Oral care compositions comprising peptidases or lactonases

Abstract

The present invention relates to oral care compositions comprising a peptidase or lactonase, preferably a peptidase and a lactonase, the use of said compositions in medicine, the use of said compositions in the treatment of oral diseases, methods of treatment comprising the administration of said compositions to a human subject, methods of preventing or removing oral biofilm comprising contacting an oral biofilm with said compositions, methods for reducing the risk of oral biofilm formation, and kits comprising said compositions.

Description

[0001] References to sequence lists This application contains a sequence list in a computer-readable form, which is incorporated herein by reference. Technical Field

[0002] This invention relates to oral care compositions comprising peptidase or lactonease, preferably peptidase and lactonease, the use of said compositions in medicine, the use of said compositions in the treatment of oral diseases, including treatment methods for administering said compositions to human subjects, methods for preventing or removing oral biofilms by contacting said compositions with said compositions, methods for reducing the risk of oral biofilm formation, and kits containing said compositions. Background Technology

[0003] Biofilms are bacterial communities found on solid surfaces in many different environments, including the oral cavity. Oral biofilms, or dental plaque, contain many bacteria associated with oral health problems such as bad breath, demineralization, tooth decay, cavities, potential tooth loss, and gum disease (gingivitis and periodontitis).

[0004] Oral biofilm formation occurs in three phases, known as the retardation phase, the growth phase, and the stationary phase. During retardation, glycoproteins from saliva bind to the oral surface (e.g., teeth) and form a structure called a biofilm, which serves as an attachment site for bacteria. During the growth phase, co-aggregation occurs, where a second bacterial colonist attaches to the first, leading to increased biofilm diversity and growth and maturation. In the stationary phase, biofilm growth slows and eventually ceases. This phase-based formation cycle results in biofilms existing in several consecutive layers, making physical wear and tear on the biofilm more difficult.

[0005] During biofilm formation, oral bacteria communicate with each other by releasing quorum sensing signaling molecules such as acylhomoserine lactones (AHLs) to regulate gene expression in terms of population density, acid resistance, virulence, and biofilm development (Polizzi et al., Pharmaceutics, 2022, Vol. 14, 2740). Interference with the communication pathways involved in quorum sensing (a process known as “quorum quenching”) has been proposed as a strategy to inhibit biofilm formation. One promising approach involves the enzymatic inactivation of AHLs via lactoneases, acylases, or oxidoreductases (Polizzi et al., Pharmaceutics, 2022, Vol. 14, 2740).

[0006] Due to increased resistance to antimicrobial agents and the mechanical properties of biofilms, many current oral care products are highly ineffective in addressing biofilm formation and alleviating related oral health problems. The focus of biofilm removal is on mechanical abrasion. However, the multilayered nature of biofilms makes mechanical abrasion difficult, and because mechanical removal of biofilms (e.g., by brushing) expands and deepens the area where biofilms adhere and spread in the mouth, it potentially increases rather than reduces the severity of the problem, thus further impacting mechanical abrasion.

[0007] Given the important role of biofilms in oral diseases, there is a need in the art for additional oral care compositions that can effectively target oral biofilms. Summary of the Invention

[0008] This invention relates to oral care compositions comprising peptidases or lactones, preferably peptidases and lactones. As illustrated by examples in this application, the inventors of this invention have identified certain fungal-derived peptidases and lactones that are highly effective in preventing oral biofilm formation and / or reducing the risk of oral biofilm formation. Without being bound by theory, it is presumed that the peptidases and lactones of this invention degrade quorum-sensing molecules secreted by oral pathogens that form biofilms, thereby disrupting oral biofilm formation.

[0009] In a first aspect, the present invention relates to oral care compositions comprising peptidases or lactones. In a preferred embodiment, the oral care composition comprises both peptidases and lactones.

[0010] The present invention also relates to the use of the oral care composition of the present invention as a medicine, and to methods for preventing and / or removing oral biofilms.

[0011] The present invention also relates to polynucleotides encoding the polypeptides of the present invention, nucleic acid constructs comprising said polynucleotides, expression vectors and recombinant host cells, and methods for producing these polypeptides.

[0012] definition Based on this detailed description, the following definitions apply. Note that unless otherwise explicitly stated in the context, the singular forms “a / an” and “the” include plural indicators.

[0013] Unless otherwise defined or explicitly indicated by the context, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0014] cDNA: The term "cDNA" refers to a DNA molecule that can be prepared by reverse transcription from mature, spliced ​​mRNA molecules obtained from eukaryotic or prokaryotic cells. cDNA lacks intron sequences that can be present in the corresponding genomic DNA. The initial primary RNA transcript is the precursor of mRNA, which is processed through a series of steps (including splicing) to become mature, spliced ​​mRNA.

[0015] Coding sequence: The term "coding sequence" refers to a polynucleotide that directly specifies the amino acid sequence of a polypeptide. The boundaries of a coding sequence are typically defined by an open reading frame (ORF), which begins with a start codon (such as ATG, GTG, or TTG) and ends with a stop codon (such as TAA, TAG, or TGA). Coding sequences can be genomic DNA, cDNA, synthetic DNA, or a combination thereof.

[0016] Control Sequences: The term "control sequence" refers to a nucleic acid sequence involved in regulating the expression of polynucleotides in a particular organism, either in vivo or in vitro. Each control sequence can be native (i.e., from the same gene) or heterologous (i.e., from different genes) for the polynucleotide encoding a polypeptide, and is native or heterologous relative to each other. Such control sequences include, but are not limited to, leader sequences, polyadenylation sequences, propeptides, propeptides, signal peptides, promoters, terminators, enhancers, and transcription or translation initiator and terminator sequences. At a minimum, control sequences include promoters and transcription and translation termination signals. These control sequences may be provided with multiple linkers for the purpose of introducing specific restriction sites that facilitate the linking of control sequences to the coding regions of polynucleotides encoding polypeptides.

[0017] Dentures: The term “dentures” is intended to encompass dentures themselves as well as orthodontic appliances, clear aligners, fixation devices, etc.

[0018] Expression: The term “expression” refers to any step involved in polypeptide production, including but not limited to transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0019] Expression vector: An expression vector is a linear or circular DNA construct containing a DNA sequence encoding a polypeptide, with the coding sequence operatively linked to a suitable control sequence that can influence the expression of the DNA in a suitable host. Such control sequences may include promoters that affect transcription, optional operon sequences that control transcription, sequences encoding suitable ribosome binding sites on mRNA, enhancers, and sequences that control the termination of transcription and translation.

[0020] Extension: The term "extension" refers to the addition of one or more amino acids to the amino and / or carboxyl termini of a polypeptide, wherein the "extended" polypeptide has peptidase or lactonease activity.

[0021] Fragment: The term "fragment" refers to a polypeptide that has one or more amino acids missing from the amino and / or carboxyl termini of a mature polypeptide, wherein the fragment has peptidase or lactonease activity.

[0022] Fusion polypeptide: The term "fusion polypeptide" is a polypeptide in which one of the polypeptides of the present invention is fused to the N-terminus and / or C-terminus. Fusion polypeptides are generated by fusing a polynucleotide encoding another polypeptide with a polynucleotide of the present invention, or by fusing two or more polynucleotides of the present invention together. Techniques for generating fusion polypeptides are known in the art and include linking the coding sequences of the polypeptides such that they conform to reading frames, and that the expression of the fusion polypeptide is under the control of the same promoter and terminator. Fusion polypeptides can also be constructed using intronomer technology, wherein the fusion polypeptide is generated post-translational (Cooper et al., 1993, ). EMBO J. [Journal of the European Society for Molecular Biology] 12: 2575-2583; Dawson et al., 1994, Science [Science] 266: 776-779. The fusion peptide may further include a cleavage site between the two peptides. This site is cleaved upon secretion of the fusion protein, thereby releasing both peptides. Examples of cleavage sites include, but are not limited to, those disclosed in the following literature: Martin et al., 2003. J. Ind. Microbiol. Biotechnol. [Journal of Industrial Microbiology and Biotechnology] 3: 568-576; Svetina et al., 2000, J. Biotechnol [Journal of Biotechnology] 76: 245-251; Rasmussen-Wilson et al., 1997, Appl. Environ. Microbiol. [Applied and Environmental Microbiology] 63: 3488-3493; Ward et al., 1995, Biotechnology [Biotechnology] 13: 498-503; and Contreras et al., 1991, Biotechnology [Biotechnology] 9: 378-381; Eaton et al., 1986, Biochemistry [Biochemistry] 25: 505-512; Collins-Racie et al., 1995, Biotechnology [Biotechnology] 13: 982-987; Carter et al., 1989, Proteins : Structure, Function, and Genetics [Proteins: Structure, Function, and Genetics] 6:240-248; and Stevens, 2003, Drug Discovery World [Drug Discovery World] 4: 35-48.

[0023] Heterogeneous: For host cells, the term "heterogeneous" means that the polypeptide or nucleic acid is not naturally present in the host cell. For polypeptides or nucleic acids, the term "heterogeneous" means that the control sequence (e.g., the promoter of the polypeptide or nucleic acid) is not naturally associated with that polypeptide or nucleic acid; that is, the control sequence comes from a gene other than the gene encoding the mature polypeptide.

[0024] Host strain or host cell: A “host strain” or “host cell” refers to an organism in which an expression vector, bacteriophage, virus, or other DNA construct (including a polynucleotide encoding a polypeptide of interest, such as an amylase) has been introduced. An exemplary host strain is a microbial cell (e.g., bacteria, filamentous fungi, and yeast) capable of expressing a polypeptide of interest and / or fermenting sugars. The term “host cell” includes protoplasts produced by cells.

[0025] Introduction: In the context of inserting a nucleic acid sequence into a cell, the term “introduction” means “transfection,” “conversion,” or “transduction,” as is known in the art.

[0026] Isolated: The term "isolated" means a polypeptide, nucleic acid, cell, or other specific material or component that has been separated from at least one other material or component (including, but not limited to, other proteins, nucleic acids, cells, etc.). Therefore, the isolated polypeptide, nucleic acid, cell, or other material exists in a form not found in nature. Isolated polypeptides include, but are not limited to, culture media containing secreted polypeptides expressed in host cells.

[0027] Lactonease: The term "lactonease" refers to an enzyme that catalyzes the enzymatic reaction of lactones, such as lactones, lactones, and esterases. N A polypeptide with lactonease activity resulting from the hydrolysis of acyl-L-homoserine lactone (EC 3.1.1.81). The terms "lactonease" and "polypeptide with lactonease activity" are used interchangeably throughout the application. For the purposes of this invention, lactonease activity can be determined according to the lactonease activity assay described in the examples herein.

[0028] Mature peptide: The term “mature peptide” refers to a peptide that has been processed at its N-terminus and / or C-terminus (e.g., removal of the signal peptide) to be in its mature form.

[0029] Mature polypeptide coding sequence: The term "mature polypeptide coding sequence" refers to a polynucleotide that encodes a mature polypeptide with peptidase or lactonease activity.

[0030] Natural: The term "natural" refers to nucleic acids or polypeptides that are naturally present in host cells.

[0031] Nucleic acid: The term "nucleic acid" encompasses DNA, RNA, heteroduplexes, and synthetic molecules capable of encoding polypeptides. Nucleic acids can be single-stranded or double-stranded and may include chemical modifications. The terms "nucleic acid" and "polynucleotide" are used interchangeably. Because the genetic code is degenerate, more than one codon can be used to encode a specific amino acid, and the compositions and methods of the present invention cover nucleotide sequences encoding specific amino acid sequences. Unless otherwise stated, nucleic acid sequences are presented in a 5' to 3' orientation.

[0032] Nucleic acid constructs: The term “nucleic acid construct” refers to a single-stranded or double-stranded nucleic acid molecule that is isolated from a naturally occurring gene or modified in a way that does not originally exist in nature to contain a segment of nucleic acid or is synthesized and contains one or more control sequences that are operatively linked to the nucleic acid sequence.

[0033] Operationally linked: The term "operationally linked" means that specified components are in a relationship that allows them to function in the intended manner (including, but not limited to, juxtaposition). For example, a regulatory sequence is operationally linked to a coding sequence such that the expression of the coding sequence is under the control of the regulatory sequence.

[0034] Parent: The term "parent" or "parental polypeptide" refers to an enzyme that has been modified to produce an enzyme variant. In one respect, a parent is a parental peptidase that has been modified to produce a peptidase variant. In another respect, a parent is a parental lactonease that has been modified to produce a lactonease variant.

[0035] Peptidase: The term "peptidase" refers to an enzyme that catalyzes the hydrolysis of peptide bonds and possesses peptidase activity (EC 3.4; also known as proteolytic activity or protease activity). The EC 3.4 group comprises several subgroups, including EC 3.4.11 (aminopeptidase), EC 3.4.16-3.4.18 (carboxypeptidase), and EC 3.4.21-3.4.25 (endopeptidase). The terms "peptidase" and "peptide with peptidase activity" are used interchangeably throughout this application. For the purposes of this invention, peptidase activity can be determined according to peptidase activity assay I or peptidase activity assay II as described in the examples herein.

[0036] Purified: The term "purified" means nucleic acids, peptides, or cells that are substantially free of other components, as determined by analytical techniques well known in the art (e.g., in electrophoretic gels, chromatographic eluates, and / or media subjected to density gradient centrifugation, where purified peptides or nucleic acids form discrete bands). Purified nucleic acids or peptides are at least about 50% pure, and typically at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 99.5%, about 99.6%, about 99.7%, about 99.8%, or more pure (e.g., weight percentage or molar percentage). In a relevant sense, a composition is enriched with the molecule when the concentration of the molecule increases significantly after the application of purification or enrichment techniques. The term “enrichment” refers to the presence of compounds, peptides, cells, nucleic acids, amino acids, or other specified materials or components in a composition at a relative or absolute concentration higher than that of the starting composition.

[0037] In one respect, the term "purified," as used herein, means that the polypeptide or cell is substantially free of components (especially insoluble components) from the producing organism. In other respects, the term "purified" means that the polypeptide is substantially free of insoluble components (especially insoluble components) from the natural organism from which it was obtained. In one respect, the polypeptide is separated from some soluble components of the organism from which it was recovered and the culture medium. The polypeptide can be purified (i.e., separated) by one or more of the following unit operation methods: filtration, precipitation, or chromatography.

[0038] Accordingly, the polypeptide can be purified such that only small amounts of other proteins, particularly other polypeptides, are present. The term "purified" as used herein can mean the removal of other components, particularly other proteins and most particularly other enzymes, present in the cells from which the polypeptide originates. The polypeptide can be "substantially pure," meaning it is free from other components from the organism that produced it (e.g., the host organism used to recombinantly produce the polypeptide). In one aspect, the polypeptide is at least 40% pure by weight of the total polypeptide material present in the formulation. In another aspect, the polypeptide is at least 50%, 60%, 70%, 80%, or 90% pure by weight of the total polypeptide material present in the formulation. As used herein, "substantially pure polypeptide" can mean a polypeptide formulation containing, by weight, at most 10%, preferably at most 8%, more preferably at most 6%, more preferably at most 5%, more preferably at most 4%, more preferably at most 3%, even more preferably at most 2%, most preferably at most 1%, and even most preferably at most 0.5% of the polypeptide and other polypeptide materials associated with it, either naturally or recombinantly.

[0039] Therefore, it is preferred that the substantially pure polypeptide, based on the weight of the total polypeptide material present in the formulation, is at least 92% pure, preferably at least 94% pure, more preferably at least 95% pure, more preferably at least 96% pure, more preferably at least 97% pure, more preferably at least 98% pure, even more preferably at least 99% pure, and most preferably at least 99.5% pure. The polypeptides of the present invention are preferably in a substantially pure form (i.e., the formulation is substantially free of other polypeptide materials associated with its natural or recombinant form). For example, this can be achieved by preparing the polypeptide using well-known recombinant methods or classical purification methods.

[0040] Recombination: The term "recombination," used in its conventional sense, refers to the manipulation (e.g., cutting and rejoining) of nucleic acid sequences to form a sequence group different from that found in nature. The term recombination refers to cells, nucleic acids, polypeptides, or vectors that have been modified from their natural state. Thus, for example, recombinant cells express genes not found in their natural (non-recombinant) forms, or express natural genes at different levels or under different conditions compared to those found in nature. The term "recombination" is synonymous with "genetically modified" and "transgenic."

[0041] Recovery: The term "recovery" refers to the removal of peptides from at least one fermentation broth component selected from a list of cells, nucleic acids, or other specified materials, for example, by methods such as: harvesting peptides by peptide crystallization, by filtration (e.g., deep filtration (using filter aids or packed filter media, cloth filtration in a box filter, rotary drum filtration, drum filtration, rotary vacuum drum filtration, candle filter, horizontal leaf filter, or the like, using sheet or pad filtration in a frame or modular device) or membrane filtration (using plate filtration, modular filtration, candle filtration, microfiltration, crossflow, dynamic crossflow, or dead-end operation ultrafiltration)), or by centrifugation (using a horizontal centrifuge, disc stack centrifuge, hydrocyclone, or the like), or by precipitation of peptides and using relevant solid-liquid separation methods to harvest peptides from broth media by particle size fractionation. Recovery encompasses the separation and / or purification of peptides.

[0042] Sequence identity: The degree of association between two amino acid sequences or two nucleotide sequences is described by the parameter "sequence identity".

[0043] For the purposes of this invention, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. [Journal of Molecular Biology] 48: 443-453) is used to determine the sequence identity between two amino acid sequences as the output of "longest identity". This algorithm is implemented in the Niedel program using the EMBOSS software package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. [Trends in Genetics] 16: 276-277) (preferably version 6.6.0 or later). The parameters used are a vacancy opening penalty of 10, a vacancy extension penalty of 0.5, and an EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix. For the Niedel program to report the longest identity, the non-brief (-nobrief) option must be specified on the command line. The Niedel-marked "longest identity" output is calculated as follows: (Identical residues × 100) / (Alignment length - Total number of vacancies in the alignment) For the purposes of this invention, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, ibid.) is used to determine the sequence identity between two polynucleotide sequences as the output of "longest identity," as implemented by the Niedel program in the EMBOSS software package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, ibid.) (preferably version 6.6.0 or later). The parameters used are a vacancy opening penalty of 10, a vacancy extension penalty of 0.5, and an EDNAFULL substitution matrix (EMBOSS version of NCBI NUC4.4). For the Niedel program to report the longest identity, the non-simplified option must be specified in the command line. The Niedel-marked "longest identity" output is calculated as follows: (Identical deoxyribonucleotides × 100) / (Alignment length – Total number of vacancies in the alignment) Signal peptide: A signal peptide is an amino acid sequence that attaches to the N-terminal portion of a protein and promotes its secretion outside the cell. The mature form of extracellular proteins lacks a signal peptide, which is cleaved during the secretion process.

[0044] Subsequence: The term “subsequence” refers to a polynucleotide in which one or more nucleotides are deleted from the 5’ and / or 3’ end of the coding sequence of a mature polypeptide; wherein the subsequence encodes fragment peptidase or lactonease activity.

[0045] Variant: The term "variant" refers to a peptidase or lactone that contains artificial mutations (i.e., substitutions, insertions (including extensions), and / or deletions (e.g., truncations)) at one or more positions compared to the parental peptidase or lactone. Substitution means replacing an amino acid occupying a position with a different amino acid; deletion means removing an amino acid occupying a position; and insertion means adding 1-5 amino acids (e.g., 1-3 amino acids, especially 1 amino acid) adjacent to and immediately following an amino acid occupying a position.

[0046] Wild-type: When referring to an amino acid or nucleic acid sequence, the term "wild-type" means that the amino acid or nucleic acid sequence is a naturally occurring or naturally occurring sequence. As used herein, the term "naturally occurring" refers to any substance found in nature (e.g., a protein, amino acid, or nucleic acid sequence). Conversely, the term "non-naturally occurring" refers to any substance not found in nature (e.g., recombinant nucleic acid and protein sequences produced in a laboratory, or modifications of wild-type sequences).

[0047] Sequence Overview

[0048] SEQ ID NO: 1 is the gDNA sequence encoding the peptidase of SEQ ID NO: 3.

[0049] SEQ ID NO: 2 is the complete polypeptide (including the signal peptide) translated from SEQ ID NO: 1.

[0050] SEQ ID NO: 3 is a mature peptidase.

[0051] SEQ ID NO: 4 is the gDNA sequence encoding the peptidase of SEQ ID NO: 6.

[0052] SEQ ID NO: 5 is the complete polypeptide (including the signal peptide) translated from SEQ ID NO: 4.

[0053] SEQ ID NO: 6 is a mature peptidase.

[0054] SEQ ID NO: 7 is the gDNA sequence encoding the peptidase of SEQ ID NO: 9.

[0055] SEQ ID NO: 8 is a complete polypeptide (including the signal peptide) translated from SEQ ID NO: 7.

[0056] SEQ ID NO: 9 is a mature peptidase.

[0057] SEQ ID NO: 10 is the gDNA sequence encoding the lactonease of SEQ ID NO: 12.

[0058] SEQ ID NO: 11 is a complete polypeptide (including the signal peptide) translated from SEQ ID NO: 10.

[0059] SEQ ID NO: 12 is a mature lactonease.

[0060] SEQ ID NO: 13 is the gDNA sequence encoding the lactonease of SEQ ID NO: 15.

[0061] SEQ ID NO: 14 is a complete polypeptide (including the signal peptide) translated from SEQ ID NO: 13.

[0062] SEQ ID NO: 15 is a mature lactonease.

[0063] SEQ ID NO: 16 is primer proA1.

[0064] SEQ ID NO: 17 is primer proA2. Detailed Implementation

[0065] This invention relates to oral care compositions comprising peptidases and / or lactones, preferably peptidases and lactones. As illustrated by examples in this application, the inventors of this invention have identified certain fungal-derived peptidases and lactones that are highly effective in preventing oral biofilm formation and / or reducing the risk of oral biofilm formation. Without being bound by theory, it is presumed that the peptidases and lactones of this invention degrade quorum-sensing molecules secreted by oral pathogens that form biofilms, thereby disrupting oral biofilm formation.

[0066] Therefore, the present invention provides an oral care composition comprising peptidase and / or lactonease, preferably peptidase and lactonease.

[0067] In one embodiment, the peptidase is a fungal peptidase, preferably obtained from Aspergillus ( ). Aspergillus ) species, most preferably Aspergillus niger ( Aspergillus niger ) peptidase.

[0068] In one embodiment, the lactonease is a fungal lactonease, preferably obtained from a species of the genus Aspergillus, most preferably from Aspergillus niger.

[0069] In one embodiment, the peptidase and lactonease are obtained from a species of the genus Aspergillus, most preferably Aspergillus niger.

[0070] In one embodiment, the peptidase is selected from the group consisting of: a) A polypeptide having at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 3; b) A polypeptide having at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 6; and c) A polypeptide having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 9.

[0071] SEQ ID NO: 3 is characterized as an aminopeptidase. Therefore, in one embodiment, the peptidase is an aminopeptidase, preferably an aminopeptidase of EC 3.4.11. EC 3.4.21-3.4.25 (endopeptidase) SEQ ID NO: 6 is characterized as a carboxypeptidase. Therefore, in one embodiment, the peptidase is a carboxypeptidase, preferably a carboxypeptidase of EC3.4.16-3.4.18 (such as EC 3.4.16, EC 3.4.17 or EC 3.4.18).

[0072] SEQ ID NO: 9 is characterized as an endopeptidase. Therefore, in one embodiment, the peptidase is an endopeptidase, preferably an endopeptidase of EC3.4.21-3.4.25 (such as EC 3.4.21, EC 3.4.22, EC 3.4.23, EC 3.4.24 or EC 3.4.25).

[0073] In a preferred embodiment, the peptidase is selected from the group consisting of: a) A polypeptide comprising SEQ ID NO: 3, substantially consisting of SEQ ID NO: 3, or consisting of SEQ ID NO: 3; b) A polypeptide comprising SEQ ID NO: 6, substantially consisting of SEQ ID NO: 6, or consisting of SEQ ID NO: 6; and c) A polypeptide comprising SEQ ID NO: 9, substantially consisting of SEQ ID NO: 9, or consisting of SEQ ID NO: 9; In one embodiment, the peptidase is present in an effective amount; preferably in an amount of about 1 ppm to about 500 ppm; more preferably in an amount of about 50 ppm to about 250 ppm; and most preferably in an amount of about 50 ppm to about 100 ppm.

[0074] In one embodiment, the lactonease is selected from the group consisting of: a) A polypeptide having at least 60%, for example, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 12; and b) A polypeptide having at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 15.

[0075] In one embodiment, the lactonease is an EC 3.1.1.81 lactonease.

[0076] In a preferred embodiment, the lactonease is selected from the group consisting of: a) A polypeptide comprising SEQ ID NO: 12, substantially consisting of SEQ ID NO: 12, or consisting of SEQ ID NO: 12; and b) A polypeptide comprising SEQ ID NO: 15, consisting essentially of SEQ ID NO: 15, or consisting of SEQ ID NO: 15.

[0077] In one embodiment, the lactonease is present in an effective amount; preferably in an amount of about 1 ppm to about 500 ppm; more preferably in an amount of about 50 ppm to about 250 ppm; and most preferably in an amount of about 100 ppm to about 200 ppm.

[0078] In one aspect, the oral care composition contains a peptidase selected from the group consisting of: (a) A polypeptide having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 2; (b) A polypeptide having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 3; c) A polypeptide having at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with the mature polypeptide of SEQ ID NO: 2; (d) A polypeptide encoded by a polynucleotide having at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with the mature polypeptide coding sequence of SEQ ID NO: 1 or its cDNA sequence; (e) A mature polypeptide derived from SEQ ID NO: 2, SEQ ID NO: 2, or SEQ ID NO: 3 by substitution, deletion, or addition of one or more amino acids; (f) A polypeptide derived from (a), (b), (c), (d), or (e), wherein the N-terminus and / or C-terminus have been extended by adding one or more amino acids; and (g) fragments of polypeptides of (a), (b), (c), (d) or (e); wherein the polypeptide has peptidase activity; preferably wherein the peptidase activity is determined according to peptidase activity assay I or peptidase activity assay II as described herein.

[0079] In a preferred embodiment, the peptidase has at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with the mature polypeptide of SEQ ID NO: 2. Preferably, the mature polypeptide of SEQ ID NO: 2 corresponds to amino acid residues 19 to 552 of SEQ ID NO: 2.

[0080] In a preferred embodiment, the peptidase has at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 3.

[0081] In a preferred embodiment, the peptidase comprises, is substantially composed of, or is composed of the mature polypeptide of SEQ ID NO: 2 or SEQ ID NO: 2. The preferred mature polypeptide of SEQ ID NO: 2 corresponds to amino acid residues 19 to 552 of SEQ ID NO: 2.

[0082] In a preferred embodiment, the peptidase comprises SEQ ID NO: 3 or a fragment thereof, is substantially composed of SEQ ID NO: 3 or a fragment thereof, or is composed of SEQ ID NO: 3 or a fragment thereof.

[0083] Peptidases may have an N-terminus and / or C-terminus extension of one or more amino acids (e.g., 1-5 amino acids).

[0084] In another aspect, the peptidase is derived from SEQ ID NO:2 through the substitution, deletion, or addition of one or more amino acids. In another aspect, the peptidase is derived from the mature polypeptide of SEQ ID NO:2 through the substitution, deletion, or addition of one or more amino acids. In another aspect, the peptidase is derived from SEQ ID NO:3 through the substitution, deletion, or addition of one or more amino acids.

[0085] In some embodiments, the peptidase is a variant of the parental peptidase (preferably SEQ ID NO: 3) that includes substitutions, deletions, and / or insertions at one or more sites. In one aspect, the peptidase is a variant of SEQ ID NO: 3, and the number of amino acid substitutions, deletions, and / or insertions introduced into the polypeptide of SEQ ID NO: 3 is up to 15, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15. The amino acid changes can be minor, i.e., conserved amino acid substitutions or insertions that do not significantly affect protein folding and / or activity; typically small deletions of 1-30 amino acids; small N-terminal or C-terminal extensions, such as methionine residues at the N-terminus; small linker peptides of up to 20-25 residues; or small extensions that facilitate purification by altering net charge or another function, such as a polyhistidine fragment, an antigenic epitope, or a binding module.

[0086] In one aspect, the oral care composition contains a peptidase selected from the group consisting of: (a) A polypeptide having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 5; (b) A polypeptide having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 6; c) A polypeptide having at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with the mature polypeptide of SEQ ID NO: 5; (d) A polypeptide encoded by a polynucleotide having at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with the mature polypeptide coding sequence of SEQ ID NO: 4 or its cDNA sequence; (e) A mature polypeptide derived from SEQ ID NO: 5, SEQ ID NO: 5, or SEQ ID NO: 6 by substitution, deletion, or addition of one or more amino acids; (f) A polypeptide derived from (a), (b), (c), (d), or (e), wherein the N-terminus and / or C-terminus have been extended by adding one or more amino acids; and (g) fragments of polypeptides of (a), (b), (c), (d) or (e); wherein the polypeptide has peptidase activity; preferably wherein the peptidase activity is determined according to peptidase activity assay I or peptidase activity assay II as described herein.

[0087] In a preferred embodiment, the peptidase has at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with the mature polypeptide of SEQ ID NO: 5. Preferably, the mature polypeptide of SEQ ID NO: 5 corresponds to amino acid residues 21 to 508 of SEQ ID NO: 5.

[0088] In a preferred embodiment, the peptidase has at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 6.

[0089] In a preferred embodiment, the peptidase comprises, is substantially composed of, or is composed of, the mature polypeptide of SEQ ID NO: 5 or SEQ ID NO: 5. The preferred mature polypeptide of SEQ ID NO: 5 corresponds to amino acid residues 21 to 508 of SEQ ID NO: 5.

[0090] In a preferred embodiment, the peptidase comprises SEQ ID NO: 6 or a fragment thereof, consists substantially of SEQ ID NO: 6 or a fragment thereof, or consists of SEQ ID NO: 6 or a fragment thereof.

[0091] Peptidases may have an N-terminus and / or C-terminus extension of one or more amino acids (e.g., 1-5 amino acids).

[0092] In another aspect, the peptidase is derived from SEQ ID NO:5 through the substitution, deletion, or addition of one or more amino acids. In another aspect, the peptidase is derived from the mature polypeptide of SEQ ID NO:5 through the substitution, deletion, or addition of one or more amino acids. In another aspect, the peptidase is derived from SEQ ID NO:6 through the substitution, deletion, or addition of one or more amino acids.

[0093] In some embodiments, the peptidase is a variant of the parental peptidase (preferably SEQ ID NO: 6) that includes substitutions, deletions, and / or insertions at one or more sites. In one aspect, the peptidase is a variant of SEQ ID NO: 6, and the number of amino acid substitutions, deletions, and / or insertions introduced into the polypeptide of SEQ ID NO: 6 is up to 15, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15. The amino acid changes can be minor, i.e., conserved amino acid substitutions or insertions that do not significantly affect protein folding and / or activity; typically small deletions of 1-30 amino acids; small N-terminal or C-terminal extensions, such as methionine residues at the N-terminus; small linker peptides of up to 20-25 residues; or small extensions that facilitate purification by altering net charge or another function, such as a polyhistidine fragment, an antigenic epitope, or a binding module.

[0094] In one aspect, the oral care composition contains a peptidase selected from the group consisting of: (a) A polypeptide having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 8; (b) A polypeptide having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 9; c) A polypeptide having at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with the mature polypeptide of SEQ ID NO: 8; (d) A polypeptide encoded by a polynucleotide having at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with the mature polypeptide coding sequence of SEQ ID NO: 7 or its cDNA sequence; (e) A mature polypeptide derived from SEQ ID NO: 8, SEQ ID NO: 8, or SEQ ID NO: 6 by substitution, deletion, or addition of one or more amino acids; (f) A polypeptide derived from (a), (b), (c), (d), or (e), wherein the N-terminus and / or C-terminus have been extended by adding one or more amino acids; and (g) fragments of polypeptides of (a), (b), (c), (d) or (e); wherein the polypeptide has peptidase activity; preferably wherein the peptidase activity is determined according to peptidase activity assay I or peptidase activity assay II as described herein.

[0095] In a preferred embodiment, the peptidase has at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with the mature polypeptide of SEQ ID NO: 8. Preferably, the mature polypeptide of SEQ ID NO: 8 corresponds to amino acid residues 23 to 526 of SEQ ID NO: 8.

[0096] In a preferred embodiment, the peptidase has at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 9.

[0097] In a preferred embodiment, the peptidase comprises, is substantially composed of, or is composed of, the mature polypeptide of SEQ ID NO: 8 or SEQ ID NO: 8. The preferred mature polypeptide of SEQ ID NO: 8 corresponds to amino acid residues 23 to 526 of SEQ ID NO: 8.

[0098] In a preferred embodiment, the peptidase comprises SEQ ID NO: 9 or a fragment thereof, is substantially composed of SEQ ID NO: 9 or a fragment thereof, or is composed of SEQ ID NO: 9 or a fragment thereof.

[0099] Peptidases may have an N-terminus and / or C-terminus extension of one or more amino acids (e.g., 1-5 amino acids).

[0100] In another respect, the peptidase is derived from SEQ ID NO:8 by substitution, deletion, or addition of one or more amino acids. In another respect, the peptidase is derived from the mature polypeptide of SEQ ID NO:8 by substitution, deletion, or addition of one or more amino acids. In another respect, the peptidase is derived from SEQ ID NO:9 by substitution, deletion, or addition of one or more amino acids.

[0101] In some embodiments, the peptidase is a variant of the parental peptidase (preferably SEQ ID NO: 9) that includes substitutions, deletions, and / or insertions at one or more sites. In one aspect, the peptidase is a variant of SEQ ID NO: 9, and the number of amino acid substitutions, deletions, and / or insertions introduced into the polypeptide of SEQ ID NO: 9 is up to 15, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15. The amino acid changes can be minor, i.e., conserved amino acid substitutions or insertions that do not significantly affect protein folding and / or activity; typically small deletions of 1-30 amino acids; small N-terminal or C-terminal extensions, such as methionine residues at the N-terminus; small linker peptides of up to 20-25 residues; or small extensions that facilitate purification by altering net charge or another function, such as a polyhistidine fragment, an antigenic epitope, or a binding module.

[0102] In one aspect, the oral care composition contains a lactone enzyme selected from the group consisting of: (a) A polypeptide having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 11; (b) A polypeptide having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 12; c) A polypeptide having at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with the mature polypeptide of SEQ ID NO: 11. (d) A polypeptide encoded by a polynucleotide having at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with the mature polypeptide coding sequence of SEQ ID NO: 10 or its cDNA sequence; (e) A mature polypeptide derived from SEQ ID NO: 11, SEQ ID NO: 11, or SEQ ID NO: 12 by substitution, deletion, or addition of one or more amino acids; (f) A polypeptide derived from (a), (b), (c), (d), or (e), wherein the N-terminus and / or C-terminus have been extended by adding one or more amino acids; and (g) fragments of polypeptides of (a), (b), (c), (d) or (e); wherein the polypeptide has lactonease activity; preferably wherein the lactonease activity is determined according to the lactonease activity assay described herein.

[0103] In a preferred embodiment, the lactonease has at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with the mature polypeptide of SEQ ID NO: 11. Preferably, the mature polypeptide of SEQ ID NO: 11 corresponds to amino acid residues 18 to 398 of SEQ ID NO: 11.

[0104] In a preferred embodiment, the lactonease has at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 12.

[0105] In a preferred embodiment, the lactonease comprises, is substantially composed of, or is composed of, the mature polypeptide of SEQ ID NO: 11 or SEQ ID NO: 11. The preferred mature polypeptide of SEQ ID NO: 11 corresponds to amino acid residues 18 to 398 of SEQ ID NO: 11.

[0106] In a preferred embodiment, the lactonease comprises SEQ ID NO: 12 or a fragment thereof, is substantially composed of SEQ ID NO: 12 or a fragment thereof, or is composed of SEQ ID NO: 12 or a fragment thereof.

[0107] Lactoneases may have an N-terminus and / or C-terminus extension of one or more amino acids (e.g., 1-5 amino acids).

[0108] In another respect, the lactonease is derived from SEQ ID NO: 11 by substitution, deletion, or addition of one or more amino acids. In another respect, the lactonease is derived from the mature polypeptide of SEQ ID NO: 11 by substitution, deletion, or addition of one or more amino acids. In another respect, the lactonease is derived from SEQ ID NO: 12 by substitution, deletion, or addition of one or more amino acids.

[0109] In some embodiments, the lactonease is a variant of the parental lactonease (preferably SEQ ID NO: 12) that includes substitutions, deletions, and / or insertions at one or more sites. In one aspect, the lactonease is a variant of SEQ ID NO: 12, and the number of amino acid substitutions, deletions, and / or insertions introduced into the polypeptide of SEQ ID NO: 12 is up to 15, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15. The amino acid changes can be minor, i.e., conserved amino acid substitutions or insertions that do not significantly affect protein folding and / or activity; typically small deletions of 1-30 amino acids; small N-terminal or C-terminal extensions, such as methionine residues at the N-terminus; small linker peptides of up to 20-25 residues; or small extensions that facilitate purification by altering net charge or another function, such as a polyhistidine fragment, an antigenic epitope, or a binding module.

[0110] In one aspect, the oral care composition contains a lactone enzyme selected from the group consisting of: (a) A polypeptide having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 14; (b) A polypeptide having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 15; c) A polypeptide having at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with the mature polypeptide of SEQ ID NO: 14; (d) A polypeptide encoded by a mature polypeptide coding sequence of SEQ ID NO: 13 or its cDNA sequence having at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity; (e) A mature polypeptide derived from SEQ ID NO: 14, SEQ ID NO: 14, or SEQ ID NO: 15 by substitution, deletion, or addition of one or more amino acids; (f) A polypeptide derived from (a), (b), (c), (d), or (e), wherein the N-terminus and / or C-terminus have been extended by adding one or more amino acids; and (g) fragments of polypeptides of (a), (b), (c), (d) or (e); wherein the polypeptide has lactonease activity; preferably wherein the lactonease activity is determined according to the lactonease activity assay described herein.

[0111] In a preferred embodiment, the lactonease has at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with the mature polypeptide of SEQ ID NO: 14. Preferably, the mature polypeptide of SEQ ID NO: 14 corresponds to amino acid residues 20 to 401 of SEQ ID NO: 14.

[0112] In a preferred embodiment, the lactonease has at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 15.

[0113] In a preferred embodiment, the lactonease comprises, is substantially composed of, or is composed of, the mature polypeptide of SEQ ID NO: 14 or SEQ ID NO: 14. The preferred mature polypeptide of SEQ ID NO: 14 corresponds to amino acid residues 20 to 401 of SEQ ID NO: 14.

[0114] In a preferred embodiment, the lactonease comprises SEQ ID NO: 15 or a fragment thereof, is substantially composed of SEQ ID NO: 15 or a fragment thereof, or is composed of SEQ ID NO: 15 or a fragment thereof.

[0115] Lactoneases may have an N-terminus and / or C-terminus extension of one or more amino acids (e.g., 1-5 amino acids).

[0116] In another respect, the lactonease is derived from SEQ ID NO: 14 by substitution, deletion, or addition of one or more amino acids. In another respect, the lactonease is derived from the mature polypeptide of SEQ ID NO: 14 by substitution, deletion, or addition of one or more amino acids. In another respect, the lactonease is derived from SEQ ID NO: 15 by substitution, deletion, or addition of one or more amino acids.

[0117] In some embodiments, the lactonease is a variant of the parental lactonease (preferably SEQ ID NO: 15) that includes substitutions, deletions, and / or insertions at one or more sites. In one aspect, the lactonease is a variant of SEQ ID NO: 15, and the number of amino acid substitutions, deletions, and / or insertions introduced into the polypeptide of SEQ ID NO: 15 is up to 15, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15. The amino acid changes can be minor, i.e., conserved amino acid substitutions or insertions that do not significantly affect protein folding and / or activity; typically small deletions of 1-30 amino acids; small N-terminal or C-terminal extensions, such as methionine residues at the N-terminus; small linker peptides of up to 20-25 residues; or small extensions that facilitate purification by altering net charge or another function, such as a polyhistidine fragment, an antigenic epitope, or a binding module.

[0118] Essential amino acids in any polypeptide, including the peptidases and lactoneases of the present invention, can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine scanning mutagenesis (Cunningham and Wells, 1989, Science 244: 1081-1085). In the latter technique, a single alanine mutation is introduced at each residue in the molecule, and the enzyme activity of the resulting molecule is tested to identify amino acid residues essential to the activity of the molecule. See also Hilton et al., 1996, J. Biol. Chem. 271: 4699-4708. The active site of an enzyme or other biological interaction can also be determined by physical analysis of the structure, such as by techniques like nuclear magnetic resonance, crystallography, electron diffraction, or photoaffinity labeling, along with mutagenesis of the amino acid at the putative contact site. See, for example, de Vos et al., 1992, Science 255: 306-312; Smith et al., 1992, J. Mol. Biol. 224: 899-904; Wlodaver et al., 1992, FEBSLett. 309: 59-64. The identity of essential amino acids can also be inferred from alignments with related peptides, and / or from sequence homology and conserved catalytic mechanisms with related peptides or peptide / protein families from a common ancestor (typically possessing similar three-dimensional structures, functions, and significant sequence similarities). Alternatively or additionally, protein structure prediction tools can be used for protein structure modeling to identify essential amino acids and / or active sites of peptides. See, for example, Jumper et al., 2021, “Highly accurate protein structure prediction with AlphaFold”, Nature 596: 583-589.

[0119] Using known mutagenesis, recombination, and / or tampering methods, followed by relevant screening procedures, one or more amino acid substitutions, deletions, and / or insertions can be made and tested, such as those disclosed by Reidhaar-Olson and Sauer, 1988, Science 241: 53-57; Bowie and Sauer, 1989, Proc. Natl. Acad. Sci. USA 86: 2152-2156; WO 95 / 17413; or WO 95 / 22625. Other methods that can be used include error-prone PCR, phage display (e.g., Lowman et al., 1991, Biochemistry 30: 10832-10837; US 5,223,409; WO 92 / 06204), and regional directed mutagenesis (Derbyshire et al., 1986, Gene 46: 145; Ner et al., 1988, DNA 7: 127).

[0120] Mutagenesis / reorganization methods can be combined with high-throughput automated screening methods to detect the activity of cloned mutagenic peptides expressed by host cells (Ness et al., 1999, Nature Biotechnology 17: 893-896). Mutagenic DNA molecules encoding active peptides can be recovered from host cells and rapidly sequenced using standard methods in the art. These methods allow for the rapid determination of the importance of individual amino acid residues within the peptide.

[0121] The oral care compositions of the present invention can be any type of oral care composition. Suitable forms of oral care compositions and methods for preparing these forms are well known in the art and are further described herein.

[0122] In one embodiment, the oral care composition is an internal oral care composition, such as toothpaste or toothpaste tablet, dental cream, mouthwash or mouthwash tablet, oral cleaner, lozenge, soft lozenge, chewing gum, sweets, candy, etc., which is designed to remove biofilms in the oral cavity, such as biofilms residing on teeth, oral soft tissues, and dentures residing in the oral cavity.

[0123] In one embodiment, the oral care composition is an external oral care composition, such as denture cleaning solution, denture cleaning tablets, denture cleaning powder, etc., which is designed to remove biofilm from dentures that have been removed from the mouth for cleaning.

[0124] In a preferred embodiment, the oral care composition is toothpaste.

[0125] In a preferred embodiment, the oral care composition is a mouthwash.

[0126] In a preferred embodiment, the oral care composition is an tablet.

[0127] In a preferred embodiment, the oral care composition is chewing gum.

[0128] The oral care composition of the present invention further comprises oral care ingredients that can vary depending on the type of oral care composition. Those skilled in the art can modify the oral care ingredients and their dosage according to the type of oral care composition and the desired characteristics of the oral care composition.

[0129] Although the oral care ingredients mentioned below are classified under a general heading based on their functionality, this is not to be construed as limiting, as ingredients may contain additional functionality as would be understood by a technician.

[0130] Toothpaste, tooth cream, mouthwash, and oral cleaning agents The internal oral care compositions of the present invention are in the form of toothpaste, tooth cream, mouthwash, and oral cleansing agents, and these internal oral care compositions may include ingredients and / or substances selected from the following categories:

[0131] toothpaste Toothpaste and tooth cream / tooth gel typically include abrasives, solvents, humectants, detergents / surfactants, thickeners and binders, buffers, flavorings, sweeteners, fluoride ions, therapeutic agents, colorants, and preservatives as oral care ingredients.

[0132] In a preferred embodiment, the present invention relates to oral care compositions in the form of toothpaste or tooth cream, which contain peptidases or lactones, preferably peptidases and lactones. The oral care compositions may contain at least one oral care ingredient selected from:

[0133] The oral care composition of the present invention may be a toothpaste comprising the following ingredients (in weight percent of the final toothpaste composition): Abrasive: 10% to 70% Wetting agent: 0% to 80% Thickener: 0.1% to 20% Binder: 0.01% to 10% Sweetener: 0.1% to 5% Foaming agent: 0% to 15% Enzymes (peptidases and / or lactoneases): 0.01% to 20%

[0134] mouthwash The mouthwashes and oral cleaning agents (including plaque removers) of the present invention typically include a carrier fluid, detergent / surfactant, buffer, flavoring agent, humectant, sweetener, therapeutic agent, fluoride ion source, colorant, and preservative as oral care ingredients.

[0135] In a preferred embodiment, the present invention relates to oral care compositions in the form of mouthwashes or oral cleansers, which contain peptidases or lactones, preferably peptidases and lactones. The oral care compositions may contain at least one oral care ingredient selected from:

[0136] The oral care composition of the present invention can be a mouthwash containing the following ingredients (in weight percent of the final mouthwash composition): Water: 0% to 70% Ethanol: 0% to 20% Wetting agent: 0% to 20% Surfactants: 0% to 2% Enzymes (peptidases and / or lactoneases): 0.01% to 20% Other ingredients: 0% to 2% (e.g., flavorings, sweeteners, fluoride ion sources).

[0137] Mouthwash compositions can be buffered in a suitable buffer solution (such as sodium citrate or sodium phosphate) in the pH range of 6-7.5.

[0138] The relevant oral care components applicable to toothpaste, tooth cream, mouthwash, and oral rinses are further detailed below. Technicians can modify oral care components depending on the type of oral care composition and the desired characteristics and / or activities of a particular oral care composition. Oral care compositions do not necessarily need to contain all the mentioned ingredients.

[0139] abrasive Abrasive and polishing materials can be incorporated into the oral care compositions of the present invention. According to the present invention, the abrasive and polishing materials include alumina and its hydrates (e.g., α-alumina trihydrate), magnesium trisilicate, magnesium carbonate, kaolin, aluminosilicates (e.g., calcined aluminum silicate and aluminum silicate), calcium carbonate, zirconium silicate, bentonite, silica, sodium bicarbonate, and powdered plastics (e.g., polyvinyl chloride), polyamide, polymethyl methacrylate, polystyrene, phenolic resin, melamine-formaldehyde resin, urea-formaldehyde resin, epoxy resin, powdered polyethylene, silica dry gel, hydrogel, and aerogel, etc.

[0140] Other suitable abrasives include calcium pyrophosphate, water-insoluble alkaline metaphosphates, polymetaphosphates, dicalcium phosphate and / or its dihydrates, dicalcium orthophosphate, tricalcium phosphate, and particulate hydroxyapatite. Mixtures of these substances may also be used.

[0141] Various types of silica dental abrasives are preferred because of their unique benefits, such as excellent tooth cleaning and polishing performance without excessive abrasion of tooth enamel or dentin, and their good compatibility with other possible components, such as metal ions and fluoride.

[0142] Depending on the oral care composition, the abrasive product may be present in 0% to 70% by weight, preferably 1% to 70%.

[0143] For toothpaste, the content of abrasive materials typically ranges from 10% to 70% by weight of the final toothpaste product.

[0144] wetting agent Humectants are used to prevent water from escaping from, for example, toothpaste and to prevent toothpaste from hardening when exposed to air. Some humectants also impart a desired sweetness to toothpaste and mouthwash compositions. Humectants suitable for oral care compositions according to the present invention include the following compounds and mixtures thereof: glycerin, polyols, sorbitol, xylitol, maltitol, lactitol, polyoxyethylene, polyethylene glycol (PEG), polypropylene glycol, propylene glycol, 1,3-propanediol, 1,4-butanediol, hydrogenated partially hydrolyzed polysaccharides, coconut oil fatty acids, amides of N-methyl-taurine, and Pluronic®.

[0145] The wetting agent is typically present in an amount of 0% to 80%, preferably 5% to 70% by weight.

[0146] Thickener / Binder Suitable thickeners and / or binders include silica, starch, tragacanth gum, xanthan gum, ebony gum, carrageenan gum (an extract of Irish moss), gum arabic, alginate, pectin, cellulose derivatives (e.g., hydroxyethyl cellulose, sodium carboxymethyl cellulose, hydroxypropyl cellulose, and hydroxyethylpropyl cellulose), polyacrylic acid and its salts, polyvinylpyrrolidone and carboxyvinyl polymers, and inorganic thickeners (e.g., amorphous silica compounds). These agents stabilize the oral care compositions of the present invention.

[0147] Thickeners may be present in toothpaste, tooth cream, gel, and mouthwash in amounts ranging from 0.1% to 20% by weight of the final product, and binders may be present in amounts ranging from 0.01% to 10% by weight of the final product.

[0148] Foaming agents and foaming regulators As foaming agents, soaps, anionic, cationic, nonionic, amphoteric, and / or facultative zwitterionic surfactants can be used alone or in combination. These can be present at levels of 0% to 15%, preferably 0.1% to 13%, and more preferably 0.25% to 10% by weight of the final product. Surfactants are only used to the extent that they do not inactivate enzymes and other components contained in the oral care composition. Useful surfactants include anionic, nonionic, and amphoteric compounds, preferably anionic compounds.

[0149] Examples of suitable surfactants include salts of higher alkyl sulfates, such as sodium lauryl sulfate or other suitable alkyl sulfates having 8 to 18 carbon atoms in the alkyl group; sodium lauryl sulfoacetate, salts of sulfonated monoglycerides of higher fatty acids, such as sodium coconut monoglyceride sulfonate or other suitable sulfonated monoglycerides of fatty acids having 10 to 18 carbon atoms; amide salts of higher fatty acids (e.g., 12 to 16 carbon atoms acids) with lower aliphatic amino acids, such as sodium N-methyl-N-palmitoyl taurate, sodium N-lauroyl sarcosinate, sodium N-myristoyl sarcosinate, and sodium N-palmitoyl sarcosinate; salts of such fatty acids with isotopic acids or with esters of glycerol monosulfates; sodium salts of monosulfate monoglycerides, such as hydrogenated coconut oil fatty acids; olefin sulfonates, such as chain olefin sulfonates or chain olefin sulfonates or mixtures thereof having 12 to 16 carbon atoms in the carbon chain of the molecule; and soaps of higher fatty acids, such as those having 12 to 18 carbon atoms, such as coconut oil fatty acids.

[0150] The cation of the salt can be sodium, potassium, or monoethanolamine, diethanolamine, or triethanolamine. Nonionic surfactants include sucrose / fatty acid esters, maltose / fatty acid esters, maltitol / fatty acid esters, malttriol / fatty acid esters, maltitol / fatty acid esters, maltpentol / fatty acid esters, malthexol / fatty acid esters, mahoheptaitol / fatty acid esters, sorbitan / fatty acid esters, lactose / fatty acid esters, lactinose / fatty acid esters, polyoxyethylene / polyoxypropylene copolymers, polyoxyethylene alkyl ethers, polyoxyethylene / fatty acid esters, fatty acid alkanolamides, polyoxyethylene sorbitan / fatty acid esters, polyoxyethylene / hydrogenated castor oil, and polyglycerol / fatty acid esters.

[0151] The preferred options are sodium lauryl sulfate, sodium dodecylbenzene sulfonate, and sodium lauryl sarcosinate.

[0152] Preferred foaming regulators include polyethylene glycol.

[0153] The foaming agent and foaming regulator may be present in an amount of 0% to 15%, preferably 0.01% to 10% by weight.

[0154] sweeteners Suitable sweeteners include, but are not limited to, saccharin and its water-soluble salts, dextrose, sucrose, lactose, maltose, levulose, aspartame, cyclohexanesulfonate, D-tryptophan, dihydrochalcone, acesulphame, steviol, levaudioside, glycyrrhizin, pellartine, kiwifruit protein, p-methoxycinnamaldehyde, hydrogenated starch hydrolysate, xylitol, sorbitol, erythritol, mannitol, and mixtures thereof.

[0155] The sweetener may be present in an amount of 0.001% to 60% by weight, preferably 0.01% to 50% by weight.

[0156] Flavorings Flavorings are typically present in small amounts, for example, from 0.01% to 5% by weight, particularly from 0.1% to 5%. Flavors that can be used in this invention include, but are not limited to, wintergreen oil, peppermint oil, spearmint oil, clove oil, menthol, anethole, methyl salicylate, eucalyptol, cinnamon, 1-menthyl acetate, sage, eugenol, celery oil, xanone, α-ionone, marjoram, lemon, orange, cranberry, propenyl ethyl guaiacol, cinnamon, vanillin, ethyl vanillin, piperaldehyde, 4-cis-heptenal, diacetyl, methyl p-tert-butylphenylacetate, carvone, eucalyptol, menthone, cinnamaldehyde, limonene, ocimene, n-decanol, citronellol, α-terpineol, methyl acetate, citronellol acetate, methyl eugenol, linalool, thymol, rosemary oil, allspice oil, diatomaceous earth oil, eucalyptus oil, and mixtures thereof.

[0157] The coolant may be added to the composition as part of the flavoring system or separately. Preferred coolants in the compositions of the present invention are p-menthane carboxylamide reagents, such as N-ethyl-p-menthane-3-carboxamide (commercially known as "WS-3"), menthol, 3-1-menthoxy-1,2-propanediol ("TK-10"), menthone glycerol acetal ("MGA"), menthyl lactate, and mixtures thereof.

[0158] Whitening agent / bleaching agent The whitening / bleaching agent includes H2O2 and can be added in an amount of less than 5%, preferably from 0.05% to 4%, based on the weight of the final composition.

[0159] Other bleaching components that may be included in this invention include peroxydiphosphate, urea, peroxides, metal peroxides (e.g., calcium peroxide, sodium peroxide, strontium peroxide, magnesium peroxide), hypochlorites (e.g., sodium hypochlorite), and salts of perborate, persilicate, superphosphate, and percarbonate (e.g., sodium perborate, potassium persilicate, and sodium percarbonate). Peroxide compounds can be stabilized by adding triphenylmethane dyes, chelating agents, or antioxidants (e.g., butylated hydroxyanisole (BHA) or butylated hydroxytoluene (BHT)).

[0160] solvent Solvents are typically added to the compositions of the present invention in an amount sufficient to make the composition flowable in the case of a toothpaste, tooth cream, or gel, or to dissolve other components of the composition in the case of a mouthwash or oral rinse.

[0161] Suitable solvents include water, ethanol, and water / ethanol mixtures, which can be present in amounts from 0.1% to 70%.

[0162] antimicrobial agents The present invention also includes water-soluble antimicrobial agents, such as chlorhexidine, triclosan, digluconate, hexetine, alexicon, and quaternary ammonium antimicrobial compounds; and may also include water-soluble sources of certain metal ions, such as zinc, copper, silver, and stannous chloride (e.g., zinc chloride, copper chloride, stannous chloride, and silver nitrate).

[0163] Because of the slow dissolution of these zinc salts in saliva, slightly soluble zinc salts such as zinc citrate, C14-alkyl zinc maleate, zinc benzoate, zinc hexanoate, and zinc carbonate can also be included in the compositions of the present invention to prolong the antimicrobial efficacy of zinc ions.

[0164] The antimicrobial agent can be present in an amount of 0% to 50% by weight, preferably 0.01% to 40% by weight, and most preferably 0.1% to 30% by weight.

[0165] Dental plaque control agent The compositions of the present invention may contain tartar control agents, such as inorganic phosphorus tartar control agents, which include any pyrophosphate, such as disodium pyrophosphate, dipotassium pyrophosphate, tetrapotassium pyrophosphate, tetrasodium pyrophosphate, and mixtures thereof.

[0166] Organophosphorus compounds that can be used as tartar control agents include polyphosphonates, such as disodium ethane-1-hydroxy-1,1-diphosphate (EHDP), methane diphosphonic acid, and 2-phosphonobutane-1,2,4-tricarboxylic acid.

[0167] The tartar control agent may be present in an amount of 0% to 10% by weight, preferably 0.1% to 5% by weight.

[0168] preservative Suitable preservatives include sodium benzoate, potassium sorbate, parabens, methylparaben, ethylparaben, propylparaben, citric acid, calcium citrate, and mixtures thereof.

[0169] The preservative may be present in an amount of 0% to 40% by weight, preferably 0.01% to 30% by weight.

[0170] Fluoride ion source The compositions of the present invention may further contain components that can be used as fluoride ion sources. Preferred soluble fluoride ion sources include sodium fluoride, potassium fluoride, stannous fluoride, indium fluoride, sodium monofluorophosphate, sodium hexafluorosilicate, zinc fluoride, lithium fluoride, aluminum fluoride, acid fluorophosphate, ammonium hydrogen fluoride, titanium tetrafluoride, and fluorinated amines.

[0171] The preferred sources of fluoride ions are sodium fluoride and sodium monofluorophosphate.

[0172] The fluoride ion source can be present in an amount of 0% to 20% by weight, preferably 0.01% to 15% by weight, and most preferably 0.1% to 10% by weight.

[0173] In a preferred embodiment, at least one oral care ingredient is a fluoride ion source; preferably, the fluoride ion source is selected from the group consisting of sodium fluoride, calcium fluoride, stannous fluoride, or sodium monofluorophosphate.

[0174] Colorant Colorants or pigments suitable for oral care compositions of the present invention include non-toxic, water-insoluble inorganic pigments such as titanium dioxide and chromium oxide green, ultramarine blue and pink, and iron oxide, as well as water-insoluble dye lakes prepared by extending calcium or aluminum salts of FD&C dyes onto alumina, such as FD&C Green Lake No. 1, FD&C Blue Lake No. 2, FD&C Red Lake No. 30, FD&C Yellow Lake No. 16, and FD&C Yellow Lake No. 10.

[0175] The preferred light-blocking agent is titanium dioxide.

[0176] The colorant may be present in an amount of 0% to 20% by weight, preferably 0.01% to 15% by weight, and most preferably 0.1% to 10% by weight.

[0177] buffer The oral care composition of the present invention may also include a buffer, i.e. a pH adjuster, such as alkali metal hydroxides, carbonates, sesquicarbonates, borates, silicates, phosphates, imidazoles, and mixtures thereof.

[0178] Specific buffers include monosodium phosphate, trisodium phosphate, sodium hydroxide, potassium hydroxide, alkali metal carbonates, sodium carbonate, imidazole, pyrophosphate, sodium citrate, hydrochloric acid, sodium hydroxide, triethanolamine, triethylamine, lactic acid, malic acid, fumaric acid, tartaric acid, phosphoric acid, and mixtures thereof.

[0179] The buffer can be present in an amount of 0% to 10% by weight, preferably 0.01% to 5% by weight.

[0180] chewing gum When the oral composition according to the invention is chewing gum, it can be any known type of chewing gum, such as optionally coated chewing gum sheets, and sticks or chewing gum provided in any desired shape in response to the intended use. Chewing gum articles can have any quality, including bubble gum quality.

[0181] In a preferred embodiment, the present invention relates to oral care compositions in the form of chewing gum, which contain peptidases or lactones, preferably peptidases and lactones. The oral care compositions may contain at least one oral care ingredient selected from: elastomers, softeners, plasticizers, emulsifiers, waxes, colorants, sweeteners, flavorings, leavening agents, and thickeners.

[0182] Collagen base components Traditionally, chewing gum is considered to consist of a water-insoluble or base portion and a water-soluble portion containing flavorings, sweeteners, and colorings. The gum base portion of chewing gum is the chewing substance that imparts the chewing characteristics of the final product. It defines the release profiles of flavorings and sweeteners and plays a significant role in chewing gum products. Flavorings, sweeteners, and colorings can be considered to contribute to the sensory appeal of chewing gum. There are no limitations on the chewing gum base used in chewing gum products according to the present invention. Conventional chewing gum bases can be obtained, for example, from Dansk Tyggegummi Fabrik A / S, LA. Dreyfus or Cafasa Gum SIA are generally suitable, but specially manufactured formulations may also be used. The formulation depends on the desired type of chewing gum or the desired structural type. Suitable raw materials for gum bases include substances in accordance with the U.S. Gum Base Regulations—Title 21, Section 172,615 of the Federal Regulations and other national and international lists (or positive lists), and include elastomers, resins, waxes, polyvinyl acetate, oils, fats, emulsifiers, fillers, and antioxidants.

[0183] The adhesive base typically comprises 15% to 90% by weight of the final product, preferably 30% to 40% by weight, and more preferably 5% to 25% by weight.

[0184] Elastomers provide chewiness, elasticity, or resilience to the matrix and control the release of bubbles and flavor in the final chewing gum. They can be any water-insoluble polymer known in the art. They include styrene-butadiene copolymers (SBR) and non-SBR types, both natural and synthetic. Examples of natural elastomers include, but are not limited to, rubbers (e.g., rubber latex (natural rubber)) and guar gum, as well as gums (e.g., chicle, jelutong, balata, guttapercha, lechi capsi, sorva, crown gum, nispero, rosedinha, perillo, nigergutta, tunu, gutta kay, pendar, leche de vaca, chiquibul, crown gum, etc.), and mixtures thereof. Examples of synthetic elastomers include, but are not limited to, polyisobutylene, isobutylene-isoprene copolymer (butyl rubber), polyethylene, polybutadiene, styrene-butadiene copolymer, polyisoprene, and mixtures thereof.

[0185] The amount of elastomer (rubber) used in a gum base composition will vary considerably depending on various factors, such as the type of gum base used (viscous or conventional, aerated or standard), the desired consistency of the gum base composition, and other components used in the composition to prepare the final chewing gum product. Typically, based on the total weight of the gum base composition, the elastomer is present in the gum base composition in an amount of about 15% to about 60%, preferably about 25% to about 30% by weight.

[0186] Elastomer solvents help soften or plasticize elastomeric components. In this way, they provide swelling properties to chewable substances.

[0187] Elastomer solvents include, but are not limited to, natural rosin esters and synthetic derivatives such as terpenes. Examples of elastomeric solvents suitable for use herein include tall oil rosin esters; partially hydrogenated wood rosin and resin rosin; glycerol esters of wood rosin and resin rosin, partially hydrogenated wood rosin / resin rosin glycerol esters, partially dimerized wood rosin and resin rosin glycerol esters, polymerized wood rosin and resin rosin glycerol esters, and tall oil rosin glycerol esters; deodorized glycerol esters of wood rosin; pentaerythritol esters of wood rosin and resin rosin; partially hydrogenated wood rosin and resin rosin; methyl esters of partially hydrogenated wood rosin; methyl esters, glycerol esters, and pentaerythritol esters of rosin and modified rosin (e.g., hydrogenated, dimerized, and polymerized rosin); terpene resins (e.g., polymers of α-pinene or β-pinene), terpene resins; polyterpenes; and mixtures thereof. The elastomer solvent can be used in the adhesive composition in an amount of about 2% to about 40%, preferably about 7% to about 15% by weight of the adhesive composition.

[0188] Polyvinyl acetate provides extensibility or elasticity to the gum base. They also affect chewing swelling, softness and air bubbles, hydrophilic characteristics, and flavor release.

[0189] The amount of polyvinyl acetate of different molecular weights present in the gum base composition should effectively provide the desired chewing properties of the finished chewing gum, such as integrity, softness, chewing swelling, film-forming characteristics, hydrophilic characteristics, and flavor release. The total amount of polyvinyl acetate used in the gum base composition is typically from about 45% to about 92% by weight of the total gum base composition. The vinyl polymer may have a molecular weight from about 2000 Da to about 95,000 Da.

[0190] Typically, low molecular weight polyvinyl acetate has a weight-average molecular weight of about 2,000 Da to about 14,000 Da. Medium molecular weight polyvinyl acetate typically has a weight-average molecular weight of about 15,000 Da to 55,000 Da. High molecular weight polyvinyl acetate typically has a weight-average molecular weight of about 55,000 Da to about 95,000 Da, but can be as high as 500,000 Da.

[0191] Waxes, fats, and oils plasticize elastomer blends and improve the elasticity of the gum base. Waxes provide a soft or firm chewiness, affect flavor release, and provide swelling and smoothness to the gum base. Fats and oils provide a soft chewiness. Fats, oils, and waxes can be used alone or in combination, or the gum base can be wax-free.

[0192] When waxes are used, they can be of mineral, animal, plant, or synthetic origin. Non-limiting examples of mineral waxes include petroleum waxes (such as paraffin and microcrystalline wax), animal waxes (including beeswax), plant waxes (including carnauba wax, candelilla wax, rice bran wax, fine-stemmed needle wax, linseed wax, and sugarcane wax), synthetic waxes (including those produced by the Fischer-Tropsch synthesis process), and mixtures thereof.

[0193] Suitable oils and fats for use in chewing gum compositions include hydrogenated or partially hydrogenated vegetable or animal fats, such as cottonseed oil, soybean oil, coconut oil, palm kernel oil, tallow, hydrogenated tallow, lard, cocoa butter, lanolin, etc.; fatty acids such as palmitic acid, oleic acid, stearic acid, linoleic acid, lauric acid, myristic acid, caproic acid, caprylic acid, capric acid, decanoic acid, or esters and salts (such as sodium stearate and potassium stearate). When used, these ingredients are typically present in amounts up to about 7% by weight of the chewing gum composition, and preferably up to about 3.5% by weight of the chewing gum composition.

[0194] Hydrogenated vegetable oils, including soybean oil and cottonseed oil, are preferred softeners and can be used alone or in combination. These softeners provide the gum-based composition with a good texture and a soft chewy character. These softeners are typically used in amounts from about 5% to about 14% by weight of the gum-based composition.

[0195] Emulsifiers help disperse the immiscible components of a gum base composition into a single, stable system. They provide hydrophilic properties to the gum base and help plasticize the resin and polyvinyl acetate. They also affect the softness and bubble characteristics of the matrix. Typical emulsifiers include acetylated monoglycerides, glyceryl monostearate, lecithin, fatty acid monoglycerides, diglycerides, propylene glycol monostearate, lecithin, triacetin, triacetic acid glycerides, and mixtures thereof.

[0196] Preferred emulsifiers are glyceryl monostearate and acetylated glyceryl monostearate. These are used as plasticizers. The emulsifier can be used in an amount of about 2% to about 15% by weight of the rubber-based composition, and preferably in an amount of about 7% to about 11% by weight of the rubber-based composition.

[0197] Fats, oils, waxes, emulsifiers, and certain sugar swelling agents are often combined and referred to as softeners. Due to the low molecular weight of these components, softeners can penetrate the basic structure of the gum base, giving it plasticity and less stickiness. The aforementioned useful plasticizers and softeners include lanolin, palmitic acid, oleic acid, stearic acid, sodium stearate, potassium stearate, glyceryl triacetate, glyceryl lecithin, glyceryl monostearate, propylene glycol monostearate, acetylated monoglycerides, glycerol, fully unsaturated vegetable oils (e.g., non-hydrogenated cottonseed oil, hydrogenated vegetable oil, petroleum wax, sorbitan monostearate, tallow, etc.) and mixtures thereof, and also include high-fructose corn syrup, corn syrup, sorbitol solutions, hydrogenated starch hydrolysates, and mixtures thereof.

[0198] The amount of softener present should be an effective amount to provide the desired chewing expansion and softness of the finished chewing gum. When used as a softener, these materials are typically used in the gum base composition in an amount of up to about 25% by weight of the gum base composition, preferably about 1% to about 17%.

[0199] The gum base may further contain surfactants. Examples of suitable surfactants include polyoxyethylene (20) sorbitan monooleate, polyoxyethylene (20) sorbitan monolaurate, polyethylene (4) sorbitan monolaurate, polyoxyethylene (20) sorbitan monopalmitate, polyoxyethylene (20) sorbitan monostearate, polyoxyethylene (4) sorbitan monostearate, polyoxyethylene (20) sorbitan tristearate, polyoxyethylene (5) sorbitan monooleate, polyoxyethylene (20) sorbitan trioleate, sorbitan monolaurate, etc. The amount of surfactant present should effectively provide the desired softness of the finished chewing gum. Typically, surfactants are used in the matrix in an amount of about 0.5% to about 3.0% by weight, based on the total weight of the gum base.

[0200] The gum base composition of the present invention may also include an effective amount of filler, sometimes referred to as a swelling agent. These materials increase hardness and swelling and affect the texture and flavor release of the chewing gum. Useful fillers include organic and inorganic compounds (mineral adjuvants), such as calcium carbonate, magnesium carbonate, heavy calcium carbonate, magnesium silicate, calcium phosphate, cellulose polymers, clay, alumina, aluminum hydroxide, aluminum silicate, talc, tricalcium phosphate, dicalcium phosphate, and mixtures thereof. These fillers or adjuvants can be used in the gum base composition in various amounts. The amount of filler present should effectively provide the desired flavor release and integrity of the finished chewing gum. Typically, fillers can be used in the gum base composition in an amount of about 1% to about 40% by weight of the gum base composition, and preferably about 5% to about 20%.

[0201] The gum base may also contain antioxidants to provide improved stability, reduce any oily odor, and provide a longer shelf life. Typical, non-limiting examples of antioxidants are butylated hydroxytoluene (BHT), butylated hydroxyanisole (BHA), and propyl gallate. Mixtures thereof may also be used.

[0202] Other adhesive components The remaining ingredients in the chewing gum composition are conventional and typically comprise 10% to 85% by weight of the final product.

[0203] Examples include sweeteners, softeners, colorants, leavening agents, thickeners, and flavoring agents commonly used in the types and amounts of chewing gum.

[0204] Suitable flavorings are those spices known to those skilled in the art, such as natural and artificial flavorings. These flavorings may be selected from synthetic flavoring oils and flavoring aromatics and / or oils, oleoresins and extracts derived from plants, leaves, flowers, fruits, etc., and combinations thereof. Representative, non-limiting flavoring oils include spearmint oil, cinnamon oil, wintergreen oil (methyl salicylate), peppermint oil, clove oil, laurel oil, anise oil, eucalyptus oil, thyme oil, cedarwood leaf oil, nutmeg oil, sweet pepper oil, sage oil, mace oil, bitter almond oil, and cinnamon oil. Other useful flavorings are artificial, natural, and synthetic fruit flavorings (such as vanilla and citrus oils, including lemon, orange, lime, and grapefruit) and fruit essences (including apple, pear, peach, grape, strawberry, raspberry, cherry, plum, pineapple, apricot, etc.). These flavorings can be used in liquid or solid form and can be used alone or in combination. Commonly used spices include peppermint, such as peppermint, menthol, artificial vanilla, cinnamon derivatives, and various fruit spices, which can be used alone or in combination.

[0205] Other useful flavoring agents include aldehydes and esters, such as cinnamyl acetate, cinnamaldehyde, diethyl citrate, dihydrocarboxylate, eugenol formate, and p-methyl anisole. Generally, any flavoring agent or food additive can be used.

[0206] Other examples of aldehyde flavoring agents include, but are not limited to, acetaldehyde (apple), benzaldehyde (cherry, almond), anisaldehyde (licorice, anise), cinnamaldehyde (cinnamon), citral (α-citral, lemon, lime), neraldehyde (β-citral, lemon, lime), decanal (orange, lemon), ethyl vanillin (vanilla, butter), heliotrope (piperaldehyde, vanillin), vanillin (vanilla, butter), α-pentylcinnamaldehyde (spicy fruit flavoring), butyraldehyde (butter, cheese), pentanalaldehyde (butter, cheese), and more. Veratral (various types), decanal (citrus fruits), aldehyde C-8 (citrus fruits), aldehyde C-9 (citrus fruits), aldehyde C-12 (citrus fruits), 2-ethylbutanal (berry fruits), hexenal (trans-2-hexenal, berry fruits), toluenealdehyde (cherries, almonds), veratral (vanilla), 2,6-dimethyl-5-heptanal (melon aldehyde, melon aldehyde), 2,6-dimethyloctanal (green fruits), and 2-dodecanoal (citrus fruits), cherry, grape, strawberry shortbread, and mixtures thereof.

[0207] The amount of flavoring agent used herein is typically influenced by factors such as the type of the final chewing gum composition, the individual flavor profile, the gum used, and the desired flavor intensity. Therefore, the amount of flavoring agent can be varied to achieve the desired results in the final product, and such variations are within the capabilities of those skilled in the art without requiring excessive experimentation. In chewing gum compositions, flavoring agents are typically present in amounts from about 0.02% to about 5% by weight of the chewing gum composition.

[0208] Chewing gum compositions typically include expanding agents. These expanding agents (carders, fillers) can be water-soluble and include, but are not limited to, expanding agents selected from the group consisting of: monosaccharides, disaccharides, polysaccharides, sugar alcohols, and mixtures thereof; sorbitol, xylitol, maltitol, mannitol, isomaltitol (a racemic mixture of α-D-glucopyranosyl-1,6-mannitol and α-D-glucopyranosyl-1,6-sorbitol, marketed by Suddeutsche Zucker under the trade name Palatinit). TM The ingredients include: glycerin, aspartame, Lycasin® glycerin, galactitol, acetylsupan potassium, saccharin and its salts, cyclohexanesulfonate and its salts, neohesperidin dihydrochalcone, glycyrrhizic acid and its salts, thaumantine and sucralose and mixtures thereof, or mixtures thereof with other suitable sweeteners; maltodextrin; hydrogenated starch hydrolysate; hydrogenated hexose; hydrogenated disaccharide; minerals such as calcium carbonate, talc, titanium dioxide, dicalcium phosphate, cellulose, etc., and mixtures thereof. The leavening agent may be used in an amount up to about 60% by weight of the chewing gum composition, preferably about 25% to about 60%.

[0209] Chewing gum compositions may also include high-intensity sweeteners (sweeteners). The sweetness intensity of high-intensity sweeteners is substantially greater than that of sucrose. Examples of suitable high-intensity sweeteners include: a) Water-soluble, naturally occurring potent sweeteners, such as dihydrochalcone, monoline, steviol, glycyrrhizin, flavanone alcohols and L-aminodicarboxylic acid, aminoalkyl ester amides, such as those disclosed in U.S. Patent No. 4,619,834, and mixtures thereof; b) Water-soluble artificial sweeteners, including soluble saccharin salts (e.g., sodium or calcium saccharin), cyclohexanesulfonate, sodium, ammonium, or calcium salts of 3,4-dihydro-6-methyl-1,2,3-oxathiazin-4-one-2,2-dioxide, potassium salts of 3,4-dihydro-6-methyl-1,2,3-oxathiazin-4-one-2,2-dioxide (acetylsupan potassium), free acid form of saccharin, and mixtures thereof; c) Dipeptide-based sweeteners, including sweeteners derived from L-aspartic acid (e.g., methyl 1-aspartic-L-phenylalanine (aspartame) and the material described in U.S. Patent No. 3,492,131), L-α-aspartic-N-(2,2,4,4-tetramethyl-3-thiecyclobutyl)-D-propanamide hydrate (alitame), methyl esters of L-aspartic-L-phenylglycerol and L-aspartic-L-2,5-dihydrophenyl-glycine, L-aspartic-2,5-dihydro-L-phenylalanine, L-aspartic-L-(1-cyclohexene)-alanine, and mixtures thereof; d) Water-soluble potent sweeteners derived from naturally occurring water-soluble sweeteners, such as chlorinated derivatives of common sugars (sucrose), such as chlorodeoxy sugar derivatives (e.g., derivatives of chlorodeoxysucrose or chlorodeoxygalactosucrose), known for example under the product name Sucralose®; examples of chlorodeoxysucrose and chlorodeoxygalactosucrose derivatives include, but are not limited to: 1-chloro-1'-deoxysucrose; 4-chloro-4-deoxy-α-D-galactopyranosyl-α-D-fructofuranoside, or 4-chloro-4-deoxygalactosucrose; 4-chloro-4-deoxy-α-D-galactopyranosyl-1-chloro-deoxy-β-D-fructofuranoside, or 4,1'-dichloro-4,1'-dideoxygalactosucrose; 1',6'-dichloro-1',6'-dideoxysucrose; 4-chloro-4-deoxy-α- D-galactopyranosyl-1,6-dichloro-1,6-dideoxy-β-D-fructofuranosyl, or 4,1',6'-trichloro-4,1',6'-trideoxygalactosucrose; 4,6-dichloro-4,6-dideoxy-α-D-galactopyranosyl-6-chloro-6-deoxy-β-D-fructofuranosyl, or 4,6,6'-trichloro-4,6,6'-trideoxygalactosucrose; 6,1',6'-trichloro-6,1',6'-trideoxysucrose; 4,6-dichloro-4,6-dideoxy-α-D-galactopyranosyl-1,6-dichloro-1,6-dideoxy-β-D-fructofuranoside, or 4,6,1',6'-tetrachloro-4,6,1',6'-tetradeoxygalactosucrose; and 4,6,1',6'-tetradeoxy-sucrose, mixtures thereof; and e) Protein-based potent sweeteners, such as Thaumaoccous daniclii (Kiwi sweet protein I and II). The amount of sweetener used in the chewing gum composition will vary depending on the sweetener selected for a particular chewing gum. Therefore, for any given sweetener, a sufficient amount of sweetener is used to provide the desired level of sweetness. Based on the total weight of the chewing gum composition, the aforementioned sugar sweeteners and sugar alcohols are typically used in an amount of about 1% to about 70% by weight, preferably about 40% to about 50% by weight. Based on the total weight of the chewing gum composition, the aforementioned strong sweeteners are typically used in an amount of up to about 1% by weight, preferably about 0.05% to about 0.4% by weight.

[0210] The colorants useful in this invention are used in amounts that effectively produce the desired color. These colorants include pigments that can be incorporated in amounts up to about 6% by weight of the chewing gum composition. Preferred pigments, namely titanium dioxide, can be incorporated in amounts up to about 2% by weight of the chewing gum composition, preferably less than about 1%. Colorants may also include natural food pigments and dyes suitable for food, pharmaceutical, and cosmetic applications. These colorants are referred to as FD&C. dyes and lakes. Acceptable materials for the foregoing uses are preferably water-soluble. Illustrative and non-limiting examples include indigo dye known as FD&C. Blue 2, which is a disodium salt of 5,5-indigo disulfonic acid. Similarly, dye known as FD&C. Green 1 comprises a triphenylmethane dye and is a monosodium salt of 4-[4-(N-ethyl-N-p-thiobenzylamino)diphenylmethylene]-[1-(N-ethyl-N-p-thiobenzyl)-δ-2,5-cyclohexadieneimine].

[0211] Examples of thickeners include methylcellulose, alginate, carrageenan, xanthan gum, gelatin, carob gum, tragacanth gum and locust bean gum, emulsifiers (such as lecithin and glyceryl monostearate), acidifiers (such as malic acid, adipic acid, citric acid, tartaric acid, fumaric acid) and mixtures thereof.

[0212] The plasticizers, softeners, emulsifiers, waxes, and antioxidants discussed above that are suitable for gum bases can also be used in chewing gum compositions.

[0213] Active chewing gum ingredients The oral care composition of the present invention in the form of chewing gum may also contain various active ingredients, such as antimicrobial agents, zinc salts, fluorides, and urea.

[0214] Furthermore, if desired, the oral composition according to the invention may include any other active ingredients, such as anti-caries agents, anti-calculus agents, anti-plaque agents, anti-periodontal agents, antifungal agents, anti-smoking agents, anti-cold agents, anti-gingivitis agents, etc.

[0215] The antimicrobial agent used in the composition can be any of a variety of cationic antimicrobial agents, such as quaternary ammonium compounds (e.g., hexadecyl pyridine chloride) and substituted guanidines (e.g., chlorhexidine and the corresponding compound alexidin). Mixtures of cationic antimicrobial agents can also be used in this invention.

[0216] Antimicrobial quaternary ammonium compounds include those in which one or two substituents on the quaternary nitrogen have a carbon chain length of about 8 to 20, typically 10 to 18 carbon atoms (typically alkyl groups), while the remaining substituents (typically alkyl or benzyl groups) have a smaller number of carbon atoms (e.g., 1 to 7 carbon atoms), typically methyl or ethyl groups. Dodecyltrimethylammonium bromide, tetradecylpyridine chloride, tetradecylethylpyridine chloride, dodecyldimethyl(2-phenoxyethyl)ammonium bromide, benzyldimethylstearylammonium chloride, hexadecylpyridine chloride, quaternized 5-amino-1,3-bis(2-ethyl-hexyl)-5-methylhexahydropyrimidine, and benzyl chloride are typical examples of quaternary ammonium antibacterial agents. Other compounds are bis[4-(R-amino)-1-pyridine]alkanes, as disclosed in U.S. Patent 4,206,215 to Bailey, issued June 3, 1980 (which is incorporated herein by reference). Pyridine compounds are preferred quaternary ammonium compounds.

[0217] Cationic antimicrobial agents are typically used in the compositions of the present invention at levels of about 0.02% to about 1%, preferably about 0.3% to about 0.7%, and most preferably about 0.3% to about 0.5%.

[0218] As readily soluble zinc salts, any physiologically acceptable, readily soluble zinc salt of inorganic or organic acids can be used in principle, which is capable of releasing zinc ions and is approved for its intended use, such as in food, cosmetic, or pharmaceutical products. Non-limiting examples include, for example, zinc citrate, zinc sulfate, zinc lactate, zinc chloride, zinc acetate, and mixtures thereof. Among these salts, zinc acetate is preferred.

[0219] The zinc salt used must be readily soluble to ensure that the amount of zinc ions released in the oral cavity within the appropriate time period is effective for the target purpose.

[0220] Advantageously, the zinc salt is present in the oral composition in an amount of 0.001% to 1.25% by weight. The amount used depends on the form of application and the intended use, and is adjusted such that the amount of zinc ions released is effective for the intended use.

[0221] As a masking salt, at least one salt selected from sodium chloride, ammonium chloride, and physiologically acceptable alkali metals, alkaline earth metals, and / or ammonium carbonate is used.

[0222] Alkali metals, particularly sodium or potassium, and alkaline earth metals, preferably calcium or magnesium. Particularly preferred masking salts are sodium carbonate, potassium carbonate and magnesium carbonate, sodium chloride, ammonium chloride and mixtures thereof.

[0223] Flavor-masking salts are advantageously used in oral compositions in amounts of 0.05% to 6.25% by weight, more preferably 0.25% to 3.50% by weight, for example 0.50% to 2.50% by weight.

[0224] In each case, the amount of masking salt used to mask the taste of zinc can be determined by those skilled in the art and depends on the specific zinc salt in question and the chosen form of application.

[0225] Urea is used in anti-caries products to neutralize acids produced in dental plaque after eating or drinking. In addition to urea, the composition may also contain pharmacologically acceptable substances capable of releasing urea under predominantly oral conditions. Examples include salts and addition compounds between urea and inorganic compounds such as magnesium sulfate, calcium phosphate, and sodium chloride.

[0226] The urea content of the composition according to the invention varies between 0.05% and 80% by weight, preferably between 0.2% and 25% by weight.

[0227] The chewing gum composition can be prepared using standard techniques and equipment known to those skilled in the art. The useful apparatus according to the invention also includes mixing and pulping devices.

[0228] Tablets and soft tablets Tablets are flavored dosage forms of medicine intended to be inhaled and held in the mouth or throat. They may contain vitamins, antibiotics, antiseptics, local anesthetics, antihistamines, decongestants, corticosteroids, astringents, analgesics, aromatics, soothing agents, or combinations of these ingredients. Tablets can come in various shapes, most commonly flat, round, octagonal, and biconvex. Another type, called bacilli, comes in short rod or cylindrical shapes. Softer types of tablets are called soft tablets, which consist of a drug in a gelatin or glycerin-gelatin matrix or a gum arabic, sucrose, and water matrix (HA Lieberman, Pharmaceutical Dosage Forms: Tablets, Vol. 1 (1980), Marcel Dekker, Inc., New York, New York City).

[0229] In a preferred embodiment, the present invention relates to oral care compositions in the form of tablets or soft lozenges, which contain peptidases or lactones, preferably peptidases and lactones. The oral care compositions may contain at least one oral care ingredient selected from lubricants, bulking agents, sweeteners, and flavoring agents.

[0230] lubricant Lubricants are used in the manufacture of compressed tablets to facilitate the release of the tablets from the mold in which they are formed. The lubricant used in this invention is a solid material that is non-charged and does not interfere with (e.g., composite) cationic antimicrobial agents. The material should preferably be insoluble in water. One type of suitable material that meets these requirements is a non-toxic hydrocarbon fat or derivative. Examples include hydrogenated tallow and hydrogenated vegetable oil. Polyethylene glycol can also be used as a lubricant as long as it is a solid material; this generally means that the polyethylene glycol has a molecular weight in the range of 4000 Da to 6000 Da. These materials can also be used as fillers, as described below.

[0231] Mixtures of lubricants can also be used in this invention. The lubricant is used at a level of about 0.1% to about 4.0%, preferably about 0.5% to about 2%.

[0232] Tablet Carrier This article uses the term "tablet carrier" to refer to one or more materials that carry the active ingredient (i.e., enzyme) and a lubricant. These materials are also called expanders or fillers. Because carriers are non-cariogenic, they should be free of sucrose and similar materials.

[0233] Acceptable filler materials include mannitol, sorbitol, xylitol, polyethylene glycol, and non-cariogenic dextran. Fillers can be used alone or in combination.

[0234] Mannitol is a naturally occurring sugar alcohol and can be obtained as a fine powder. Its sweetness is only about 50% that of sucrose. However, mannitol's negative heat of solution allows it to impart a pleasant, cooling sensation in the mouth when dissolved in tablet form.

[0235] Sorbitol is a chemical isomer of mannitol and has a similar level of sweetness. Its heat of solution (which is negative) also provides a pleasant, cooling sensation in the mouth. Sorbitol is available as free-flowing granules or as a crystalline powder. Polyethylene glycol (PEG) can also be used in the compositions of this invention. These materials have the general formula HOCH2(CH2OCH2). n PEG is a polymer of ethylene oxide (CH2OH). Using PEG alone is not advantageous, but its use in combination with other fillers is acceptable. The most desirable molecular weights were found to be between 4000 Da and 6000 Da.

[0236] The filler is typically used in the compositions of the present invention at a level of about 85% to about 99.8%, preferably about 90% to about 98%, and most preferably about 94% to about 97%.

[0237] Other tablet components Acceptable tablets can be manufactured using only the active ingredients, lubricants, and filler materials as outlined above. However, to make the tablets more aesthetically acceptable, they typically include materials such as spray-dried or encapsulated flavorings or liquid flavorings adsorbed onto a suitable diluent. Spray-dried or encapsulated flavorings are preferred. Suitable flavorings include peppermint oil, wintergreen oil, sassafras oil, spearmint oil, and clove oil. Sweeteners are also acceptable for use in the compositions of the present invention. Suitable agents include aspartame, acetylsupan, saccharin, dextrose, and levose. Sweeteners and flavorings are typically used in the compositions of the present invention at levels of about 0.1% to about 2%, preferably about 0.25% to about 1.5%.

[0238] It is also acceptable that the amount of water-soluble fluoride compound present in the tablets in solid form is sufficient to provide a fluoride concentration of about 0.0025% to about 5.0% by weight, preferably about 0.005% to about 2.0% by weight, to provide additional anti-caries efficacy. Preferred fluorides are sodium fluoride, stannous fluoride, indium fluoride, and sodium monofluorophosphate. The tablets may also contain various active ingredients, such as antimicrobial agents, zinc salts, fluorides, and urea (see above).

[0239] Sweets and candies In a preferred embodiment, the present invention relates to oral care compositions in the form of sweets or candies, which contain peptidases or lactones, preferably peptidases and lactones. The oral care compositions may contain at least one oral care ingredient selected from colorants, sweeteners, flavoring agents, and oil modifiers.

[0240] The preparation of confectionery products is historically well-known and has remained largely unchanged over the years. Confectionery products have been classified as either "hard" or "soft" confectionery. The volatile oil modifier of this invention can be incorporated into conventional hard and soft confectionery products by mixing the modifier into them.

[0241] Hard desserts can be processed and formulated using conventional methods. Typically, hard desserts have a matrix consisting of a mixture of sugars and other carbohydrate leavening agents maintained in an amorphous or glassy state. This form is considered to be a solid sugar syrup, which typically contains about 0.5% to about 1.5% water. Such materials typically contain up to about 92% corn syrup, up to about 55% sugar, and about 0.1% to about 5% water by weight of the final composition. The syrup component is typically prepared from fructose-rich corn syrup, but may include other materials. Additional ingredients, such as flavoring agents, sweeteners, acidulants, coloring agents, etc., may also be added.

[0242] Such sweets can be prepared using conventional methods, such as those involving fire cookers, vacuum cookers, and scraper cookers (also known as high-speed atmospheric cookers).

[0243] The fire-cooking apparatus relates to a traditional method for manufacturing confectionery bases. In this method, a desired amount of carbohydrate leavening agent is dissolved in water by heating a reagent in a pot until the leavening agent dissolves. Additional leavening agent can then be added, and cooking continues until the final temperature reaches 145°C to 156°C. The batch is then cooled and processed as a plastic sample lump to incorporate additives such as flavorings, colorings, etc.

[0244] High-speed atmospheric cookers utilize heat exchanger surfaces, which involve spreading a layer of candy on the heat exchange surface, heating the candy to 165°C to 170°C within minutes. The candy is then rapidly cooled to 100°C to 120°C and functions as a plastic-like mass in which additives (such as flavorings, colorings, etc.) can be incorporated.

[0245] In a vacuum cooker, the carbohydrate leavening agent is boiled to 125°C to 132°C under vacuum, and additional water is evaporated without further heating. When cooking is complete, the mass is semi-solid and has a plastic-like consistency. At this point, flavorings, colorings, and other additives are mixed into the mass using conventional mechanical mixing operations.

[0246] During the production of conventional hard confectionery, the optimal mixing time required to evenly combine spices, colorings, and other additives is determined by the time needed to achieve a uniform distribution of the materials. Typically, a mixing time of 4 to 10 minutes has been found to be acceptable.

[0247] Once the candy block has been properly tempered, it can be cut into processable portions or shaped as desired. A variety of forming techniques can be used depending on the desired shape and size of the final product. A general discussion of the composition and preparation of hard confectionery can be found in HA Lieberman, Pharmaceutical Dosage Forms: Tablets, Volume 1 (1980), Marcel Dekker, Inc., New York, New York City.

[0248] According to the present invention, useful equipment includes cooking and mixing apparatus well-known in the field of confectionery manufacturing, and the selection of specific apparatus will be obvious to a person skilled in the art. In contrast, compressed tablet confectionery contains specific materials and forms a structure under pressure.

[0249] These sweets typically contain up to about 95% sugar by weight of the composition, as well as typical tablet excipients, such as binders and lubricants, and flavorings, colorings, etc. Similar to hard sweets, soft sweets can be used in this invention. The preparation of soft sweets (e.g., nougat) involves conventional methods, such as a combination of two main components, namely (1) a high-boiling-point syrup, such as corn syrup, hydrogenated starch hydrolysate, etc., and (2) a relatively lightweight frozen sweet, which is typically prepared from ovalbumin, gelatin, plant proteins (e.g., soy-derived compounds), unsweetened milk-derived compounds (e.g., milk proteins), and mixtures thereof. Frozen sweets are typically relatively light and can have a density range, for example, from about 0.5 to about 0.7 g / cc.

[0250] Flavoring components in desserts are spices that have a associated bitterness or other unpleasant aftertaste. These flavoring components can be selected from natural and synthetic flavoring liquids, such as volatile oils, synthetic flavoring oils, flavoring aromas, and oils, liquids, oleoresins, or extracts derived from plants, leaves, flowers, fruits, stems, and combinations thereof. Non-limiting representative examples of volatile oils include spearmint oil, cinnamon oil, wintergreen oil (methyl salicylate), peppermint oil, menthol, clove oil, laurel oil, anise oil, eucalyptus oil, thyme oil, cedarwood leaf oil, nutmeg oil, sweet pepper oil, sage oil, nutmeg skin extract, bitter almond oil, and cinnamon oil. In addition, desserts may contain artificial, natural, or synthetic flavorings, including single and mixed fruit flavorings (such as vanilla and citrus oils, including lemon, orange, grape, lime, and grapefruit) and fruit essences (including apple, pear, peach, grape, strawberry, raspberry, cherry, plum, pineapple, apricot, etc.).

[0251] Other useful flavorings include aldehydes and esters, such as benzaldehyde (cherries, almonds), citral (i.e., α-citral (lemons, limes)), neraldehyde (i.e., β-citral (lemons, limes)), decanal (oranges, lemons), aldehyde C-8 (citrus fruits), aldehyde C-9 (citrus fruits), aldehyde C-12 (citrus fruits), tolualdehyde (cherries, almonds), 2,6-dimethyl-octanal (green fruits), and 2-dodecaldehyde (citrus fruits), and mixtures thereof.

[0252] In the use of sweeteners, this invention is considered to include those sweeteners well known in the art, including both natural and artificial sweeteners. Sweeteners may be selected from the following non-limiting list: sugars, such as sucrose, glucose (corn syrup), dextrose, invert sugar, fructose, and mixtures thereof; saccharin and its various salts (e.g., sodium or calcium salts); cyclohexane and its various salts, such as sodium salts; dipeptide sweeteners, such as aspartame, dihydrochalcone compounds, glycyrrhizin; stevia (… Stevia Rebaudiana(Steviol glycosides); chlorinated derivatives of sucrose; flavanone alcohols; hydroxyguaiacol esters; L-aminodicarboxylic acid geminiamine; L-aminodicarboxylic acid aminoolefin ester amides; and sugar alcohols such as sorbitol, sorbitol syrup, mannitol, xylitol, etc. The synthetic sweetener 3,6-dihydro-6-methyl-1,2,3-oxathiazin-4-one-2,2-dioxide, particularly its potassium salt (acetylsupan potassium), sodium salt, and calcium salt, was also considered.

[0253] Sweets may also include coloring agents. These coloring agents can be selected from a variety of dyes suitable for food, pharmaceutical, and cosmetic applications, and are referred to as FD&C dyes, etc. Acceptable materials for the aforementioned application spectrum are preferably water-soluble. Illustrative examples include indigo dye known as FD&C Blue No. 2, which is a disodium salt of 5,5'-indodisulfonic acid. Similarly, dye known as FD&C Green No. 1 contains a triphenylmethane dye and is a monosodium salt of 4-[4-N-ethyl-p-sulfonylbenzylamino)diphenylmethylene]-[1-(N-ethyl-N-p-thiobenzyl)-2-5-cyclohexadieneimine]. A complete description of all FD&C and D&C dyes and their corresponding chemical structures can be found in Volume 5 of the Kirk-Othmer Encyclopedia of Chemical Technology.

[0254] Sweets can also include volatile oil modifiers, such as capsicum oleoresin. These oil modifiers are present in quantities that are not detected as separate components in the oral cavity, but they can still alter the sensory perception of volatile oils.

[0255] Oil modifiers are present in amounts ranging from about 1 to about 150 ppm, similar to those used in sweet peppers. Chili peppers can be obtained from small peppers (Capsicum minium), ornamental peppers (Capsicum fruttescens), bell peppers (Capsicum annuum), and similar varieties. Commercially, the fruit of the chili pepper is called chilies or peppers. These fruits are known for their strong bite, pungent taste, and distinctive aroma.

[0256] Regarding confectionery compressed tablet formulations, they will contain a tablet granulation matrix and various additives, such as sweeteners and flavorings. The tablet granulation matrix used will vary depending on a number of factors, such as the type of matrix used, the desired crispness, and other components used to manufacture the final product. These confectionery products typically contain up to 95% sugar by weight of the composition.

[0257] Sweetened compressed tablets may additionally include tablet excipients, such as binders or lubricants, as well as flavoring agents, coloring agents, and volatile oils and volatile oil modifiers.

[0258] The variations that can be practiced with regard to these sweets are very extensive and are within the capabilities of those skilled in the art, particularly with respect to the use of additional fillers, flavorings, colorings, etc.

[0259] External oral care composition External oral care preparations (such as denture cleaning solutions, denture cleaning tablets, denture cleaning powders, etc.) may include ingredients and / or substances selected from the following categories:

[0260] In a preferred embodiment, at least one oral care ingredient is selected from the group consisting of: carriers, disinfectants and bleaching agents, detergents, washing agents and surfactants, foaming agents, preservatives, and flavoring agents.

[0261] Alternatively, the oral care composition of the present invention may also be contained in a filament suitable for cleaning teeth (e.g., a filament used as dental floss). Preferably, the oral care composition is coated onto the outside of the filament. Thus, in a preferred embodiment, the present invention relates to a filament comprising an oral care composition containing a peptidase or lactonease, preferably a peptidase and a lactonease, wherein the filament is suitable for cleaning teeth.

[0262] use The oral care compositions of the present invention are suitable for use in the treatment of oral diseases, wherein the desired outcome is the prevention or removal of oral biofilms. The compositions of the present invention are particularly suitable for the treatment of periodontal disease and dental caries.

[0263] Periodontal disease, also known as gingivitis, is a group of inflammatory conditions caused by bacterial infection and the subsequent formation of a biofilm on the teeth and surrounding tissues. Periodontal disease can be classified according to severity as follows: gingivitis (including plaque-induced gingivitis), chronic periodontitis, aggressive periodontitis, periodontitis as a manifestation of systemic disease, necrotizing ulcerative gingivitis / periodontitis, periodontal ligament abscess, and combined pulpoperiodontal disease. Depending on the extent of the affected area, periodontal disease can be further considered local or systemic.

[0264] Tooth decay, also known as cavities or caries, is caused by organic acids (such as lactic acid), which are produced by certain biofilm-forming bacteria residing in the oral cavity (including Streptococcus mutans). Streptococcus mutans ) and some Lactobacillus species ( Lactobacillus ) Species) release. Dental caries can be associated with other complications, such as inflammation of the tissues surrounding the teeth, tooth loss, and infection or abscess formation. Dental caries can be classified by location, etiology, rate of progression, and affected hard tissues, for example, according to the GVBlack classification (categories I, II, III, IV, V, and VI).

[0265] In one aspect, the present invention relates to an oral care composition comprising a peptidase or lactonease, preferably a peptidase and a lactonease, for use as a medicine.

[0266] In one aspect, the present invention relates to an oral care composition comprising a peptidase or lactonease, preferably a peptidase and a lactonease, for use in the treatment of oral diseases.

[0267] In a preferred embodiment, the present invention relates to an oral care composition comprising a peptidase or lactonease, preferably a peptidase and a lactonease, for use in the treatment of periodontal disease and / or dental caries. In one aspect, the present invention relates to the use of an oral care composition comprising a peptidase or lactonease, preferably a peptidase and a lactonease, for the treatment or preventative treatment of a human subject.

[0268] In one aspect, the present invention relates to a method of treating a human subject, the method comprising administering to the human subject an oral care composition comprising a peptidase or lactonease, preferably a peptidase and a lactonease. In a preferred embodiment, the oral care composition is applied to the oral cavity of the human subject.

[0269] In one aspect, the present invention relates to a method for preventing or removing oral biofilms, the method comprising contacting the biofilm with an oral care composition comprising a peptidase or lactonease, preferably a peptidase and a lactonease. In one embodiment, the oral care composition is an external oral care composition, and the biofilm is located on a target; preferably the target is a denture. In one embodiment, the target is located inside or outside the oral cavity.

[0270] Sources of peptides The peptidases and lactones of this invention can be obtained from microorganisms of any genus. For the purposes of this invention, the term "obtained from," as used herein in conjunction with a given source, should mean that the polypeptide encoded by the polynucleotide is produced by that source or by a strain that has inserted the polynucleotide of this invention. In one aspect, polypeptides obtained from a given source are secreted extracellularly.

[0271] In one respect, the polypeptide is obtained from Aspergillus species, preferably Aspergillus niger or Aspergillus oryzae. Aspergillus oryzae The most preferred variety is Aspergillus niger.

[0272] It should be understood that, for the aforementioned species, this invention covers complete and incomplete stages, as well as other taxonomic equivalents, such as asexual forms, regardless of their known species names. Those skilled in the art will readily identify the appropriate equivalents.

[0273] The probes mentioned above can be used to identify and obtain polypeptides from other sources, including microorganisms isolated from nature (e.g., soil, compost, water, etc.) or DNA samples obtained directly from natural materials (e.g., soil, compost, water, etc.). Techniques for directly isolating microorganisms and DNA from natural habitats are well known in the art. The polynucleotide encoding the polypeptide can then be obtained by similarly screening a library of genomic DNA or cDNA from another microorganism or a mixed DNA sample. Once the polynucleotide encoding the polypeptide has been detected with the probe, it can be isolated or cloned using techniques known to those skilled in the art (see, for example, Davis et al., 2012, Basic Methods in Molecular Biology, Elsevier).

[0274] Polynucleotides This invention also relates to polynucleotides encoding the polypeptides of this invention, as described herein.

[0275] The polynucleotide can be genomic DNA, cDNA, synthetic DNA, synthetic RNA, mRNA, or a combination thereof. The polynucleotide can be cloned from strains of the genus *Aspergillus*, preferably *Aspergillus niger*, or related organisms, and therefore can be, for example, a polynucleotide sequence encoding a variant of the polypeptide of the present invention.

[0276] In one embodiment, the polynucleotide encoding the polypeptide of the present invention is isolated from Aspergillus cells, preferably Aspergillus niger cells.

[0277] These polynucleotides can also be constructed by introducing nucleotide substitutions that do not change the amino acid sequence of the polypeptide but correspond to the codons used by the host organism intended to produce the enzyme, or by mutating them by introducing nucleotide substitutions that may produce different amino acid sequences. For a general description of nucleotide substitutions, see, for example, Ford et al., 1991. Protein Expression and Purification [Protein Expression and Purification] 2: 95-107.

[0278] On the one hand, polynucleotides are isolated.

[0279] On the other hand, the polynucleotides are purified.

[0280] Nucleic acid constructs The present invention also relates to nucleic acid constructs comprising the polynucleotide of the present invention, wherein the polynucleotide is operatively linked to one or more control sequences, which, under conditions compatible with the control sequences, direct the expression of the coding sequence in a suitable host cell.

[0281] Polynucleotides can be manipulated in various ways to provide polypeptide expression. Depending on the expression vector, manipulating the polynucleotide before insertion into the vector may be desirable or necessary. Techniques for modifying polynucleotides using recombinant DNA methods are well known in the art.

[0282] promoter The control sequence may be a promoter, i.e., a polynucleotide recognized by the host cell for expressing the polypeptide encoding the present invention. The promoter contains a transcriptional control sequence that mediates polypeptide expression. The promoter can be any polynucleotide exhibiting transcriptional activity in the host cell, including mutant promoters, truncated promoters, and heterozygous promoters, and can be a gene encoding an extracellular or intracellular polypeptide that is homologous or heterologous to the host cell.

[0283] Examples of suitable promoters for guiding the transcription of polynucleotides in bacterial host cells in this invention are described in Sambrook et al., 1989, *Molecular Cloning: A Laboratory Manual*, Cold Spring Harbor Lab, New York; Davis et al., 2012, ibid.; and Song et al., 2016. PLOS One [Public Library of Science General] 11(7): e0158447.

[0284] Examples of suitable promoters for guiding the transcription of polynucleotides in filamentous fungal host cells in this invention are obtained from Aspergillus and Fusarium species. Fusarium ), Rhizopus ( Rhizomucor ) and Trichoderma ( Trichoderma ) Cell promoters, such as those described in: Mukherjee et al., 2013, “ Trichoderma "Biology and Applications of Trichoderma" and Schmoll and Dattenböck, 2016, "Gene Expression Systems in Fungi: Advancements and Applications". Fungal Biology [Fungal Biology]

[0285] Examples of useful promoters for expression in yeast hosts are described in: Smolke et al., 2018, “Synthetic Biology: Parts, Devices and Applications” (Chapter 6: Constitutive and Regulated Promoters in Yeast: How to Design and Make Use of Promoters in S. cerevisiae) and Schmoll and Dattenböck, 2016, “Gene Expression Systems in Fungi: Advancements and Applications”. Fungal Biology [Fungal Biology]

[0286] Termination The control sequence can also be a transcription terminator that is recognized by the host cell to terminate transcription. The terminator is operatively linked to the 3' end of a polynucleotide encoding a polypeptide. Any terminator that is functional in the host cell can be used in this invention.

[0287] Preferred terminators for bacterial host cells can be obtained from the genes of Bacillus clausti (Bacterium clausti). Bacillus clausii alkaline protease ( aprH ), Bacillus licheniformis ( Bacillus licheniformis α-Amylase ( amyL ) and Escherichia coli ( Escherichia coli ) Ribosomal RNA ( rrnB ).

[0288] Preferred terminators for filamentous fungal host cells can be obtained from species of the genera *Aspergillus* or *Trichoderma*, such as those obtained from *Aspergillus niger* glucosylamylase and *Trichoderma reesei*. Trichoderma reesei Genes for β-glucosidase, *Trichoderma reesei* cellobiase I, and *Trichoderma reesei* endoglucanase I, such as those described in the terminator below: Mukherjee et al., 2013, " Trichoderma"Biology and Applications of Trichoderma" and Schmoll and Dattenböck, 2016, "Gene Expression Systems in Fungi: Advancements and Applications". Fungal Biology [Fungal Biology]

[0289] Preferred terminators for yeast host cells can be obtained from the genes of *Saccharomyces cerevisiae* enolase, *Saccharomyces cerevisiae* cytochrome C (CYC1), and *Saccharomyces cerevisiae* glyceraldehyde-3-phosphate dehydrogenase. Other useful terminators for yeast host cells were proposed by Romanos et al., 1992. Yeast [Yeast] 8: 423-488 Description.

[0290] mRNA stabilizers Control sequences can also be mRNA stabilizer regions downstream of the promoter and upstream of the gene's coding sequence, which increase the expression of the gene.

[0291] Examples of suitable mRNA stabilizer regions were obtained from Bacillus thuringiensis (Bt). Bacillus thuringiensis ) cryIIIA Gene (WO 94 / 25612) and Bacillus subtilis ( Bacillus subtilis SP82 gene (Hue et al., 1995, J. Bacteriol. [Journal of Bacteriology] 177: 3465-3471.

[0292] Examples of mRNA stabilizer regions in fungal cells are described in Geisberg et al., 2014. Cell 156(4): 812-824 and Morozov et al., 2006, Eukaryotic Cell 5(11): 1838-1846.

[0293] Leader sequence The control sequence can also be a leader sequence, i.e., an untranslated region of mRNA that is important for translation in the host cell. The leader sequence is operatively linked to the 5' end of a polynucleotide encoding a polypeptide. Any leader sequence that is functional in the host cell can be used.

[0294] The appropriate leader sequence for bacterial host cells was determined by Hambraeus et al., 2000. Microbiology study]146(12): 3051-3059 and Kaberdin and Bläsi, 2006, FEMS Microbiol. Rev. [FEMS Microbiol. [Review of Physics] 30(6): 967-979 Description.

[0295] Preferred leader sequences for filamentous fungal host cells can be obtained from the genes of Aspergillus oryzae (…). Aspergillus oryzae TAKA amylase and Aspergillus nidulans ( Aspergillus nidulans Triose phosphate isomerase.

[0296] Suitable leader sequences for yeast host cells can be obtained from the following genes: Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae 3-phosphoglycerate kinase, Saccharomyces cerevisiae α-factor, and Saccharomyces cerevisiae alcohol dehydrogenase / glyceraldehyde-3-phosphate dehydrogenase (ADH2 / GAP).

[0297] polyadenylation sequence The control sequence can also be a polyadenylation sequence, i.e., a sequence operatively linked to the 3' end of a polynucleotide that is recognized by the host cell during transcription as a signal to add polyadenylation residues to the transcribed mRNA. Any polyadenylation sequence that is functional in the host cell can be used.

[0298] Preferred polyadenylated sequences for filamentous fungal host cells are obtained from the genes of Aspergillus nidulans anthranilate synthase, Aspergillus niger glucosyl amylase, Aspergillus niger α-glucosidase, Aspergillus oryzae TAKA amylase, and Fusarium oxysporum trypsin-like protease.

[0299] Useful polyadenylation sequences in yeast host cells were discovered by Guo and Sherman, 1995. Mol. Cellular Biol. [Molecular Cell Biology] 15: 5983-5990 Description.

[0300] signal peptide The control sequence can also be a signal peptide coding region that encodes a signal peptide linked to the N-terminus of a polypeptide and guides the polypeptide into the secretory pathway of the cell. The 5' end of the polynucleotide coding sequence itself may contain a signal peptide coding sequence naturally linked to the coding sequence segment of the polypeptide within the translation read frame. Alternatively, the 5' end of the coding sequence may contain a signal peptide coding sequence that is heterologous to the coding sequence. In cases where the coding sequence does not naturally contain a signal peptide coding sequence, a heterologous signal peptide coding sequence may be required. Alternatively, a heterologous signal peptide coding sequence may simply replace the natural signal peptide coding sequence to enhance polypeptide secretion. Any signal peptide coding sequence that guides the expressed polypeptide into the host cell's secretory pathway can be used.

[0301] The effective signal peptide coding sequence of bacterial host cells is obtained from the signal peptide coding sequences of genes in the following gene groups: Bacillus ( ) Bacillus NCIB 11837 produces maltose amylase, Bacillus subtilis protease, Bacillus subtilis β-lactamase, and Bacillus stearothermophilus ( Bacillus stearothermophilus α-Amylase, thermophilic Bacillus stearothermophilus neutral protease ( nprT , nprS , nprM ) and Bacillus subtilis prsA Other signal peptides were identified by Freudl, 2018. Microbial Cell Factories [Microbial Cell Factory] 17: 52 Description.

[0302] The effective signal peptide coding sequences for filamentous fungal host cells are obtained from the following genes: Aspergillus niger neutral amylase, Aspergillus niger glucosylase, Aspergillus oryzae TAKA amylase, and *Pseudomonas spp.* Humicola insolens Cellulase, specific humic endoglucanase V, and cottony humic mold ( Humicola lanuginosa Lipase and Rhizopus oryzae ( Rhizomucor miehei Aspartic proteases, such as those described by Xu et al., 2018, Biotechnology Letters The signal peptide described in [Biotechnology Letters] 40: 949-955.

[0303] Useful signal peptides in yeast host cells are obtained from the genes of *Saccharomyces cerevisiae* α-factor and *Saccharomyces cerevisiae* invertase. Sequences encoding other useful signal peptides are described above by Romanos et al., 1992.

[0304] propeptide The control sequence can also be a propeptide-coding sequence encoding the propeptide located at the N-terminus of the polypeptide. The resulting polypeptide is called a proenzyme or propeptide progenitor (or, in some cases, a zymogen). The propeptide progenitor is usually inactive and can be converted into an active polypeptide by catalytic cleavage or autocatalytic cleavage of the propeptide progenitor. The propeptide-coding sequence can be obtained from the genes of Bacillus subtilis alkaline protease (…). aprE ), Bacillus subtilis neutral protease ( nprT ), thermophilic hygrophytes ( 嗜热毁丝霉 Laccase (WO 95 / 33836), Rhizopus oryzae aspartic protease and Saccharomyces cerevisiae α-factor.

[0305] When both a signal peptide sequence and a propeptide sequence are present, the propeptide sequence is located immediately adjacent to the N-terminus of the polypeptide, and the signal peptide sequence is located immediately adjacent to the N-terminus of the propeptide sequence. Alternatively, when both a signal peptide sequence and a propeptide sequence are present, the polypeptide may contain only a portion of the signal peptide sequence and / or only a portion of the propeptide sequence. Alternatively, the final or isolated polypeptide may comprise a mixture of a mature polypeptide and a polypeptide containing partial or full-length propeptide sequences and / or signal peptide sequences.

[0306] Regulatory sequence It is also desirable to add regulatory sequences that regulate the expression of host cell growth-related peptides. Examples of regulatory sequences are those that cause gene expression to turn on or off in response to chemical or physical stimuli, including the presence of regulatory compounds. Regulatory sequences in prokaryotic systems include... lac , tac and trp Operant systems. In yeast, the ADH2 or GAL1 system can be used. In filamentous fungi, the *Aspergillus niger* glucosylamylase promoter, the *Aspergillus oryzae* TAKA α-amylase promoter, the *Aspergillus oryzae* glucosylamylase promoter, the *Trichoderma reesei* cellobiose hydrolase I promoter, and the *Trichoderma reesei* cellobiose hydrolase II promoter can be used. Other examples of regulatory sequences are those that allow gene amplification. In fungal systems, these regulatory sequences include dihydrofolate reductase genes amplified in the presence of methotrexate and metallothionein genes amplified with heavy metals.

[0307] Transcription factor Control sequences can also be transcription factors, which are polynucleotides encoding polynucleotide-specific DNA-binding polypeptides that control the rate of transcription of genetic information from DNA to mRNA by binding to specific polynucleotide sequences. Transcription factors can function alone and / or together with one or more other polypeptides or transcription factors in a complex by promoting or blocking the recruitment of RNA polymerase. Transcription factors are characterized by containing at least one DNA-binding domain, which is typically attached to a specific DNA sequence adjacent to the genetic element regulated by the transcription factor. Transcription factors can regulate the expression of proteins of interest directly (i.e., by binding to their promoters to activate the transcription of genes encoding proteins of interest) or indirectly (i.e., by binding to the promoters of other transcription factors that regulate the transcription of genes encoding proteins of interest). Suitable transcription factors for fungal host cells are described in WO 2017 / 144177. Suitable transcription factors for prokaryotic host cells are described in Seshasayee et al., 2011. Subcellular Biochemistry [Subcellular biochemistry]52: 7-23 and Balleza et al., 2009, FEMS Microbiol. Rev. [FEMS Microbiology Reviews] 33(1): 133-151.

[0308] expression carrier The present invention also relates to recombinant expression vectors comprising the polynucleotide of the present invention, a promoter, and transcription and translation termination signals. Multiple nucleotides and control sequences can be linked together to produce a recombinant expression vector, which may include one or more convenient restriction sites to allow the insertion or substitution of the polynucleotide encoding the polypeptide at such sites. Alternatively, the polynucleotide can be expressed by inserting the polynucleotide or a nucleic acid construct containing the polynucleotide into a suitable vector for expression. In producing the expression vector, the coding sequence is located in the vector such that the coding sequence is operatively linked to a suitable control sequence for expression.

[0309] Recombinant expression vectors can be any vector (e.g., plasmids or viruses) that can readily undergo recombinant DNA procedures and induce polynucleotide expression. The choice of vector will typically depend on its compatibility with the host cell to which it will be introduced. Vectors can be linear or closed circular plasmids.

[0310] The vector can be a self-replicating vector, that is, a vector that exists as an extrachromosomal entity and replicates independently of chromosome replication, such as a plasmid, extrachromosomal element, microchromosome, or artificial chromosome. The vector can contain any means to ensure self-replication. Alternatively, the vector can be one that integrates into the genome when introduced into a host cell and replicates along with the chromosome in which it has been integrated. Furthermore, a single vector or plasmid, or two or more vectors or plasmids collectively containing the total DNA of the host cell genome to be introduced, or transposons can be used.

[0311] The vector preferably contains one or more selective markers that allow for convenient selection of cells such as transformed cells, transfected cells, and transduced cells. A selective marker is a gene whose product provides resistance to biocides or viruses, resistance to heavy metals, or prototrophic auxotrophic traits, etc.

[0312] The vector preferably contains at least one element that allows the vector to integrate into the genome of the host cell or to replicate autonomously in the cell independently of the genome.

[0313] In order to integrate into the host cell genome, the vector may depend on a polynucleotide sequence encoding a polypeptide or any other element of the vector used for integration into the genome via homologous recombination (such as homologous directed repair (HDR)) or non-homologous recombination (such as non-homologous end joining (NHEJ)).

[0314] For autonomous replication, the vector may further include an origin of replication, which enables the vector to replicate autonomously in the host cell discussed. The origin of replication can be any plasmid replicon that mediates autonomous replication and functions within the cell. The terms "origin of replication" or "plasmid replicon" refer to the polynucleotide that enables a plasmid or vector to replicate in vivo.

[0315] More than one copy of the polynucleotide of the present invention can be inserted into host cells to enhance polypeptide production. For example, two, three, four, five, or more copies can be inserted into host cells. An increased copy number of the polynucleotide can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selective marker gene along with the polynucleotide, wherein cells containing the amplified copy of the selective marker gene and thus additional copies of the polynucleotide can be selected by culturing cells in the presence of a suitable selective reagent.

[0316] host cells The present invention also relates to recombinant host cells containing polynucleotides of the present invention operably linked to one or more control sequences that direct the production of polypeptides of the present invention.

[0317] A construct or vector containing a polynucleotide is introduced into a host cell, such that the construct or vector is maintained as a chromosomal integrase or as a self-replicating extrachromosomal vector, as previously described. The choice of host cell will depend largely on the gene encoding the polypeptide and its origin. The polypeptide can be native or heterologous to the recombinant host cell. Furthermore, at least one of the one or more control sequences can be heterologous to the polynucleotide encoding the polypeptide. The recombinant host cell may contain a single copy or at least two copies, such as three, four, five or more copies, of the polynucleotide of the invention.

[0318] The host cell can be any microbial cell that can be used to recombinantly generate the polypeptides of the present invention.

[0319] The host cell can be a fungal cell. As used herein, “fungi” includes Ascomycota, Basidiomycota, Chytridiomycota, Zygomycota, Oomycota, and all mitotic fungi (as defined by Hawksworth et al. in the following literature: Ainsworth and Bisby’s Dictionary of The Fungi[Ainsworth and Bysby Dictionary of Fungi], 8th edition, 1995, CAB International, University Press, Cambridge, UK.

[0320] Fungal cells can undergo transformation through processes involving protoplast-mediated transformation, Agrobacterium-mediated transformation, electroporation, gene gun methods, and shock wave-mediated transformation (e.g., Li et al., 2017). Microbial Cell Factories [Microbial Cell Factory] 16:168 (reviewed) and EP 238023, Yelton et al., 1984, Proc. Natl. Acad. Sci. USA [Proceedings of the National Academy of Sciences of the United States of America] 81: 1470-1474; Christensen et al., 1988, Bio / Technology [Biotechnology] 6: 1419-1422 and Lubertozzi and Keasling, 2009, Biotechn. Advances The procedure described in [Advances in Biotechnology] 27: 53-75 can be used for transformation. However, any method known in the art for introducing DNA into fungal host cells can be used, and the DNA can be introduced as a linearized or cyclic polynucleotide.

[0321] The fungal host cell can be a yeast cell. As used herein, "yeast" includes ascosporogenous yeast (Endomycetales), basidiosporogenous yeast, and yeasts belonging to the class Fungi Imperfecti (Blastomycetes). For the purposes of this invention, yeast should be as follows... Biology and Activities of Yeast [Biology and Activity of Yeast] (Edited by Skinner, Passmore, and Davenport) Soc. App. Bacteriol. Symposium Series The definition is as described in Proceedings of the Society for Applied Bacteriology, No. 9 (Series 9), 1980.

[0322] Yeast host cells can be Candida genus ( 念珠菌属 ), Hansenula genus ( 汉逊酵母属 Kluyveromyces ( ) 克鲁维酵母属 ), Pichia pastoris ( 毕赤酵母属 ), Yeast ( 酿酒酵母属 ), genus *Fissionyomyces* ( 裂殖酵母属 ) or Yersinia genus ( 解脂耶氏酵母属) cells, such as Kluyveromyces lactis ( 乳酸克鲁维酵母 ), Kelvin yeast ( 卡尔斯伯酵母 ), brewing yeast, saccharifying yeast ( 糖化酵母 ), Douglas yeast ( 道格拉斯酵母 ), Klufer yeast ( 克鲁维酿酒酵母 Nodi yeast ( 诺尔酵母 ), oval yeast ( 卵形酵母 ) or Yersinia lipophila ( 解脂耶氏酵母 ) cells. In a preferred embodiment, the yeast host cell is a Pichia pastoris or a Pichia pastoris. Komagataella ) cells, such as Pichia pastoris ( 巴斯德毕赤酵母 ) (Faffia colomata ( 毕赤酵母 ))cell.

[0323] Fungal host cells can be filamentous fungal cells. "Filamentous fungi" includes the phylum Fungi (…). 真菌门 Filamentous fungi are all filamentous forms of the subphylum Oomycetes (as defined by Hawksworth et al., 1995, ibid.). Filamentous fungi are generally characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth occurs through hyphal extension, and carbon metabolism is obligate aerobic. In contrast, yeasts (such as Saccharomyces cerevisiae) undergo vegetative growth through budding of single-celled cells, and carbon metabolism can be fermentative.

[0324] The host cell for filamentous fungi can be *Cladosporium* ( ). 顶孢霉属 Aspergillus, Bruxelles Aureobasidium ), genus *Citropa* ( Bjerkandera ), genus Pseudocybe Ceriporiopsis ), genus Aureospora ( Chrysosporium ), Coprinus ( 鬼伞属 ), genus *Gynostemma* 革盖菌属 Cryptococcus ( 隐球菌属 ), Ustilago aceae ( Filibasidium Fusarium, Humus ( ), Humicola ), Pyrethrum ( Magnaporthe Mucor ( ) 毛霉属 ), genus *Hypericum* 毁丝霉属 ), genus *Neotrichum* ( Neocallimastix Neurospora ( Neurospora ), Penicillium genus ( 拟青霉属 ), Penicillium ( 青霉属 ), genus *Platycota* 显革菌属 ), *Neuromyces* genus ( Phlebia ), Rumenichthys ( Piromyces ), Pleurotus ( 侧耳属 ), genus *Schizophyllum* (裂褶菌属 ), genus Bassilia ( 篮状菌属 ), genus Thermophilic Ascomycota 嗜热ascus ), genus *Clostridium* ( Thielavia ), genus *Cyclophorus* ( Tolypocladium ), spp. Trametes The host cells are *Aspergillus*, *Trichoderma*, or *Fusarium* cells. In a preferred embodiment, the filamentous fungal host cells are *Aspergillus*, *Trichoderma*, or *Fusarium* cells. In another preferred embodiment, the host cells are *Aspergillus niger*, *Aspergillus oryzae*, *Trichoderma reesei*, or *Fusarium moniliforme*. 镰刀菌 )cell.

[0325] For example, the host cell for filamentous fungi can be Aspergillus bubomori (… 泡盛曲霉 Aspergillus smut () 臭曲霉 Aspergillus fumigatus ( ) 烟曲霉 ), Aspergillus japonicum ( 曲霉属 Japanese Aspergillus nidus, Aspergillus niger, Aspergillus oryzae, Aspergillus niger ( ), Aspergillus nidus ( ) Bjerkandera scordata ), dried cereus ( Ceriporiopsis aneirina ), Carnegie cereus ( Ceriporiopsis caregiea ), pale yellow cereus ( Ceriporiopsis gilvescens Panochita cereus ( Ceriporiopsis pannocinta ), Circulating cereus ( Ceriporiopsis rivulosa ), *Pseudomonas erythroptera* ( Ceriporiopsis subrufa ), Insectoid cereus ( Ceriporiopsis subvermispora ), Narrow-sided golden spores ( Chrysosporium inops ), Keratoplasmosis ( Chrysosporium keratinophilus ), Lukenowens golden spores ( Chrysosporium from Lucknow ), Fecal spores ( Chrysosporium merdarius ), spores of the genus *Pseudomonas* Chrysosporium small cloth ), Queensland golden spores ( Chrysosporium queenslandicum ), Tropical golden spores ( Chrysosporium tropicum ), Brown spores ( Chrysosporium zonatum ), Grey-covered Ghost Umbrella ( Grey coprinus ), scabra ( Coriolus shaggy ), Fusarium moniliforme ( Fusarium bacteriophage ), Cereal Fusarium ( Fusarium cereale ), Fusarium oxysporum ( Fusarium crookwellensis ), Fusarium solani ( Fusarium wilt Fusarium graminearum ( ), Fusarium gramineae Fusarium graminearum ( ), Fusarium graminearum ( ) Fusarium grass Fusarium heterosporum ( ), Fusarium heterosporum ), Albizia julibrissin ( Fusarium negundi Fusarium oxysporum ( ), Fusarium oxysporum Fusarium multiflorum ( ), Fusarium reticulatum ), pink Fusarium ( Fusarium pink ), Fusarium elderberry ( Fusarium sambucinum ), Skin-colored Fusarium ( Fusarium sarcochrome Fusarium pseudobryophyte ( ), Fusarium sporotrichioides ), Fusarium sulfonata ( Fusarium sulfurum ), Fusarium ( Fusarium torulosum Fusarium pseudofilariae ( ) Fusarium trichothecioides ), Fusarium moniliforme ( Fusarium poisoned ), specific humic mold, loose cottony humic mold, rice black rhizopus, thermophilic hygrophytes, and roughy neurospora ( Neurospora crassa ), Penicillium purpureum ( Penicillium purpurogenus ), Chloris chrysophagus ( Phanerochaete chrysosporium ), Epireobacterium ( Phlebia radiata ), Erycibe and Pleurotus eryngii ( Oyster mushroom eryngium Emerson's basket bacteria ( Talaromyces emersonii ), terrestrial closporidum ( Thielavia terrestrial ), long-haired cork bacteria ( Trametes villosa ), discoloration thrombus ( Trametes versicolor Trichoderma harzianum ( Trichoderma harzianum Corning Trichoderma ( Trichoderma koningii Trichoderma longifolia ( Trichoderma long-armed ), Trichoderma reesei or Trichoderma viride ( Trichoderma viride )cell.

[0326] In a particularly preferred embodiment, the host cell is an Aspergillus niger cell.

[0327] In a particularly preferred embodiment, the host cell is an Aspergillus oryzae cell.

[0328] On the one hand, the host cell is isolated.

[0329] On the other hand, the host cell is purified.

[0330] Generation method The present invention also relates to methods for producing the polypeptides of the invention, the methods comprising (a) culturing cells under conditions conducive to the production of the polypeptide, the cells producing the polypeptide in their wild-type form; and optionally (b) recovering the polypeptide.

[0331] In one respect, the cell is an Aspergillus cell, preferably an Aspergillus niger cell or an Aspergillus oryzae cell, most preferably an Aspergillus niger cell.

[0332] The present invention also relates to methods for generating the polypeptides of the invention, the methods comprising (a) culturing the recombinant host cells of the invention under conditions conducive to the generation of the polypeptide; and optionally (b) recovering the polypeptide.

[0333] In one respect, the recombinant host cell is an Aspergillus cell, preferably an Aspergillus niger cell or an Aspergillus oryzae cell, and most preferably an Aspergillus niger cell.

[0334] In one respect, the recombinant host cell is the Aspergillus niger cell.

[0335] In one respect, the recombinant host cell is Aspergillus oryzae cells.

[0336] The host cells are cultured in a nutrient medium suitable for producing peptides using methods known in the art. For example, cells can be cultured in a suitable medium and under conditions that allow for peptide expression and / or isolation by shake-flask culture or by small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid-state and / or microcarrier-based fermentation) in a laboratory or industrial fermenter. Suitable media are available from commercial suppliers or can be prepared according to publicly available compositions (e.g., in the catalogue of the U.S. Center for Type Culture Collection). If the peptide is secreted into the nutrient medium, it can be recovered directly from that medium. If the peptide is not secreted, it can be recovered from cell lysates.

[0337] Peptides can be detected using methods known in the art that are specific to peptides, including but not limited to the use of specific antibodies, enzyme product formation, enzyme substrate disappearance, or determination of the relative or specific activity of the peptide.

[0338] Peptides can be recovered from culture media using methods known in the art, including but not limited to collection, centrifugation, filtration, extraction, spray drying, evaporation, or precipitation. In one aspect, whole fermentation broth containing peptides is recovered. In another aspect, cell-free fermentation broth containing peptides is recovered.

[0339] Peptides can be purified using a variety of procedures known in the art to obtain substantially pure peptides and / or peptide fragments (see, for example, Wingfield, 2015). Current Protocols in Protein Science [The Latest Protocols in Protein Science]; 80(1): 6.1.1-6.1.35; Labrou, 2014, Protein Downstream Processing [Downstream protein processing], 1129: 3-10).

[0340] In terms of alternatives, peptides are not recycled.

[0341] Enzyme granules The present invention also relates to enzyme particles / granules comprising the polypeptides of the present invention. In embodiments, the particles comprise a core and optionally one or more coatings (outer layers) surrounding the core.

[0342] The core diameter (measured as equivalent sphere diameter (volume-average particle size)) can be 20–2000 µm, particularly 50–1500 µm, 100–1500 µm, or 250–1200 µm. The core diameter as an equivalent sphere diameter can be determined using laser diffraction methods such as those using the Malvern Mastersizer and / or those described under ISO 13320 (2020).

[0343] In the embodiments, the core comprises a peptidase or lactonease, preferably a peptidase and a lactonease.

[0344] The core may include other materials such as fillers, fibrous materials (cellulose or synthetic fibers), stabilizers, solubilizers, suspending agents, viscosity modifiers, light spheres, plasticizers, salts, lubricants, and fragrances.

[0345] The core may include adhesives such as synthetic polymers, waxes, fats, or carbohydrates.

[0346] The core, typically as a homogeneous blend, may include salts of polyvalent cations, reducing agents, antioxidants, peroxide decomposition catalysts, and / or acidic buffer components.

[0347] The core may contain inert particles into which the polypeptide is adsorbed or applied (e.g., by fluidized bed coating) to the surface of the inert particles.

[0348] The diameter of the core can be 20-2000 µm, especially 50-1500 µm, 100-1500 µm or 250-1200 µm.

[0349] The core may be surrounded by at least one coating, for example, to improve storage stability, reduce dust formation during handling, or to color the particles. Optional coatings may include salt coatings or other suitable coating materials, such as polyethylene glycol (PEG), methyl hydroxypropyl cellulose (MHPC), and polyvinyl alcohol (PVA).

[0350] The coating may be applied at a rate of at least 0.1% (e.g., at least 0.5%, at least 1%, at least 5%, at least 10%, or at least 15%) of the core weight. This amount may be at most 100%, 70%, 50%, 40%, or 30%.

[0351] The coating is preferably at least 0.1 µm thick, particularly at least 0.5 µm, at least 1 µm, or at least 5 µm thick. In some embodiments, the coating thickness is less than 100 µm, such as less than 60 µm or less than 40 µm.

[0352] The coating should seal the core unit by forming a substantially continuous layer. A substantially continuous layer should be understood as a coating with very few or no pores, such that the core unit has very few or no uncoated areas. This layer or coating should be uniform in thickness.

[0353] The coating may further comprise other materials as known in the art, such as fillers, anti-sticking agents, pigments, dyes, plasticizers and / or binders, such as titanium dioxide, kaolin, calcium carbonate or talc.

[0354] Salt coatings may contain at least 60% salt by weight, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% salt by weight.

[0355] To provide acceptable protection, the salt coating is preferably at least 0.1 µm thick, such as at least 0.5 µm, at least 1 µm, at least 2 µm, at least 4 µm, at least 5 µm, or at least 8 µm. In particular embodiments, the thickness of the salt coating is less than 100 µm, such as less than 60 µm or less than 40 µm.

[0356] Salt can be added from a salt solution (where the salt is completely dissolved) or from a salt suspension (where the fine particles are less than 50 µm, for example less than 10 µm or less than 5 µm).

[0357] Salt coatings may contain a single salt or a mixture of two or more salts. The salts may be water-soluble, particularly having a solubility of at least 0.1 g in 100 g of water at 20°C, preferably at least 0.5 g / 100 g of water, for example at least 1 g / 100 g of water, or for example at least 5 g / 100 g of water.

[0358] Salts can be inorganic salts, such as sulfates, sulfites, phosphates, phosphonates, nitrates, chlorides, or carbonates, or salts of simple organic acids (less than 10 carbon atoms, such as 6 or fewer carbon atoms), such as citrates, malonates, or acetates. Examples of cations in these salts are alkali or alkaline earth metal ions, ammonium ions, or first transition metal ions, such as sodium, potassium, magnesium, calcium, zinc, or aluminum. Examples of anions include chloride, bromine, iodine, sulfate, sulfite, bisulfite, thiosulfate, phosphate, dihydrogen phosphate, dibasic phosphate, hypophosphite, dihydrogen pyrophosphate, tetraborate, borate, carbonate, bicarbonate, silicate, citrate, malate, maleate, malonic acid, succinate, lactate, formate, acetate, butyrate, propionate, benzoate, tartrate, ascorbate, or gluconate. In particular, alkali or alkaline earth metal salts of sulfate, sulfite, phosphate, phosphonate, nitrate, chloride or carbonate, or salts of simple organic acids such as citrate, malonate or acetate can be used.

[0359] The salt in the coating may have a constant humidity of 60% or more, particularly 70%, 80% or more or 85% or more at 20°C, or it may be another hydrated form of such salt (e.g., anhydrous form). Salt coatings may be as described in WO 00 / 01793 or WO 2006 / 034710.

[0360] A specific example of a suitable salt is NaCl (CH4). 20℃ = 76%), Na2CO3 (CH 20℃ = 92%), NaNO3 (CH 20℃ =73%), Na2HPO4 (CH 20℃ = 95%), Na3PO4 (CH 25℃ = 92%), NH4Cl (CH 20℃ = 79.5%), (NH4)2HPO4 (CH 20℃ =93.0%), NH4H2PO4 (CH 20℃ = 93.1%), (NH4)2SO4 (CH 20℃ =81.1%), KCl (CH 20℃ = 85%), K2HPO4 (CH 20℃ =92%), KH2PO4 (CH 20℃ = 96.5%), KNO3 (CH 20℃ = 93.5%), Na2SO4 (CH 20℃ = 93%), K2SO4 (CH 20℃ = 98%), KHSO4 (CH 20℃= 86%), MgSO4 (CH 20℃ = 90%), ZnSO4 (CH 20℃ = 90%) and sodium citrate (CH 25℃ = 86%). Other examples include NaH2PO4, (NH4)H2PO4, CuSO4, Mg(NO3)2, and magnesium acetate.

[0361] Salts can be in anhydrous form, or they can be hydrated salts, i.e., crystalline salt hydrates with one or more bound water crystals, such as those described in WO 99 / 32595. Specific examples include anhydrous sodium sulfate (Na₂SO₄), anhydrous magnesium sulfate (MgSO₄), magnesium sulfate heptahydrate (MgSO₄•7H₂O), zinc sulfate heptahydrate (ZnSO₄•7H₂O), disodium hydrogen phosphate heptahydrate (Na₂HPO₄•7H₂O), magnesium nitrate hexahydrate (Mg(NO₃)₂(6H₂O)), sodium citrate dihydrate, and magnesium acetate tetrahydrate.

[0362] Preferably, the salt is used as a salt solution, for example, in a fluidized bed.

[0363] Coating materials can be waxy coating materials and film-forming coating materials. Examples of waxy coating materials are poly(ethylene oxide) products (polyethylene glycol, PEG) with an average molecular weight of 1,000 to 20,000; ethoxylated nonylphenol having 16 to 50 ethylene oxide units; ethoxylated fatty alcohols containing 12 to 20 carbon atoms and having 15 to 80 ethylene oxide units; fatty alcohols; fatty acids; and monoglycerides, diglycerides, and triglycerides of fatty acids. Examples of film-forming coating materials suitable for application via fluidized bed technology are given in GB 1483591.

[0364] The particles may optionally have one or more additional coatings. Examples of suitable coating materials are polyethylene glycol (PEG), methyl hydroxypropyl cellulose (MHPC), and polyvinyl alcohol (PVA). Examples of enzyme particles with multiple coatings are described in WO 93 / 07263 and WO 97 / 23606.

[0365] The core can be prepared by blends of granulated components, for example by methods including granulation techniques such as crystallization, precipitation, pan-coating, fluidized bed coating, fluidized bed agglomeration, rotary atomization, extrusion, granulation, spheronization, particle size reduction, drum granulation, and / or high-shear granulation.

[0366] Methods for preparing the core can be found in *Handbook of Powder Technology*; CE Capes, *Particle Size Enlargement*; Volume 1; 1980; Elsevier. Preparation methods include known feed and pellet formulation techniques, such as: (a) Spray-dried products, wherein a liquid peptide-containing solution is atomized in a spray drying tower to form small droplets, which are dried as they descend along the drying tower to form peptide-containing particulate material. This method can produce very small particles (Michael S. Showell (ed.)). Powdered detergents [Powdered Detergent]; SurfactantScience Series; 1998; Volume 71; pp. 140-142; Marcel Dekker.

[0367] (b) Layered products, wherein a polypeptide is coated in layers around a pre-formed inert core particle, wherein the polypeptide-containing solution is typically atomized in a fluidized bed apparatus, in which the pre-formed core particle is fluidized and the polypeptide-containing solution adheres to the core particle and is dried until a dry polypeptide layer remains on the surface of the core particle. If useful core particles of the desired size can be found, particles of the desired size can be obtained in this manner. This type of product is described, for example, in WO 97 / 23606.

[0368] (c) Absorbed core particles, wherein instead of coating the polypeptide in layers around the core, the polypeptide is absorbed onto and / or into the surface of the core. Such a method is described in WO 97 / 39116.

[0369] (d) Extruded or pelletized products, wherein a peptide-containing paste is compressed into pellets or extruded under pressure through small openings and cut into particles, followed by drying of these pellets. Such particles typically have a fairly large size because the material with the extrusion openings (usually a flat plate with perforations) limits the pressure drop allowed through the extrusion openings. Furthermore, when using small openings, the very high extrusion pressure increases the heat generated in the peptide paste, which is detrimental to the peptide (Michael S. Showell (edited);). Powdered detergents [Powdered Detergents]; Surfactant Science Series; 1998; Volume 71; pp. 140-142; Marcel Dekker.

[0370] (e) Spray-granulated products, wherein peptide-containing powder is suspended in molten wax and the suspension is sprayed (e.g., via a rotary sprayer) into a cooling chamber where the droplets rapidly solidify (Michael S. Showell (ed.); Powdered detergents [Powdered Detergent]; Surfactant Science Series; 1998; Vol. 71; pp. 140-142; Marcel Dekker. The resulting product is one in which the polypeptide is uniformly distributed throughout the inert material rather than concentrated on its surface. This technique is described in US 4,016,040 and US 4,713,245.

[0371] (f) A mixer-granulated product in which a polypeptide-containing liquid is added to a dry powder composition of conventional granulation components. The liquid and powder are mixed in a suitable ratio, and as the moisture from the liquid is absorbed into the dry powder, the components of the dry powder begin to adhere and aggregate, and the particles accumulate to form polypeptide-containing granules. Such methods are described in US4,106,991, EP 170360, EP 304332, EP 304331, WO 90 / 09440, and WO 90 / 09428. In certain aspects of this process, various high-shear mixers can be used as granulators. Granules consisting of polypeptides, fillers, and binders are mixed with cellulose fibers to reinforce the granules, thereby producing so-called T-granules. The reinforced granules are more robust and release less enzyme dust.

[0372] (g) Particle size reduction, in which a core is generated by grinding or crushing larger particles, pellets, flat sheets, briquettes, etc., containing polypeptides. The desired core particle fraction is obtained by sieving the ground or crushed product. Oversized and undersized particles can be recovered. Particle size reduction is described in Martin Rhodes (ed.); Principles of Powder Technology; 1990; Chapter 10; John Wiley & Sons.

[0373] (h) Fluidized bed granulation. Fluidized bed granulation involves suspending microparticles in an airflow and spraying liquid through a nozzle onto the fluidized particles. The particles hit by the sprayed droplets become wetted and sticky. The sticky particles collide with and adhere to other particles to form granules.

[0374] (i) These cores can be dried, for example, in a fluidized bed dryer. Those skilled in the art can use other known methods for drying particles in the feed or enzyme industries. Drying is preferably carried out at a product temperature of 25°C to 90°C. For some peptides, it is important that the peptide-containing core contains a small amount of water before salt coating. If water-sensitive peptides are salt-coated before removing excess water, the excess water will be trapped in the core and may negatively affect the activity of the peptide. After drying, these cores preferably contain 0.1-10% w / w water.

[0375] Dust-free particles may be generated, for example, as disclosed in US 4,106,991 and US 4,661,452, and may optionally be coated by methods known in the art.

[0376] The particles may further contain one or more additional enzymes, such as hydrolases, isomerases, ligases, lyases, oxidoreductases, and transferases. One or more additional enzymes are preferably selected from the group consisting of: acetylxylan esterase, acylglycerol lipase, amylase, α-amylase, β-amylase, arabinofuranylase, cellobiase, cellulase, ferulic acid esterase, galactanase, α-galactosidase, β-galactosidase, β-glucanase, β-glucosidase, lysophospholipase, lysozyme, α-mannosidase, β-mannosidase (mannanase), phytase, phospholipase A1, phospholipase A2, phospholipase D, protease, pullulanase, pectin esterase, triacylglycerol lipase, xylanase, β-xylosidase, or any combination thereof. Each enzyme will then be present in more particles, ensuring a more uniform distribution of the enzymes and reducing the physical separation of different enzymes due to the varying particle sizes. The method for generating multi-enzyme coparticles is disclosed in IP.com disclosure IPCOM000200739D.

[0377] Another example of using coparticles to formulate peptides is disclosed in WO 2013 / 188331.

[0378] The present invention also relates to protected polypeptides prepared according to the method disclosed in EP 238216.

[0379] Liquid preparations The present invention also relates to liquid compositions comprising the polypeptides of the present invention. The compositions may comprise enzyme stabilizers (examples of which include polyols (such as propylene glycol or glycerol), sugars or sugar alcohols, lactic acid, reversible protease inhibitors, boric acid or boric acid derivatives such as aromatic borate esters, or phenyl boric acid derivatives such as 4-formylphenylboronic acid).

[0380] In some embodiments, one or more fillers or one or more carrier materials are included to increase the volume of such compositions. Suitable fillers or carrier materials include, but are not limited to, various salts of sulfate, carbonate, and silicate, as well as talc, clay, etc. Suitable fillers or carrier materials for liquid compositions include, but are not limited to, water or low molecular weight primary and secondary alcohols (including polyols and diols). Examples of such alcohols include, but are not limited to, methanol, ethanol, propanol, and isopropanol. In some embodiments, these compositions contain about 5% to about 90% of such materials.

[0381] In one aspect, the liquid formulation contains 20%-80% w / w polyol. In one embodiment, the liquid formulation contains 0.001%-2% w / w preservative.

[0382] In another embodiment, the present invention relates to a liquid preparation comprising: (A) 0.001%-25% w / w of polypeptides having the β-fructofuranosidase activity of the present invention; (B) 20%-80% w / w polyols; (C) Optional 0.001%-2% w / w preservative; and (D) Water.

[0383] In another embodiment, the present invention relates to a liquid preparation comprising: (A) 0.001%-25% w / w of polypeptides having the β-fructofuranosidase activity of the present invention; (B) 0.001%-2% w / w preservative; (C) Optional 20%-80% w / w polyols; and (D) Water.

[0384] In another embodiment, the liquid formulation comprises one or more formulations, such as formulations selected from the group consisting of: polyols, sodium chloride, sodium benzoate, potassium sorbate, sodium sulfate, potassium sulfate, magnesium sulfate, sodium thiosulfate, calcium carbonate, sodium citrate, dextrin, glucose, sucrose, sorbitol, lactose, starch, PVA, acetate, and phosphate, preferably selected from the group consisting of: sodium sulfate, dextrin, cellulose, sodium thiosulfate, kaolin, and calcium carbonate. In one embodiment, the polyol is selected from the group consisting of: glycerol, sorbitol, propylene glycol (MPG), ethylene glycol, diethylene glycol, triethylene glycol, 1,2-propanediol or 1,3-propanediol, dipropylene glycol, polyethylene glycol (PEG) with an average molecular weight of less than about 600, and polypropylene glycol (PPG) with an average molecular weight of less than about 600, more preferably selected from the group consisting of: glycerol, sorbitol, and propylene glycol (MPG), or any combination thereof.

[0385] In another embodiment, the liquid formulation comprises 20%-80% polyols (i.e., the total amount of polyols), such as 25%-75% polyols, 30%-70% polyols, 35%-65% polyols, or 40%-60% polyols. In one embodiment, the liquid formulation comprises 20%-80% polyols, such as 25%-75% polyols, 30%-70% polyols, 35%-65% polyols, or 40%-60% polyols, wherein the polyols are selected from the group consisting of: glycerol, sorbitol, propylene glycol (MPG), ethylene glycol, diethylene glycol, triethylene glycol, 1,2-propanediol or 1,3-propanediol, dipropylene glycol, polyethylene glycol (PEG) with an average molecular weight of less than about 600, and polypropylene glycol (PPG) with an average molecular weight of less than about 600. In one embodiment, the liquid formulation comprises 20%-80% polyol (i.e., the total amount of polyol), such as 25%-75% polyol, 30%-70% polyol, 35%-65% polyol, or 40%-60% polyol, wherein the polyol is selected from the group consisting of glycerol, sorbitol, and propylene glycol (MPG).

[0386] In another embodiment, the preservative is selected from the group consisting of sodium sorbate, potassium sorbate, sodium benzoate, and potassium benzoate, or any combination thereof. In one embodiment, the liquid formulation contains 0.02%-1.5% w / w preservative, such as 0.05%-1% w / w or 0.1%-0.5% w / w preservative. In one embodiment, the liquid formulation contains 0.001%-2% w / w preservative (i.e., the total amount of preservative), such as 0.02%-1.5% w / w, 0.05%-1% w / w, or 0.1%-0.5% w / w preservative, wherein the preservative is selected from the group consisting of sodium sorbate, potassium sorbate, sodium benzoate, and potassium benzoate, or any combination thereof.

[0387] In another embodiment, the liquid formulation further comprises one or more additional enzymes, such as hydrolases, isomerases, ligases, lyases, oxidoreductases, and transferases. The one or more additional enzymes are preferably selected from the group consisting of: acetylxylan esterase, acylglycerol lipase, amylase, α-amylase, β-amylase, arabinofuranoside, cellobiase, cellulase, ferulic acid esterase, galactanase, α-galactosidase, β-galactosidase, β-glucanase, β-glucosidase, lysophospholipase, lysozyme, α-mannoside, β-mannoside (mannanase), phytase, phospholipase A1, phospholipase A2, phospholipase D, protease, pullulanase, pectin esterase, triacylglycerol lipase, xylanase, β-xylosidase, or any combination thereof.

[0388] Example Peptidase activity assay I The peptidase activity of the peptidase of the present invention can be determined by hydrolysis of the Suc-AAPF-pNA substrate. Suc-AAPF-pNA is an abbreviation for N-succinyl-alanine-alanine-proline-phenylalanine-p-nitroaniline, and it is a blocked peptide that can be cleaved by the peptidase. After enzymatic cleavage, free pNA molecules with a yellow color are released, and this can be measured by visible spectrophotometry at a wavelength of 405 nm.

[0389] The assay can be performed on peptidase samples diluted in residual activity buffer (100 mM Tris, pH 8.6). 30 µl of diluted peptidase sample and 70 µl of substrate working solution (0.72 mg / mL, in 100 mM Tris, pH 8.6) are added to a 96-well microtiter plate. The two solutions are mixed at room temperature, and the absorbance at 405 nm is measured over time (e.g., every 20 seconds over 5 minutes). The slope of the time-dependent absorbance curve (absorbance per minute) is proportional to the peptidase activity.

[0390] Peptidase Activity Assay II Peptidase activity can be determined by hydrolysis of the substrate N-[3-(2-furanyl)acryloyl]-Gly-Leu-Ala-OH (FA-GLA). This reaction produces a decrease in absorbance at 340 nm, which is proportional to the enzyme activity.

[0391] The assay was performed at 37°C and pH 7.0 in 0.02 M 3-(N-morpholino)propanesulfonic acid (MOPS) buffer containing 0.33 g / L FA-GLA substrate, 0.001 mM ZnCl2, and 0.001 mM CaCl2. After mixing the substrate with the enzyme, the decrease in absorbance at 340 nm over time was measured. The slope of the time-dependent absorption curve (absorbance per minute) was proportional to the peptidase activity.

[0392] lactonease activity assay Lactonease activity can be achieved by, for example, Khersonsky and Tawfik. Biochemistry[Biochemistry], 2005, Vol. 44, pp. 6371-6382. In short, lactonease activity can be determined by hydrolysis of lactones (such as benzyl acetate and 1-phenylvinyl acetate) in a pH-sensitive colorimetric assay. The release of protons from carboxylic acid formation is tracked using the pH indicator cresol purple. The reaction can be carried out at pH 8.0–8.3 in a 2.5 mM bicine buffer containing 1 mM CaCl2, 0.2 M NaCl, and 0.2–0.3 mM cresol purple (from a 60 mM stock solution in DMSO). A decrease in absorbance at 577 nm after mixing the substrate with the lactonease is proportional to the lactonease activity.

[0393] Example 1: Cloning, expression, and purification of SEQ ID NO: 3, 6, and 12 DNA sequences encoding peptidases SEQ ID NO: 3 and SEQ ID NO: 6 and lactonease SEQ ID NO: 12 (provided herein as SEQ ID NO: 1, SEQ ID NO: 4 and SEQ ID NO: 10, respectively) encoded by genomic DNA from Aspergillus niger strain ATCC1015 were amplified by PCR, and then cloned and transformed into Aspergillus oryzae using the strategy described in Example 1a of WO 2023 / 161245.

[0394] As described in WO 2023 / 161245, fermentation was carried out for four days at 30°C in 500 mL shake flasks in DAP4C-1 medium with stirring at 150 rpm. The culture was filtered through a Nalgene 0.2 µm filter unit to remove host cells.

[0395] The filtered supernatant was concentrated and the buffer was exchanged for 20 mM HEPES (pH 8) using a Sartorius ultrafiltration system with a 10 kDa cutoff membrane. The concentrated sample was applied to a 5 mL Q-Sepharose fast flow column (Cytiva) equilibrated in 20 mM HEPES (pH 8). After washing the column with equilibration buffer, the enzyme was eluted in three column volumes using a linear NaCl gradient (0–1 M NaCl) containing 20 mM HEPES and 1 M NaCl (pH 8). The fractions were analyzed by SDS-PAGE and pooled based on enzyme observation on Coomassie staining gels. The pooled fractions were used as purified enzyme preparations, and their concentrations were determined by measuring absorbance at 280 nm.

[0396] Example 2: Cloning, expression, and purification of SEQ ID NO: 9 Materials and Methods Molecular cloning techniques well known in the field are described in Sambrook, J., Fritsch, EF, Maniatis, T. (1989) Molecular cloning: a laboratory manual (2nd edition) Cold Spring Harbor Laboratory, New York.

[0397] Enzymes used for DNA manipulation (e.g., restriction endonucleases, ligases, etc.) are available from New England Biolabs, Inc. and should be used according to the manufacturer’s instructions.

[0398] Polymerase chain reaction (PCR) was performed using the Expand™ PCR system (Boehringer Mannheim). PCR fragments were purified and DNA fragments were extracted from agarose gels using the QIAquick™ Gel Extraction Kit (Qiagen). The recovered PCR fragments were incorporated into a plasmid vector using the In-Fusion® HD Cloning Kit (TAKARA). Plasmids were constructed and amplified using *E. coli* DH5α (Toyobo). PCR fragments were cloned using the commercial plasmid pBluescript II SK- (Stratagene #212206). The amplified plasmids were recovered using the Qiagen® Plasmid Kit (Qiagen).

[0399] Culture medium and solution: LB medium consists of the following: 10 g tryptone, 5 g yeast extract, 5 g sodium chloride, and deionized water to a final volume of 1 liter.

[0400] LB ampicillin-containing plates consist of the following: 10 g tryptone, 5 g yeast extract, 5 g sodium chloride, 15 g Bacto agar, 100 µg / ml ampicillin, and deionized water to a final volume of 1 liter.

[0401] The TAE buffer consists of: 4.84 g of Tris base, 1.14 ml of glacial acetic acid, 2 ml of 0.5 M EDTA (pH 8.0), and to a final volume of 1 liter of deionized water.

[0402] The COVE salt solution consists of the following: 26 g KCl, 26 g MgSO4•7H2O, 76 g KH2PO4, 50 ml COVE trace metal solution, and 1 liter of deionized water.

[0403] COVE trace metals consist of the following: 0.04 g Na2B4O7•10H2O, 0.4 g CuSO4•5H2O, 1.2 g FeSO4•7H2O, 1.0 g MnSO4•5H2O, 0.8 g Na2MoO4•2H2O, 10 g ZnSO4•7H2O, and topping up to 1 liter of deionized water.

[0404] The AMG trace metal solution consists of the following: 0.3 g citric acid, 0.68 g ZnCl2, 0.25 g CuSO4•5H2O, 0.024 g NiCl2•6H2O, 1.39 g FeSO4•7H2O, 1.356 g MnSO4•5H2O, and is made up to 1 liter of deionized water.

[0405] The COVE-N-glyX plate consists of the following: 218 g xylitol, 10 g glycerol, 2.02 g KNO3, 50 ml COVE salt solution, 25 g Noble agar, and 1 liter of deionized water.

[0406] The COVE salt solution consists of the following: 26 g KCl, 26 g MgSO4•7H2O, 76 g KH2PO4, 50 ml COVE trace metal solution, and 1 liter of deionized water.

[0407] COVE trace metals consist of the following: 0.04 g Na2B4O7•10H2O, 0.4 g CuSO4•5H2O, 1.2 g FeSO4•7H2O, 1.0 g MnSO4•5H2O, 0.8 g Na2MoO4•2H2O, 10 g ZnSO4•7H2O, and topping up to 1 liter of deionized water.

[0408] The COVE medium consists of the following: 342.3 g sucrose, 20 ml COVE salt solution, 10 ml 1 M acetamide, 10 ml 1.5 M CsCl2, 25 g Noble agar, and to a final volume of 1 liter of deionized water.

[0409] The top layer of COVE agarose consists of the following: 342.3 g sucrose, 20 ml COVE salt solution, 10 ml 1 M acetamide, 10 ml 1.5 M CsCl2, 10 g low melting point agarose, and topped up to 1 liter of deionized water.

[0410] The COVE-2 medium consists of the following: 30 g sucrose, 20 ml COVE salt solution, 10 ml 1 M acetamide, 25 g Noble agar, and 1 liter of deionized water.

[0411] MSS medium consists of the following: 70 g sucrose, 100 g soybean flour, three drops of pluronic antifoaming agent, and 1 liter of deionized water; adjust the pH to 6.0.

[0412] Urea-free MU-1 glu medium consists of the following: 260 g glucose, 3 g MgSO4•7H2O, 6 g K2SO4, 5 g KH2PO4, 0.5 ml AMG trace metal solution, a few drops of defoamer, and topping up to 1 liter of deionized water; adjust the pH to 4.5.

[0413] 50% urea consists of 500 g of urea and 1 liter of deionized water.

[0414] YPG medium consists of the following: 10 g yeast extract, 20 g Bacto peptone, 20 g glucose, and 1 liter of deionized water.

[0415] STC consists of 0.8 M sorbitol, 25 mM or 50 mM Tris (pH 8), and 25 mM or 50 mM CaCl2.

[0416] SPTC consists of 40% polyethylene glycol 4000 (PEG4000) in STC buffer.

[0417] The SOC medium consists of the following: 20 g tryptone, 5 g yeast extract, 0.5 g NaCl, 10 ml of 250 mM KCl, and 1 liter of deionized water.

[0418] The TAE buffer consists of: 4.84 g of Tris base, 1.14 ml of glacial acetic acid, 2 ml of 0.5 M EDTA (pH 8.0), and to a final volume of 1 liter of deionized water.

[0419] Strains and plasmids: The expression host strain, Aspergillus niger strain C6061, was isolated by Novozymes and is a derivative of Aspergillus niger NN049184 isolated from soil. Strain C6061 was genetically modified to disrupt the expression of amylosidase and α-amylase activities.

[0420] Plasmid pRika147 is described in Instance 9 of WO 2012 / 160093.

[0421] Conversion strategy: Using known universal methods for the transformation of filamentous fungi (such as Yelton et al., "Transformation of...") Aspergillus nidulans (as described in "Transformation of Aspergillus niger by using a trpC plasmid", Proc. Natl. Acad. Sci. USA, 1984, 81(5), pp. 1470-1474) and the transformation of the parental Aspergillus niger host cell was achieved by following these steps: The *Aspergillus niger* host strain was inoculated into 100 ml of YPG medium and incubated at 32°C and 80 rpm for 16 hours. Globules were collected and washed with 0.6 M KCl, then resuspended in 20 ml of 0.6 M KCl (final concentration 20 mg / ml) containing a commercial β-glucanase product (GLUCANEX™, Novozymes, Bagsvaerd, Denmark). The suspension was incubated at 32°C and 80 rpm until protoplasts formed, then washed twice with STC buffer. Protoplasts were counted using a hemocytometer and resuspended in an 8:2:0.1 STC:STPC:DMSO solution and adjusted to a final concentration of 2.5 × 10⁻⁶. 7 One protoplast per ml. Add approximately 4 µg of plasmid DNA to 100 µl of protoplast suspension, mix gently, and incubate on ice for 30 minutes. Add 1 ml of SPTC and incubate the protoplast suspension at 37°C for 20 minutes. After adding 10 ml of 50°C COVE top agarose, pour the mixture onto basal medium and incubate the plate at 30°C for 5 days.

[0422] PCR protocol: Reagents: 5x PCR buffer (containing MgCl2) 20 µl 10 µl of 2.5 mM dNTP mixture Forward primer (100 µM) 1 µl Reverse primer (100 µM) 1 µl Expand high-fidelity polymerase (Roche) 1 µl Template DNA (50-100 ng / µl) 1 µl Add distilled water to a final volume of 100 µl. condition: Shake flask culture: Spores of the selected transformants were inoculated into 100 ml of MSS medium and cultured at 30°C and 200 rpm for 3 days. Then, 10% of the seed culture was transferred to 100 ml of MU-1 glu medium supplemented with 4 ml of 50% urea solution in a 500 ml flask. The flask was cultured at 30°C and 200 rpm for 5–6 days. The culture supernatant obtained after centrifugation was used for enzyme activity assay.

[0423] Activity determination: The peptidase hydrolysis substrate Z-Gly-Pro-pNA of SEQ ID NO: 9. The sample, appropriately diluted with 50 mM acetate buffer (pH 4.6), was incubated with the substrate at 37°C for 5 min. The color produced by the release of p-nitroaniline (pNA) was quantified by the increase in absorbance at 405 nm.

[0424] Construction of pHUda2808 plasmid Plasmid pHUda2808 was constructed to introduce the cDNA of the Aspergillus niger S28 endopeptidase gene (proA, SEQ ID NO: 7) into plasmid pRika147 between the Aspergillus niger amylase promoter (PamyB) and the glucosylamylase terminator (Tamg) (see Example 9 of WO 2012 / 160093). The plasmid was constructed as described below.

[0425] The following primers were used to generate the PCR product amplifying the cDNA of SEQ ID NO: 7: Primer proA1 (positive): ggatttagtcttgatcggatccaccatgcgttccttctcc (SEQ ID NO:16) Primer proA2 (antonym): gaaatggattgattgtcacgtgtcaagcataatactcctc (SEQ ID NO:17) The desired fragment was amplified by PCR in the reaction, which consisted of approximately 100 ng of Aspergillus niger NN049184 (WO2012 / 160093) cDNA, 1 µl of Expand high-fidelity polymerase (Roche), 100 µM primer proA1, 100 µM primer proA2, 5x PCR buffer (containing MgCl2), and 20 µl of 2.5 mM dNTP mixture (total volume: 100 µl). The reaction was incubated in a Bio-Rad® C1000 Touch™ thermal cycler programmed as follows: 1 cycle at 94°C for 2 minutes; 30 cycles of 30 seconds at 94°C, 30 seconds at 55°C, and 2 minutes at 72°C; 1 cycle at 72°C for 7 minutes; and held at 4°C. The obtained 1,581 bp PCR fragment was purified by 0.8% agarose gel electrophoresis with TAE buffer, excised from the gel, and extracted using the QIAQUICK® Gel Extraction Kit.

[0426] Plasmid pRika147 was digested with BamHI and PmlI and purified by 0.8% agarose gel electrophoresis in TAE buffer, in which a 9,558 bp fragment was excised from the gel and extracted using the QIAQUICK® Gel Extraction Kit. In a reaction, a 1,581 bp fragment was incorporated into a 9,558 bp vector. The reaction consisted of 1 µl of the 9,558 bp fragment, 3 µl of the 1,581 bp fragment, 3 µl of H2O, and 2 µl of the In-Fusion® HD Cloning Kit (Takara Shuzo). The infusion reaction was incubated at 50 °C for 15 min. 5 µl of the mixture was transformed into DH5α chemically competent *E. coli* cells. The transformants were plated on LB agar plates with ampicillin and incubated overnight at 37 °C. Plasmid DNA was purified from several transformants using the QIA Micropreparation Kit. Appropriately ligated plasmid DNA was screened by using appropriate restriction enzymes, followed by 0.8% agarose gel electrophoresis in TAE buffer. One plasmid was named pHUda2808.

[0427] Expression of SEQ ID NO: 9 gene in Aspergillus niger C6061 To express SEQ ID NO: 9, protoplasts of Aspergillus niger strain C6061 were prepared as described above.

[0428] Approximately 10 µg of pHUda2808 was added to 0.3 ml of protoplast suspension, gently mixed, and incubated on ice for 30 minutes. 3 ml of SPTC was added, and the protoplast suspension was incubated at 37°C for 20 minutes. After adding 12 ml of 50°C COVE top agarose, the mixture was poured onto a COVE plate, and the plate was incubated at 30°C for 3 days. Then, 12 ml of 50°C COVE top agarose supplemented with 5 µg / ml 5-fluorocytosine (5-FC) was placed on top, and the plate was incubated at 30°C for 7 days. 5-FC is a reagent used for reverse selection to check whether the expression construct of SEQ ID NO: 9 in pHUda2808 is located at a defined locus in the genomic DNA of host strain C6061.

[0429] The grown transformants were transferred using sterile toothpicks to COVE-2 plates supplemented with 5 ug / ml 5-fluorocytosine. Single spore isolates were transferred to COVE-N-glyX plates.

[0430] Shake-flask fermentation of the transformant Transformants and their parent strain C6061 were cultured on COVE-N-glyX plates at 30°C for approximately one week. Using sterile pipettes, a small stopper was removed from each plate and inoculated into 100 ml of MSS medium in a 500 ml flask. The flasks were incubated at 30°C and 200 rpm for 3 days. 10 ml of the culture was transferred to 100 ml of MU-1 glu medium in a 500 ml flask. The flasks were incubated at 30°C and 200 rpm for 5–6 days. Each culture was centrifuged in a 10 ml tube at 5,000 rpm for 10 minutes, and the supernatant was collected to determine peptidase production. Based on shake-flask fermentation, strain NN069063 was selected as the optimal production strain for SEQ ID NO: 9.

[0431] Purification of SEQ ID NO: 9 Microbial filtration sample NN069063 was mixed with 50 bmM HEPES (pH 7.0) buffer at a volume ratio of 1:1 and then filtered through a 0.22 µm filter membrane. The buffer was then exchanged for 50 mM HEPES (pH 7.0) buffer using a Sephadex G-25 packed column. The buffer-exchanged sample was loaded onto a Source 15Q anion exchange column equilibrated with 50 mM HEPES (pH 7.0) and eluted using a linear gradient of 10 CV with the same buffer containing 0.5 M NaCl. Fractions were pooled based on SDS-PAGE (reduction conditions).

[0432] Example 3: Cloning, expression, and purification of SEQ ID NO: 15 DNA encoding the lactonease of SEQ ID NO: 15 (provided herein as SEQ ID NO: 13) was PCR amplified from the genomic DNA of Aspergillus niger strain ATCC1015, and then cloned and transformed into Aspergillus oryzae using the strategy described in Example 1a of WO 2023 / 161245.

[0433] A recombinant Aspergillus oryzae clone containing a lactonease expression construct was selected and cultured in a shake flask at 1600 ml YPM (1% yeast extract, 2% peptone, and 2% maltose) at 30°C with stirring at 80 rpm for 3 days. The enzyme-containing supernatant was harvested by filtration using a 0.22 μm top vacuum filter (Thermo Fisher Scientific Inc., Waltham, MA, USA).

[0434] The conductivity of the supernatant was adjusted to 190 mS / cm by adding ammonium sulfate in a cold chamber. Precipitate was removed by filtration using a 0.22 μm 1L top-mounted vacuum filter (Thermo Fisher Scientific, Waltham, MA, USA), and the supernatant containing SEQ ID NO: 15 was loaded onto a hydrophobic interaction column (Stopfan Corporation), which was equilibrated with two column volumes (CV) of 0.1 M NaOH, two CVs of ddH2O, and two CVs of 20 mM PBS and (NH4)2SO4 (190 mS / cm). To remove unbound material, the column was washed with two CVs of 20 mM PBS and (NH4)2SO4 (190 mS / cm). SEQ ID NO: 15 was eluted using a linear ammonium sulfate gradient (from 190 mS / cm to 0 mS / cm in 14 CVs, followed by two CVs of 20 mM PBS). Fractions containing SEQ ID NO: 15 were selected and combined based on SDS-PAGE results. The fractions were concentrated using a 10 kDa concentrator (Vivaspin 20, Sartorius) and the purity and concentration of SEQ ID NO: 15 were determined by SDS-PAGE.

[0435] Example 4: Preventive assay of human saliva biofilm Human saliva was collected from 21 different volunteers. The saliva was diluted to 50% in equal volumes of PBS and glycerol, then frozen and stored at -80°C.

[0436] Enzyme solutions were prepared by diluting purified enzyme samples with MilliQ water to achieve a final protein concentration of 50–200 ppm (see Table 1). 1% crystal violet solution was purchased from Sigma-Aldrich and further diluted tenfold with MilliQ water to obtain a 0.1% staining solution. Brain-Heart Infusion (BHI) broth was purchased from Sigma-Aldrich.

[0437] In a flat-bottomed 96-well plate, biofilms were grown in the presence of the enzyme of the present invention by dispensing 10 µl of enzyme solution to each well, followed by 90 µl of saliva solution (9 µl saliva, 9 µl sterile saliva, 7.2 µl 50% sucrose, and 64.8 µl BHI). The plates were inoculated under aerobic conditions at 37°C without shaking for 20 h. Untreated biofilms grown in the absence of enzyme solution served as a control.

[0438] After inoculation, the liquid was removed from the wells, and the biofilm was dried at 37°C for 30 min. After drying, 100 µl of 0.1% crystal violet staining solution was added to each well, and the plate was incubated at room temperature for 30 min. Subsequently, the staining solution was removed, the wells were thoroughly washed with MilliQ water, and the plate was dried at 37°C for 30 min.

[0439] After drying, 100 µl of 33% acetic acid was added to each well to allow for dye extraction for 30 min. The absorbance at 600 nm was measured using a microplate reader (PerkinElmer Ensight).

[0440] For data processing, absorbance is directly proportional to the degree of residual biofilm after enzyme or control treatment. Results are expressed as the percentage of biofilm prevention and calculated as follows: 100 - ((A600 nm enzyme-treated sample) / (A600 nm buffer-treated control sample) × 100) Where A600 nm refers to the average of six absorbance measurements taken at 600 nm for the enzyme- or control-treated sample. The results are listed in Table 1, showing that all evaluated peptidases and lactones exhibited potent biofilm prevention.

[0441] The invention described and claimed herein is not limited to the specific aspects disclosed herein, as these aspects are intended to illustrate several aspects of the invention. Any equivalent aspects are intended to be within the scope of the invention. In fact, various modifications to the invention, in addition to those shown and described herein, will become apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. In case of conflict, the disclosure including the definition shall prevail.

[0442] The invention is further defined by the following numbered paragraphs:

[0443] 1. An oral care composition comprising a peptidase and / or a lactonease.

[0444] 2. The oral care composition according to paragraph 1, wherein the oral care composition comprises a peptidase and a lactonease.

[0445] 3. The oral care composition according to any one of the preceding paragraphs, wherein the peptidase and / or lactonease is obtained from a species of Aspergillus, most preferably Aspergillus niger.

[0446] 4. The oral care composition according to any one of the preceding paragraphs, wherein the peptidase is selected from the group consisting of: a) A polypeptide having at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 3; b) A polypeptide having at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 6; and c) A polypeptide having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 9.

[0447] 5. The oral care composition according to any one of the preceding paragraphs, wherein the peptidase is selected from the group consisting of: a) A polypeptide comprising SEQ ID NO: 3, substantially consisting of SEQ ID NO: 3, or consisting of SEQ ID NO: 3; b) A polypeptide comprising SEQ ID NO: 6, substantially consisting of SEQ ID NO: 6, or consisting of SEQ ID NO: 6; and c) A polypeptide comprising SEQ ID NO: 9, consisting essentially of SEQ ID NO: 9, or consisting of SEQ ID NO: 9.

[0448] 6. The oral care composition according to any one of paragraphs 1-4, wherein the lactonease is selected from the group consisting of: a) A polypeptide having at least 60%, for example, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 12; and b) A polypeptide having at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 15.

[0449] 7. The oral care composition according to any one of paragraphs 1-4, wherein the lactonease is selected from the group consisting of: a) A polypeptide comprising SEQ ID NO: 12, substantially consisting of SEQ ID NO: 12, or consisting of SEQ ID NO: 12; and b) A polypeptide comprising SEQ ID NO: 15, consisting essentially of SEQ ID NO: 15, or consisting of SEQ ID NO: 15.

[0450] 8. The oral care composition according to any one of the preceding paragraphs, wherein the peptidase and / or lactonease are present in an effective amount; preferably in an amount of about 1 ppm to about 500 ppm; most preferably in an amount of about 50 ppm to about 200 ppm.

[0451] 9. The oral care composition according to any one of paragraphs 1-8, wherein the oral care composition is in the form of an internal oral care composition; preferably in the form of toothpaste or toothpaste tablets, tooth cream, mouthwash or mouthwash tablets, oral cleanser, lozenges, soft lozenges, chewing gum, sweets, or candies.

[0452] 10. The oral care composition according to any one of paragraphs 1-8, wherein the oral care composition is in the form of an external oral care composition; preferably in the form of a denture cleaning solution, denture cleaning tablets, or denture cleaning powder.

[0453] 11. The oral care composition according to any one of paragraphs 1-10, for use as a medicine.

[0454] 12. The oral care composition according to any one of paragraphs 1-10, for use in the treatment of oral diseases; preferably for use in the treatment of periodontal diseases (e.g., gingivitis) and / or dental caries.

[0455] 13. Use of the oral care composition according to any one of paragraphs 1-10 for the treatment or preventive treatment of human subjects.

[0456] 14. A method of treating a human subject, the method comprising applying an oral care composition according to any one of paragraphs 1-10; preferably, the oral care composition is applied to the oral cavity of the human subject.

[0457] 15. A method for preventing and / or removing oral biofilms, the method comprising contacting the oral biofilm with an oral care composition according to any one of paragraphs 1-10.

[0458] 16. The method according to paragraph 15, wherein the oral biofilm is located on the target, preferably the denture.

[0459] 17. The method according to paragraph 16, wherein the denture is located inside or outside the oral cavity.

[0460] 18. A set box, the set box comprising: a) The oral care composition according to any one of paragraphs 1-10; and b) the instructions for use.

[0461] 19. A polypeptide having peptidase activity, said polypeptide being selected from the group consisting of: a) A polypeptide having at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 3; b) A polypeptide having at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 6; and c) A polypeptide having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 9.

[0462] 20. A polypeptide having peptidase activity, said polypeptide being selected from the group consisting of: a) A polypeptide comprising SEQ ID NO: 3, substantially consisting of SEQ ID NO: 3, or consisting of SEQ ID NO: 3; b) A polypeptide comprising SEQ ID NO: 6, substantially consisting of SEQ ID NO: 6, or consisting of SEQ ID NO: 6; and c) A polypeptide comprising SEQ ID NO: 9, consisting essentially of SEQ ID NO: 9, or consisting of SEQ ID NO: 9.

[0463] 21. A polypeptide having lactonease activity, said polypeptide being selected from the group consisting of: a) A polypeptide having at least 60%, for example, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 12; and b) A polypeptide having at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 15.

[0464] 22. A polypeptide having peptidase activity, said polypeptide being selected from the group consisting of: a) A polypeptide comprising SEQ ID NO: 12, substantially consisting of SEQ ID NO: 12, or consisting of SEQ ID NO: 12; and b) A polypeptide comprising SEQ ID NO: 15, substantially consisting of SEQ ID NO: 15, or consisting of SEQ ID NO: 15. 23. A polynucleotide encoding a polypeptide according to any one of paragraphs 19-22.

[0465] 24. The polynucleotide according to paragraph 19, wherein the polynucleotide comprises: a) SEQ ID NO: 1 or its mature polypeptide coding sequence; b) SEQ ID NO: 4 or its mature polypeptide coding sequence; c) SEQ ID NO: 7 or its mature polypeptide coding sequence; d) SEQ ID NO: 10 or its mature polypeptide coding sequence; and e) SEQ ID NO: 13 or its mature polypeptide coding sequence.

[0466] 25. The polynucleotide as described in paragraph 23 or 24 is purified.

[0467] 26. The polynucleotide as described in paragraph 23 or 24 is isolated.

[0468] 27. A nucleic acid construct or expression vector comprising a polynucleotide as described in paragraph 22 or 23, the polynucleotide being operatively linked to one or more control sequences that direct the production of the polypeptide in an expression host.

[0469] 28. A recombinant host cell comprising a nucleic acid construct or expression vector as described in paragraph 27.

[0470] 29. The recombinant host cell according to paragraph 28, wherein the polypeptide is heterologous to the recombinant host cell.

[0471] 30. The recombinant host cell according to paragraph 28 or 29, wherein at least one of the one or more control sequences is heterologous to the polynucleotide encoding the polypeptide.

[0472] 31. The recombinant host cell according to any one of paragraphs 28-30, wherein the recombinant host cell comprises at least two copies, such as three, four, five or more copies, of the polynucleotide according to any one of paragraphs 23-24.

[0473] 32. The recombinant host cell according to any one of paragraphs 28-31, wherein the recombinant host cell is a yeast recombinant host cell, for example, cells of the genera *Candida*, *Hansenula*, *Kluyveromyces*, *Pichia*, *Saccharomyces*, *Saccharomyces*, or *Yersinia*, such as *Kluyveromyces lactis*, *Kalvatia*, *Saccharomyces cerevisiae*, *Saccharomyces sacchariformis*, *Saccharomyces davidiana*, *Douglas*, *Kluyveromyces kluyvernsis*, *Nordiya*, *Ovoyces*, or *Yersinia lipolytica* cells.

[0474] 33. The recombinant host cell according to any one of paragraphs 28-31, wherein the recombinant host cell is a filamentous fungal recombinant host cell, such as *Cladosporium*, *Aspergillus*, *Briefomus*, *Cirsium*, *Pseudomonas*, *Aureospora*, *Coprinus*, *Cladosporium*, *Cryptococcus*, *Ustilago*, *Fusarium*, *Pyrophyllus*, *Pyrophyllus*, *Mucor*, *Pyrophyllus*, *Neurospora*, *Penicillium*, etc. Cells of the genera *Moldae*, *Pleurotus*, *Gastromycetes*, *Rumenichthys*, *Pleurotus*, *Schizophyllum*, *Basilaria*, *Thermophilic Ascomycetes*, *Fusporium*, *Cyclophorus*, *Vallisneria*, or *Trichoderma*, especially *Aspergillus buergerianus*, *Aspergillus scabiosifolius*, *Aspergillus fumigatus*, *Aspergillus japonicus*, *Aspergillus nidus*, *Aspergillus niger*, *Aspergillus oryzae*, *Cyclophorus nidus ... , Insectivorous lacewings, Narrow-sided augenosa, Keratopteric augenosa, Lukenowens augenosa, Coprophytic augenosa, Femtosporum augenosa, Queensland augenosa, Tropical augenosa, Brown augenosa, Coprinus comatus, Trichoderma spp., Fusarium moniliforme ... Spores, skin-colored Fusarium, pseudo-branchial Fusarium, sulfur-colored Fusarium, round Fusarium, pseudo-filamentous Fusarium, patchy Fusarium, specific humic mold, loose cottony humic mold, rice black root mold, thermophilic filamentous mold, rough spores, purple-producing Penicillium, yellow-spore flat fungus, radiating fungus, erythrophorus, Emerson basket fungus, terrestrial closporium, long-haired cork fungus, discoloration cork fungus, Trichoderma harzianum, Corning Trichoderma, long-branched Trichoderma, Trichoderma reesei, or green Trichoderma cells.

[0475] 34. The recombinant host cell according to any one of paragraphs 28-33, wherein the recombinant host cell is isolated.

[0476] 35. The recombinant host cell according to any one of paragraphs 28-33, wherein the recombinant host cell is purified.

[0477] 36. A method for producing a polypeptide as described in any one of paragraphs 19-22, the method comprising culturing a recombinant host cell according to any one of paragraphs 28-33 under conditions conducive to the production of said polypeptide.

[0478] 37. The method according to paragraph 36, the method further comprising recovering the polypeptide.

[0479] 38. A method for producing a polypeptide according to any one of paragraphs 28-33, the method comprising culturing cells under conditions conducive to the production of the polypeptide, the cells producing the polypeptide in their wild-type form.

[0480] 39. The method according to paragraph 38, the method further comprising recovering the polypeptide.

[0481] 40. A whole culture medium formulation or cell culture composition comprising a polypeptide according to any one of paragraphs 19-22 and / or a recombinant host cell according to any one of paragraphs 28-33.

Claims

1. An oral care composition comprising a peptidase and / or a lactonease.

2. The oral care composition according to claim 1, wherein the oral care composition comprises peptidase and lactonease.

3. The oral care composition according to any one of the preceding claims, wherein the peptidase and / or lactonease is obtained from a species of Aspergillus, most preferably Aspergillus niger.

4. The oral care composition according to any one of the preceding claims, wherein the peptidase is selected from the group consisting of: a) A polypeptide having at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 3; b) A polypeptide having at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 6; and c) A polypeptide having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO:

9.

5. The oral care composition according to any one of the preceding claims, wherein the peptidase is selected from the group consisting of: a) A polypeptide comprising SEQ ID NO: 3, substantially consisting of SEQ ID NO: 3, or consisting of SEQ ID NO: 3; b) A polypeptide comprising SEQ ID NO: 6, substantially consisting of SEQ ID NO: 6, or consisting of SEQ ID NO: 6; and c) A polypeptide comprising SEQ ID NO: 9, consisting essentially of SEQ ID NO: 9, or consisting of SEQ ID NO:

9.

6. The oral care composition according to any one of claims 1-4, wherein the lactonease is selected from the group consisting of: a) A polypeptide having at least 60%, for example, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 12; and b) A polypeptide having at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO:

15.

7. The oral care composition according to any one of claims 1-4, wherein the lactonease is selected from the group consisting of: a) A polypeptide comprising SEQ ID NO: 12, substantially consisting of SEQ ID NO: 12, or consisting of SEQ ID NO: 12; and b) A polypeptide comprising SEQ ID NO: 15, consisting essentially of SEQ ID NO: 15, or consisting of SEQ ID NO:

15.

8. The oral care composition according to any one of the preceding claims, wherein the peptidase and / or lactonease are present in an effective amount; preferably in an amount of about 1 ppm to about 500 ppm; most preferably in an amount of about 50 ppm to about 200 ppm.

9. The oral care composition according to any one of the preceding claims, wherein the oral care composition is in the form of toothpaste or toothpaste tablets, tooth cream, mouthwash or mouthwash tablets, oral cleanser, lozenges, soft lozenges, chewing gum, sweets or candies.

10. The oral care composition according to any one of claims 1-8, for use as a medicine.

11. The oral care composition according to any one of claims 1-8, for use in the treatment of oral diseases; preferably for use in the treatment of periodontal disease and / or dental caries.

12. A method for preventing and / or removing oral biofilms, the method comprising contacting the oral biofilm with an oral care composition according to any one of claims 1-8.

13. A polypeptide having peptidase activity, said polypeptide being selected from the group consisting of: a) A polypeptide having at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 3; b) A polypeptide having at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 6; and c) A polypeptide having at least 60%, such as at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO:

9.

14. A polypeptide having peptidase activity, said polypeptide being selected from the group consisting of: a) A polypeptide comprising SEQ ID NO: 3, substantially consisting of SEQ ID NO: 3, or consisting of SEQ ID NO: 3; b) A polypeptide comprising SEQ ID NO: 6, substantially consisting of SEQ ID NO: 6, or consisting of SEQ ID NO: 6; and c) A polypeptide comprising SEQ ID NO: 9, consisting essentially of SEQ ID NO: 9, or consisting of SEQ ID NO:

9.

15. A polypeptide having lactonease activity, said polypeptide being selected from the group consisting of: a) A polypeptide having at least 60%, for example, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO: 12; and b) A polypeptide having at least 60%, for example at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with SEQ ID NO:

15.

16. A polypeptide having peptidase activity, said polypeptide being selected from the group consisting of: a) A polypeptide comprising SEQ ID NO: 12, substantially consisting of SEQ ID NO: 12, or consisting of SEQ ID NO: 12; and b) A polypeptide comprising SEQ ID NO: 15, consisting essentially of SEQ ID NO: 15, or consisting of SEQ ID NO:

15.

17. A polynucleotide encoding a polypeptide according to any one of claims 13-16.

18. A nucleic acid construct or expression vector comprising the polynucleotide of claim 17, the polynucleotide being operatively linked to one or more control sequences that direct the production of the polypeptide in an expression host.

19. A recombinant host cell comprising the nucleic acid construct or expression vector according to claim 18.

20. A method for producing a polypeptide according to any one of claims 13-17, the method comprising: The recombinant host cell according to claim 19 is cultured under conditions conducive to the production of the polypeptide, and optionally, the polypeptide is recovered.

Images