Step 2: Use an ELISA reader to read the fluorescence data of the PCR amplification products obtained in Step 1 and perform genotyping.
5. The application as described in claim 4, characterized in that, The PCR amplification system in step 1 is a 10.0 μL reaction system: 10-100 ng of tomato sample DNA template; 5 μL of 2×PARMS Mix; 0.15 μL of ABCC5-KASP-FAM-F (10 μM concentration), 0.15 μL of ABCC5-KASP-HEX-F (10 μM concentration), and 0.4 μL of ABCC5-KASP-R (10 μM concentration); and water added to a final volume of 10 μL using ddH2O.
6. The application as described in claim 4, characterized in that, The PCR reaction conditions in step 1 are as follows: pre-denaturation at 94℃ for 15 min, 1 cycle; denaturation at 94℃ for 20 s, annealing at 65℃ for 1 min, decreasing the temperature by 0.7℃ for each cycle, 10 cycles; denaturation at 94℃ for 20 s, annealing at 57℃ for 12 min, 30 cycles; after the cycles are completed, allow the mixture to cool naturally to room temperature.
7. The application as described in claim 4, characterized in that, Step 2 also includes uploading the fluorescence data to http: / / www.snpway.com for genotype analysis.