Application of GmABCB19ab gene in regulating soybean plant type
By regulating the soybean GmABCB19ab gene and editing soybean genes using the CRISPR-Cas9 system, the problems of excessive stem growth and reduced petiole angle were solved, thereby optimizing the soybean plant architecture, improving lodging resistance and stress resistance, and promoting increased soybean yield.
Patent Information
- Application Number
- CN202610412959.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-31
- Publication Date
- 2026-06-26
Smart Images

Figure CN122277685A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to the application of the GmABCB19ab gene in regulating soybean plant architecture. Background Technology
[0002] Soybean (Glycine max) is an important crop used for both grain, oil, and feed. In recent years, my country's soybean demand has remained around 110 million tons, with nearly 90 million tons imported annually, resulting in an import dependency rate exceeding 85%, highlighting a significant supply-demand imbalance. The core bottleneck causing the current state of my country's soybean industry is low yield per unit area and limited arable land. Currently, limited arable land resources have led to dense planting and intercropping becoming effective measures to increase soybean yield per unit area. However, these planting methods exacerbate mutual shading between plants, inducing a shade avoidance response, mainly manifested as excessive stem elongation and thinning, and a smaller petiole angle, which in turn reduces the soybean's resistance to lodging and other adverse conditions, severely restricting yield increases. Therefore, breeding high-yielding soybean varieties that combine short stalks and a small petiole angle is of great significance for breaking through the yield bottleneck.
[0003] The ABCB subfamily (ABCB) of plant ABC transporters is involved in the transport of various plant hormones. The Arabidopsis thaliana AtABCB19 gene has been reported to be involved in auxin polar transport and photomorphogenesis, but the function of the soybean GmABCB19ab gene, especially its role in plant architecture regulation, has not been reported. Summary of the Invention
[0004] To address the shortcomings of existing technologies, the present invention aims to provide the application of the soybean GmABCB19ab gene in regulating soybean plant height and petiole angle.
[0005] To achieve the objectives of this invention, the following technical solutions can be used:
[0006] In a first aspect, the present invention provides a soybean GmABCB19ab protein, wherein the soybean GmABCB19ab protein is as follows (A1) or (A2):
[0007] (A1) A protein consisting of the amino acid sequences described in SEQ ID NO. 3 and SEQ ID NO. 4 of the sequence listing;
[0008] (A2) A protein derived from (A1) having the same function by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequences described in SEQ ID NO. 3 and SEQ ID NO. 4 in the sequence listing;
[0009] (A3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of (A1) or (A2).
[0010] Preferably, the nucleotide sequence of the gene encoding the soybean GmABCB19ab protein is shown in SEQ ID NO. 1 and SEQ ID NO. 2 in the sequence listing.
[0011] In the aforementioned proteins, the protein tag refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology for expression, to facilitate the expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.
[0012] Secondly, this invention provides the application of substances that reduce the content or activity of soybean GmABCB19ab protein, or reduce / silence the expression level of soybean GmABCB19ab gene, in reducing the height of soybean plants:
[0013] The soybean GmABCB19ab protein is either (A1) or (A2) as follows:
[0014] (A1) A protein consisting of the amino acid sequences described in SEQ ID NO. 3 and SEQ ID NO. 4 of the sequence listing;
[0015] (A2) A protein derived from (A1) having the same function by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequences described in SEQ ID NO. 3 and SEQ ID NO. 4 in the sequence listing;
[0016] (A3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of (A1) or (A2);
[0017] The nucleotide sequence of the soybean GmABCB19ab gene is shown in SEQ ID NO. 1 and SEQ ID NO. 2 in the sequence listing.
[0018] Thirdly, this invention protects the use of substances that reduce the content or activity of soybean GmABCB19ab protein, or reduce / silence the expression level of the soybean GmABCB19ab gene, in reducing the angle between soybean petioles:
[0019] The soybean GmABCB19ab protein is either (A1) or (A2) as follows:
[0020] (A1) A protein consisting of the amino acid sequences described in SEQ ID NO. 3 and SEQ ID NO. 4 of the sequence listing;
[0021] (A2) A protein derived from (A1) having the same function by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequences described in SEQ ID NO. 3 and SEQ ID NO. 4 in the sequence listing;
[0022] (A3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of (A1) or (A2);
[0023] The nucleotide sequence of the soybean GmABCB19ab gene is shown in SEQ ID NO. 1 and SEQ ID NO. 2 in the sequence listing.
[0024] Fourthly, this invention also protects the use of substances that reduce the content or activity of soybean GmABCB19ab protein, or reduce / silence the expression level of the soybean GmABCB19ab gene, in soybean breeding:
[0025] The soybean GmABCB19ab protein is either (A1) or (A2) as follows:
[0026] (A1) A protein consisting of the amino acid sequences described in SEQ ID NO. 3 and SEQ ID NO. 4 of the sequence listing;
[0027] (A2) A protein derived from (A1) having the same function by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequences described in SEQ ID NO. 3 and SEQ ID NO. 4 in the sequence listing;
[0028] (A3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of (A1) or (A2);
[0029] The nucleotide sequence of the soybean GmABCB19ab gene is shown in SEQ ID NO. 1 and SEQ ID NO. 2 in the sequence listing;
[0030] The purpose of the soybean breeding is to reduce soybean plant height or decrease the petiole angle.
[0031] In a specific implementation, the substance that reduces the content or activity of soybean GmABCB19ab protein, or reduces / silences the expression of soybean GmABCB19ab gene, is an RNA interference molecule, an antisense oligonucleotide, a CRISPR / Cas9 gene editing system, or a TALEN or zinc finger nuclease-mediated targeted knockout element.
[0032] In a specific implementation scheme, the nucleotide sequence of the gRNA targeting the GmABCB19ab encoding gene in the CRISPR / Cas9 gene editing system is as follows:
[0033] GmABCB19ab-gRNA1: TTTTACAAGCTCTTCTCAT, as shown in SEQ ID NO.5;
[0034] GmABCB19ab-gRNA2: CTGAGAAAGAAGTACTTGG, as shown in SEQ ID NO.6;
[0035] GmABCB19ab-gRNA3: TATCTATCAACGTTTCTGG, as shown in SEQ ID NO.7; and
[0036] GmABCB19ab-gRNA4: GAAGCTTGGATACAAGGCA, as shown in SEQ ID NO.8.
[0037] In the specific implementation plan, the soybean variety is the Glycine max variety Wm82.
[0038] Fifthly, the present invention protects a method for reducing soybean plant height, the method comprising reducing the content and / or activity of the soybean GmABCB19ab protein as described above, or reducing / silencing the expression level of the soybean GmABCB19ab gene as described above.
[0039] Sixthly, the present invention protects a method for reducing the petiole angle, the method comprising reducing the content and / or activity of the soybean GmABCB19ab protein described above, or reducing / silencing the expression level of the soybean GmABCB19ab gene described above.
[0040] Seventhly, the present invention protects a method for breeding soybean varieties with reduced plant height or reduced petiole angle, the method comprising reducing the content and / or activity of the soybean GmABCB19ab protein described above, or reducing / silencing the expression level of the soybean GmABCB19ab gene described above.
[0041] In a specific implementation plan, the reduction of the content and / or activity of the soybean GmABCB19ab protein mentioned above, or the reduction / silencing of the expression level of the soybean GmABCB19ab gene mentioned above, is achieved by editing the coding gene of GmABCB19ab using the CRISPR-Cas9 system.
[0042] In a specific implementation scheme, the nucleotide sequence of the gRNA targeting the GmABCB19ab encoding gene in the CRISPR-Cas9 system is as follows:
[0043] GmABCB19ab-gRNA1: TTTTACAAGCTCTTCTCAT, as shown in SEQ ID NO.5;
[0044] GmABCB19ab-gRNA2: CTGAGAAAGAAGTACTTGG, as shown in SEQ ID NO.6;
[0045] GmABCB19ab-gRNA3: TATCTATCAACGTTTCTGG, as shown in SEQ ID NO.7; and
[0046] GmABCB19ab-gRNA4: GAAGCTTGGATACAAGGCA, as shown in SEQ ID NO.8.
[0047] The GmABCB19ab gene was edited using the CRISPR-Cas9 system. It was found that after the GmABCB19ab mutation, soybean plant height decreased and petiole angle narrowed under both white light and shading conditions.
[0048] The significant advantages of this invention are:
[0049] This invention provides, for the first time, the application of the protein encoded by the GmABCB19ab gene in regulating soybean plant height and petiole angle. Therefore, this invention can yield plant lines with short stems and small petiole angles suitable for dense planting conditions, and has significant application value. Attached Figure Description
[0050] Figure 1 This invention relates to the gene editing form of the soybean gmabcb19ab mutant.
[0051] Figure 2 This is a graph showing the statistical results of plant height and petiole angle of the soybean gmabcb19ab mutant line under normal greenhouse light conditions.
[0052] Figure 3 This is a statistical result of the petiole angle of the soybean gmabcb19ab mutant line under greenhouse shading conditions. Detailed Implementation
[0053] To facilitate understanding of the present invention, the technical solutions described below are further illustrated with specific embodiments, but the present invention is not limited thereto. Unless otherwise specified, the experimental materials used in the following embodiments were purchased from conventional biochemical reagent stores. The determination of vector sequencing in the following embodiments was performed by conventional sequencing companies.
[0054] The soybean (Glycine max) variety Wm82 was provided by the National Center for Soybean Improvement.
[0055] The gene editing vector used in this invention is pCas9 (https: / / pmc.ncbi.nlm.nih.gov / articles / PMC4507317 / ), provided by the National Center for Soybean Improvement.
[0056] Example 1: Construction of a plant expression vector for the soybean GmABCB19ab gene mutant
[0057] This invention provides primers for constructing expression vectors, including primers for amplifying guide RNA (gRNA) sequences:
[0058] GmABCB19ab-F1: GGATTGTATCTATCAACGTTTCTGG, as shown in SEQ ID NO.9;
[0059] GmABCB19ab-R1:AAACCCAGAAACGTTGATAGATACA,as shown in SEQ ID NO.10;
[0060] GmABCB19ab-F3: GGATTGCTGAGAAAGAAGTACTTGG, as shown in SEQ ID NO.11;
[0061] GmABCB19ab-R3: AAACCCAAGTACTTCTTTCTCAGCA, as shown in SEQ ID NO.12;
[0062] GmABCB19ab-F5: GGATTGGAAGCTTGGATACAAGGCA, as shown in SEQ ID NO.13;
[0063] GmABCB19ab-R5:AAACTGCCTTGTATCCAAGCTTCCA, as shown in SEQ ID NO.14;
[0064] GmABCB19ab-F6: GGATTGATGAGAAGAGCTTGTAAAA, as shown in SEQ ID NO.15;
[0065] GmABCB19ab-R6: AAACTTTTACAAGCTCTTCTCATCA, as shown in SEQ ID NO.16.
[0066] (I) Construction of recombinant plasmid PUC19-GmABCB19ab-gRNA
[0067] KOD Plus is a product of TOYOBO.
[0068] 1. Obtaining gRNA fragments
[0069] (1) Prepare reaction system 1-4.
[0070] Reaction system 1 is 10 μL, consisting of 1 μL of GmABCB19ab-F1 primer aqueous solution (concentration of 10 μM), 1 μL of GmABCB19ab-R1 primer aqueous solution (concentration of 10 μM), and 8 μL of Anneal Buffer (TE buffer containing 50 mM NaCl for reaction).
[0071] Reaction system 2 consisted of 10 μL of 1 μL of GmABCB19ab-F3 primer aqueous solution (concentration 10 μM), 1 μL of GmABCB19ab-R3 primer aqueous solution (concentration 10 μM), and 8 μL of Anneal Buffer (TE buffer containing 50 mM NaCl for reaction).
[0072] Reaction system 3 consisted of 10 μL of 1 μL of GmABCB19ab-F5 primer aqueous solution (concentration 10 μM), 1 μL of GmABCB19ab-R5 primer aqueous solution (concentration 10 μM), and 8 μL of Anneal Buffer (TE buffer containing 50 mM NaCl for reaction).
[0073] Reaction system 4 consisted of 10 μL of 1 μL of GmABCB19ab-F6 primer aqueous solution (concentration 10 μM), 1 μL of GmABCB19ab-R6 primer aqueous solution (concentration 10 μM), and 8 μL of Anneal Buffer (TE buffer containing 50 mM NaCl for reaction).
[0074] (2) After completing step (1), take reaction systems 1-4 respectively and perform annealing amplification. In the PCR instrument, slowly cool down from 95℃ to 16℃ (0.1℃ / s).
[0075] 2. Connect the target to the pUC19 vector.
[0076] (1) Prepare reaction system 5-8.
[0077] Reaction system 5 is 20 μL, consisting of 10 μL of reaction system 1, 1 μL of pUC19-1 digested with BsaI, 2 μL of 10×T4 buffer, 1 μL of T4 ligase, and 6 μL of ddH2O.
[0078] Reaction system 6 is 20 μL, consisting of 10 μL of reaction system 2, 1 μL of PUC19-3 digested with BsaI, 2 μL of 10×T4 buffer, 1 μL of T4 ligase, and 6 μL of ddH2O.
[0079] Reaction system 7 is 20 μL, consisting of 10 μL of reaction system 3, 1 μL of PUC19-5 digested with BsaI, 2 μL of 10×T4 buffer, 1 μL of T4 ligase, and 6 μL of ddH2O.
[0080] Reaction system 8 is 20 μL, consisting of 10 μL reaction system 4, 1 μL PUC19-6 digested with BsaI, 2 μL 10×T4 buffer, 1 μL T4 ligase and 6 μL ddH2O.
[0081] (3) After completing step (1), take 5-8 of the reaction system respectively and transform the product into Escherichia coli DH5α competent cells (Tolu Harbor) to obtain several monoclonal cells.
[0082] (4) Using each single clone as a template, PCR amplification was performed using primer pairs consisting of primer M13R: 5'-CAGGAAACAGCTATGAC-3' and GmABCB19ab-R1, GmABCB19ab-R3, GmABCB19ab-R5, and GmABCB19ab-R6, respectively. Clones containing the target fragment of 700 bp were sent for bacterial culture sequencing to obtain positive clones.
[0083] (5) Positive monoclonal antibodies were inoculated into LB liquid medium and cultured at 37 °C to obtain bacterial culture; then plasmids were extracted from the bacterial culture, namely recombinant plasmids pUC19-GmABCB19ab-1, pUC19-GmABCB19ab-3, pUC19-GmABCB19ab-5 and pUC19-GmABCB19ab-6.
[0084] 3. Connect pUC19-GmABCB19ab-1, pUC19-GmABCB19ab-3, pUC19-GmABCB19ab-5 and pUC19-GmABCB19ab-6 to the pCas9 final carrier.
[0085] (1) Preparation of reaction system 9. Reaction system 9 is 20 μL and consists of 1 μL pCas9-adaptor vector (50 ng / μL), 2 μL pUC19-GmABCB19ab-1 (50 ng / μL), 2 μL pUC19-GmABCB19ab-3 (50 ng / μL), 2 μL pUC19-GmABCB19ab-5 (50 ng / μL), 2 μL pUC19-GmABCB19ab-6 (50 ng / μL), 1 μL AarIenzyme (thermo), 0.4 μL 50 × oligo, 2 μL 10 × T4 ligation buffer (NEB), 1 μL T4 ligase and 6.6 μL ddH2O.
[0086] (2) After completing step (1), take the reaction system 9 and carry out the connection reaction.
[0087] The reaction conditions were: 37 ℃ for 5 min, 25 ℃ for 10 min (15 cycles in total); 50 ℃ for 5 min, 80 ℃ for 10 min, and stored at 4 ℃.
[0088] (3) After completing step (2), the reaction product is transformed into Escherichia coli DH5α competent cells (Tolo Harbor) to obtain several monoclonal cells.
[0089] (4) Using a single clone as a template, PCR amplification was performed using primer pairs consisting of primers GmABCB19ab-F1 and GmABCB19ab-R5; and GmABCB19ab-F3 and GmABCB19ab-R6. Clones containing the target fragment of 700 bp were sent for bacterial culture sequencing to obtain positive clones.
[0090] Positive monoclonal antibodies were inoculated into LB liquid medium and cultured to obtain bacterial culture; then the plasmid, namely the recombinant plasmid pCas9-GmABCB19ab, was extracted from the bacterial culture.
[0091] Based on the sequencing results, the structure of the recombinant plasmid pCas9-GmABCB19ab is described as follows: The DNA molecule shown in SEQ ID NO. 3 was inserted between the recognition sequence of the restriction endonuclease AarI of the vector pCas9 to obtain the recombinant plasmid.
[0092] Example 2. Obtaining transgenic soybean plants
[0093] 1. After constructing the recombinant plasmid and transforming Agrobacterium EHA105, soybean transformation was carried out.
[0094] 2. The recombinant plasmid was transformed into soybean variety Wm82 (hereinafter referred to as soybean). After screening, differentiation, and rooting, T0 generation transgenic soybean plants were obtained. The specific steps are as follows:
[0095] (1) Sterilize soybeans with chlorine gas produced by the reaction of 15 mL concentrated hydrochloric acid and 100 mL sodium hypochlorite for 2.5 h-3 h. Take them out and dry them in a clean bench.
[0096] (2) Seed germination: Sow soybeans evenly in the germination medium, about 20-30 seeds per dish.
[0097] (3) Agrobacterium infection: Cut the soybean in half, remove part of the embryo tip, and make a wound in the meristematic area to obtain the soybean explant. Place it in a recombinant Agrobacterium bacterial solution with an OD600 nm of about 0.6 and shake at room temperature for 30 min. Take out the explant and blow it under sterile conditions for 10 min. Then spread it on the co-culture medium and incubate in the dark for 5 days.
[0098] (4) Wash the embryo 4-5 times with sterile water and liquid induction medium containing hormones to ensure that Agrobacterium is thoroughly cleaned. Cut off the elongated embryo, leaving only 3-4 mm. Insert the embryo downwards into the solid bud induction medium and incubate for 2 weeks in a 16 h light / 8 h dark incubator at 25 ℃.
[0099] (5) After 15 days, some explants began to sprout. Those with sprouts were cut off from the stump and transferred to a new solid bud induction medium. Those without sprouts were discarded and continued to be cultured under light in the greenhouse.
[0100] (6) After 15 days, the explants that sprouted were subcultured into a new solid bud induction medium, and the cotyledons that did not sprout were discarded. The explants were cultured in the greenhouse for 15 days. The explants were cultured in the solid bud induction medium for a total of 30 days.
[0101] (7) Separate the well-grown callus from the cotyledons, discard the explants, scrape off the black surface of the callus, and transfer it to a solid shoot elongation medium. Replace the solid elongation medium every 15 days, and generally subculture 4-5 times, for a total of 60-80 days. The callus is being screened while it is elongating, and seedlings will grow during the screening process.
[0102] (8) When the seedlings grow to about 4-5 cm, cut them off from the callus and transfer them to the rooting medium.
[0103] (9) After culturing in the rooting medium for about 20-30 days, the seedlings that have grown strong and developed root systems can be transferred to a pure vermiculite environment in a disposable cup and placed in a low-light hardening environment. Use another disposable plastic cup to cover the seedlings to achieve the purpose of moisturizing. Generally, hardening takes 5 days.
[0104] (10) After a few days of adaptation, when you observe obvious root growth, remove the disposable cup used for moisturizing. Transfer it to a large pot containing nutrient soil and continue to cultivate it.
[0105] Example 3. Molecular identification of mutant types in transgenic soybeans
[0106] For CRISPR knockout vectors, this application detected their basta resistance gene and Cas9 protein. PCR amplification was performed based on the location of their gRNA, followed by sequencing.
[0107] After Sanger sequencing, gmabcb19ab-1 and gmabcb19ab-2 plants were obtained, and neither mutant contained the Cas9 protein.
[0108] Sequencing results showed that compared with the wild type, gmabcb19ab-1 had the following mutation in the GmABCB19a gene on both homologous chromosomes: the "5'-GGAGCAGACTCTGCCCTTTTACAAGCTCTTCTCATTTGCAGACAAGTGTG-3'" in the GmABCB19a gene, corresponding to positions 50-100 of SEQ ID NO. 1, was mutated to "5'-GGAGCAGACTCTGCCCTTTTGCTCTTCTCATTTGCAGACAAGTGTG-3'". This mutation results in a nucleotide deletion at positions 71-74 of SEQ ID NO. 1, causing a frameshift and premature termination of translation, leading to loss of function of the GmABCB19a protein and thus knockout of the GmABCB19a gene. Compared to the wild type, gmabcb19-2 shows the following mutations in the GmABCB19a genes on both homologous chromosomes: the 5'-GGAGCAGACTCTGCCCTTTTACAAGCTCTTCTCATTTGCAGACAAGTGTG-3' in the GmABCB19a gene corresponds to positions 50-100 of SEQ ID NO. 1, and is mutated to "5'-GGAGCAGACTCTGCCCTTTACAAGCTCTTCTCATTTGCAGACAAGTGTG-3'". This mutation results in a nucleotide deletion at position 70 of SEQ ID NO. 1, causing a frameshift and resulting in loss of function of the GmABCB19a protein, thus knocking out the GmABCB19a gene. Sequencing results for the two mutation sites and their surrounding nucleotides are shown in [link to sequencing data]. Figure 1 As shown.
[0109] Sequencing results showed that compared with the wild type, gmabcb19ab-1 had the following mutation in the GmABCB19b gene on both homologous chromosomes: the "5'-AGAGGAGCAGACACTACCCTTTTACAAGCTCTTCTCATTTGCAGACAAG-3'" in the GmABCB19b gene, corresponding to positions 50-100 of SEQ ID NO.2, was mutated to "5'-AGAGGAGCAGACACTACCCTTACAAGCTCTTCTCATTTGCAGACAAG-3'". This mutation results in a nucleotide deletion at positions 72-73 of SEQ ID NO. 2, causing a frameshift and premature termination of translation, leading to loss of function of the GmABCB19b protein and thus knockout of the GmABCB19b gene. Compared to the wild type, both homologous chromosomes of gmABCB19-2 exhibit the following mutations in the GmABCB19b gene: The '5'-AGAGGAGCAGACACTACCCTTTTACAAGCTCTTCTCATTTGCAGACAAG-3' in the GmABCB19b gene corresponds to positions 50-100 of SEQ ID NO. 2, and is mutated to '5'-AGAGGAGCAGACACTACCCTTTTAAGCTCTTCTCATTTGCAGACAAG-3'. This mutation results in a nucleotide deletion at positions 75-76 of SEQ ID NO. 2, causing a frameshift and resulting in loss of function of the GmABCB19b protein, thus knocking out the GmABCB19b gene. Sequencing results for these two mutation sites and their surrounding nucleotides are shown in [link to sequencing data]. Figure 1 As shown.
[0110] Example 4. Phenotypic identification of GmABCB19ab loss-of-function mutant plants.
[0111] Seeds of two homozygous mutant lines of the GmABCB19ab gene obtained in Example 3 and seeds of the wild-type soybean variety Wm82 were planted in a greenhouse under normal light conditions and grown to stage V2. One group continued to grow under normal light conditions, while the other group was transferred to a Low R / FR environment. Plant type traits such as plant height, petiole length, and leaf angle were investigated at stage V4. Under both normal light and shading conditions, the plant heights of soybean mutants gmabcb19ab-1 and gmabcb19ab-2 (average values of 7.76 cm and 10.77 cm under normal light, respectively; and 11.83 cm and 17.29 cm under shading conditions, respectively) were significantly shorter than those of wild-type Wm82 (average value of 13.08 cm under normal light and 21.54 cm under shading conditions) (P<0.05). The petiole angles of soybean mutants gmabcb19ab-1 and gmabcb19ab-2 (for the second trifoliate leaf counting downwards from the stem apex: average values were 50 ℃ and 43.33 ℃ under normal light, and 9.22 ℃ and 11.56 ℃ under shade; for the third trifoliate leaf counting downwards from the stem apex: average values were 50 ℃ and 56.89 ℃ under normal light, and 4.33 ℃ and 13.56 ℃ under shade) were significantly smaller than those of wild-type Wm82 (for the second trifoliate leaf counting downwards from the stem apex: average value was 66.33 ℃ under normal light, and 34.22 ℃ under shade; for the third trifoliate leaf counting downwards from the stem apex: average value was 86.89 ℃ under normal light, and 37.2 ℃ under shade) (P<0.05). Under both experimental conditions, the petiole length of the mutant lines was not significantly different from that of the wild type. Phenotypic results are as follows: Figure 3 As shown.
[0112] This experiment was conducted under two illumination conditions: normal illumination (WL) (WL: photosynthetic photon flux density (PPFD) = 300 μmol / m³). -2 s -1 , R:FR=8.04, Blue=59 μmol m -2 s -1 ) and shading conditions Low R:FR (WL+FR: maintain PPFD = 300 μmol m -2 s -1 The value remained unchanged. After supplementing with far-red light, the R:FR value decreased to 0.63, and Blue = 58.82 μmol m. -2 s -1 ).
[0113] The present invention has been described in detail above. The scope of protection of the present invention is not limited to the embodiments described above. Variations and advantages that can be conceived by those skilled in the art without departing from the spirit and scope of the inventive concept are included in the present invention and are protected by the appended claims.
Claims
1. Application of substances that reduce the content or activity of soybean GmABCB19ab protein, or reduce / silence the expression level of the soybean GmABCB19ab gene, in reducing soybean plant height: in, The soybean GmABCB19ab protein is as follows (A1) or (A2): (A1) A protein consisting of the amino acid sequences described in SEQ ID NO. 3 and SEQ ID NO. 4 of the sequence listing; (A2) A protein derived from (A1) having the same function by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequences described in SEQ ID NO. 3 and SEQ ID NO. 4 in the sequence listing; (A3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of (A1) or (A2); The nucleotide sequence of the soybean GmABCB19ab gene is shown in SEQ ID NO. 1 and SEQ ID NO. 2 in the sequence listing.
2. Application of substances that reduce the content or activity of soybean GmABCB19ab protein, or reduce / silence the expression level of the soybean GmABCB19ab gene, in reducing the soybean petiole angle: in, The soybean GmABCB19ab protein is as follows (A1) or (A2): (A1) A protein consisting of the amino acid sequences described in SEQ ID NO. 3 and SEQ ID NO. 4 of the sequence listing; (A2) A protein derived from (A1) having the same function by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequences described in SEQ ID NO. 3 and SEQ ID NO. 4 in the sequence listing; (A3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of (A1) or (A2); The nucleotide sequence of the soybean GmABCB19ab gene is shown in SEQ ID NO. 1 and SEQ ID NO. 2 in the sequence listing.
3. Application of substances that reduce the content or activity of soybean GmABCB19ab protein, or reduce / silence the expression level of the soybean GmABCB19ab gene, in soybean breeding: in, The soybean GmABCB19ab protein is as follows (A1) or (A2): (A1) A protein consisting of the amino acid sequences described in SEQ ID NO. 3 and SEQ ID NO. 4 of the sequence listing; (A2) A protein derived from (A1) having the same function by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequences described in SEQ ID NO. 3 and SEQ ID NO. 4 in the sequence listing; (A3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of (A1) or (A2); The nucleotide sequence of the soybean GmABCB19ab gene is shown in SEQ ID NO. 1 and SEQ ID NO. 2 in the sequence listing; The purpose of the soybean breeding is to reduce soybean plant height or decrease the petiole angle.
4. The application according to any one of claims 1-3, characterized in that, The substances that reduce the content or activity of soybean GmABCB19ab protein, or reduce / silence the expression of soybean GmABCB19ab gene, are RNA interference molecules, antisense oligonucleotides, CRISPR / Cas9 gene editing systems, or TALEN or zinc finger nuclease-mediated targeted knockout elements.
5. The application according to claim 4, characterized in that, The nucleotide sequence of the gRNA targeting the GmABCB19ab encoding gene in the CRISPR / Cas9 gene editing system is as follows: GmABCB19ab-gRNA1: TTTTACAAGCTCTTCTCAT, GmABCB19ab-gRNA2: CTGAGAAAGAAGTACTTGG, GmABCB19ab-gRNA3: TATCTATCAACGTTTCTGG and GmABCB19ab-gRNA4: GAAGCTTGGATACAAGGCA.
6. A method for reducing soybean plant height, characterized in that, The method includes reducing the content and / or activity of the soybean GmABCB19ab protein as described in claim 1, or reducing / silencing the expression level of the soybean GmABCB19ab gene as described in claim 1.
7. A method for reducing the included angle of the petiole, characterized in that, The method includes reducing the content and / or activity of the soybean GmABCB19ab protein as described in claim 1, or reducing / silencing the expression level of the soybean GmABCB19ab gene as described in claim 1.
8. A method for cultivating soybean varieties with reduced plant height or decreased petiole angle, characterized in that, The method includes reducing the content and / or activity of the soybean GmABCB19ab protein as described in claim 1, or reducing / silencing the expression level of the soybean GmABCB19ab gene as described in claim 1.
9. The method according to any one of claims 6-8, characterized in that, The reduction of the content and / or activity of the soybean GmABCB19ab protein as described in claim 1, or the reduction / silencing of the soybean GmABCB19ab gene expression level as described in claim 1, is achieved by editing the coding gene of GmABCB19ab using the CRISPR-Cas9 system.
10. The method according to claim 9, characterized in that, The nucleotide sequence of the gRNA targeting the GmABCB19ab encoding gene in the CRISPR-Cas9 system is as follows: GmABCB19ab-gRNA1: TTTTACAAGCTCTTCTCAT, GmABCB19ab-gRNA2: CTGAGAAAGAAGTACTTGG, GmABCB19ab-gRNA3: TATCTATCAACGTTTCTGG and GmABCB19ab-gRNA4: GAAGCTTGGATACAAGGCA.