A molecular marker related to stem diameter under salt stress of alfalfa and application thereof

Abstract

This invention belongs to the field of molecular biology, specifically relating to a molecular marker associated with stem diameter in alfalfa under salt stress and its application. The technical problem this invention addresses is that the selection of alfalfa varieties with ideal stem diameter under salt stress primarily relies on multi-year phenotypic measurements, a time-consuming and labor-intensive process heavily influenced by the environment, resulting in insufficient selection efficiency and accuracy. The technical solution of this invention is a molecular marker associated with stem diameter in alfalfa under salt stress, with the following locus information: chromosome: chr5; location: 58795369; SNP genotype: G / T. This invention also provides a primer set for amplifying the aforementioned molecular marker. This invention can be used for early prediction of stem diameter in alfalfa under salt stress and for marker-assisted breeding.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to a molecular marker related to stem diameter of alfalfa under salt stress and its application. Background Technology

[0002] Alfalfa (Medicago sativa L.) is an important leguminous forage crop, characterized by high yield and quality. Stem diameter, as one of the important agronomic traits reflecting stem mechanical strength and plant structure, is closely related to lodging resistance, biomass formation, and cultivation adaptability. Under adverse conditions such as salt stress, stem development and stem thickness are more easily affected by environmental factors, leading to significant phenotypic fluctuations and increasing the difficulty of breeding selection.

[0003] In current breeding practices, under salt stress, the selection of ideal stem diameter often relies on multi-year or multi-location field measurements and single-plant selection. This method is not only costly and time-consuming, but also significantly affected by environmental and year-specific differences in phenotype, limiting the accuracy and efficiency of selection. To more stably characterize the genetic effects of materials, breeding and quantitative genetic analysis often incorporate multi-year / multi-environmental phenotypic data into mixed linear models, correcting for environmental effects and obtaining the best linear unbiased predictive value (BLUP) as a comprehensive phenotypic index, thereby improving the stability and comparability of trait evaluation.

[0004] Developing molecular markers based on base variations at target sites and conducting molecular detection and marker-assisted selection in the early stages of breeding can significantly improve screening efficiency. Among them, competitive allele-specific PCR (KASP) is a commonly used SNP genotyping technique, typically consisting of two allele-specific forward primers and one universal reverse primer. It distinguishes different alleles through fluorescence signals and features high throughput, relatively low cost, and convenient detection. It can be used for associated site verification and marker-assisted selection.

[0005] Therefore, developing KASP molecular markers that are closely related to stem diameter under salt stress in alfalfa and using them for material identification and early selection in breeding is of great significance for reducing the workload of phenotypic identification, improving selection accuracy and accelerating the breeding process. Summary of the Invention

[0006] The technical problem this invention aims to solve is that the selection of alfalfa varieties with ideal stem diameter traits under salt stress mainly relies on multi-year phenotypic measurements. The selection process is time-consuming and labor-intensive, greatly affected by the environment, and lacks selection efficiency and accuracy.

[0007] The technical solution of this invention is a molecular marker related to the stem diameter of alfalfa under salt stress, and its site information is as follows: chromosome: chr5; location: 58795369; SNP genotype: G / T.

[0008] Furthermore, the nucleotide sequence of the molecular marker is shown in SEQ ID No. 1 and / or SEQ ID No. 2.

[0009] The present invention also provides a primer set for amplifying the molecular marker, the nucleotide sequences of which are shown in SEQ ID No. 3-5.

[0010] The present invention also provides a molecular marker detection kit, comprising primers shown in SEQ ID No. 3-5.

[0011] The present invention also provides a molecular marker chip, comprising primers shown in SEQ ID No. 3-5.

[0012] The present invention also provides applications of the molecular marker, primer sets for amplifying the molecular marker, the kit, and / or the molecular marker chip, wherein at least one of the following is provided: a. Predicting the stem diameter of alfalfa material under salt stress; b. Identification and screening of alfalfa materials with different stem diameters under salt stress conditions; c. Molecular marker-assisted breeding of alfalfa materials with different stem diameters under salt stress; d. Preparation of alfalfa materials with different stem diameters under salt stress conditions.

[0013] Specifically, in the aforementioned application, if the classification is G / G, it is a coarse-stemmed alfalfa material; if the classification is G / T, it is a fine-stemmed alfalfa material.

[0014] This invention also provides a method for screening alfalfa materials with different stem diameters under salt stress or predicting the stem diameter of alfalfa materials under salt stress, comprising the following steps: extracting genomic DNA from the alfalfa material to be tested; performing PCR amplification on the SNP molecular marker sites using the primers described in SEQ ID No. 3-5; sequencing the amplification products, and screening or predicting their genotypes.

[0015] The amplification program is as follows: 94℃ for 15 min; 95℃ for 20 sec, 65~56℃ for 60 sec, 10 cycles, with the annealing extension temperature decreasing by 0.8℃ in each cycle; 94℃ for 20 sec, 57℃ for 60 sec, 10 cycles.

[0016] Specifically, the criteria for genotyping or prediction are as follows: if the genotyping result is G / G, it is a coarse-stemmed alfalfa material; if the genotyping result is G / T, it is a fine-stemmed alfalfa material.

[0017] The beneficial effects of this invention are as follows: Based on the association analysis of stem diameter phenotypic data (BLUP values ​​obtained after environmental effect correction) and genotypic data under salt stress conditions over many years, this invention obtained a SNP locus (chr5_58795369) that is significantly associated with stem diameter under salt stress conditions in alfalfa, with a LOD value of 7.22 and an explainable phenotypic contribution rate of 11.17%. A KASP primer combination was designed for this locus. KASP (competitive allele-specific PCR), as a commonly used SNP genotyping technique, can achieve rapid genotyping detection of biallelic SNP loci. The KASP primer combination developed in this invention can directly and specifically distinguish and detect the G or T bases of the target SNP mutation site, thereby enabling early prediction and marker-assisted breeding of stem diameter traits in alfalfa under salt stress conditions. This reduces the workload of phenotypic identification and significantly improves selection efficiency, accelerating the genetic improvement process of stem diameter traits, and has significant application value and promotional significance. Attached Figure Description

[0018] Figure 1 GWAS revealed a significant association between the chr5_58795369 locus and diameter.

[0019] Figure 2 Comparison of stem diameter differences among alfalfa genotypes under salt stress conditions. Detailed Implementation

[0020] To further illustrate the technical means and effects of the present invention in achieving its intended purpose, the following detailed description of the specific implementation methods, structures, features, and effects of the present invention, in conjunction with the accompanying drawings and preferred embodiments, is provided below.

[0021] Example 1: Obtaining Molecular Markers This experimental population consisted of 176 alfalfa germplasm materials, including core germplasm, germplasm from different regions, and germplasm with different phenotypes. Considering the variability among individual plants of the same alfalfa variety, cuttings were taken from the germplasm resource nursery and propagated by cuttings in a greenhouse. After successful rooting, these germplasm materials were transplanted to an experimental field in Yinchuan, Ningxia. In the experimental field, a randomized block design was used to establish the experimental population, with three replicates, each containing five cuttings. To ensure sufficient growing space, the interval between replicates was 150 cm, and the distance between rows and plants was set at 80 cm and 80 cm, respectively. During the growing season, no fertilization or irrigation was applied; only manual weeding was carried out. Winter irrigation was provided to help the plants overwinter.

[0022] Under salt stress growth conditions, the stem diameter of each material was manually measured at the initial flowering stage to obtain phenotypic data for different replicates and years. To reduce the influence of environmental factors such as year and block design on phenotypic performance, a linear mixed model was used to jointly analyze multi-year, multi-replica data to estimate the BLUP value of stem diameter for each material, which was then used for subsequent GWAS analysis.

[0023] 100 mg of young alfalfa leaves were selected, flash-frozen in liquid nitrogen, and then total plant DNA was extracted using the CWBIO Plant Genomic DNA Extraction Kit (Cowin Biosciences, Taizhou, China) according to the manufacturer's instructions. The concentration and quality of the total DNA were detected using a micro spectrophotometer (Nano Photometer NP80, Germany), and then sequenced on the BGIDNBSEQ next-generation sequencing platform (BGI, Shenzhen, China).

[0024] Each material yielded approximately 36 GB of raw data. The raw sequencing data was processed using Trimmomatic (version 0.39) (Bolger et al., 2014) software to remove the adapter and filter out low-quality base sequences. The cleaned sequencing data was then aligned to the haplotype reference genome of 'Zhongmu 4' alfalfa using BWA-MEM. SAMtools (version 1.13) was used to filter multiple alignments and low-quality sequences, resulting in filtered BAM files, which were then sorted. PCR repetitive sequences were marked using the Mark Duplicates function in the Picard toolkit (version 2.23.0). Finally, the processed BAM files were used for variant detection using GATK Haplotype Caller (version 4.2.3.062). The following parameters were set as screening criteria in the SNP filtering strategy: Quality By Depth (QD) less than 2.0, Fisher Strand (FS) greater than 60.0, MQ Rank Sum Test less than -12.5, Read PosRank Sum less than -8.0, SOR (Strand Odds Ratio) greater than 3.0, and Mapping Qualities (MQ) less than 40.0. Subsequently, the selection criteria for a subset of alfalfa SNP markers were defined, including: (1) using VCFtools (version 0.1.16) to remove SNP markers with a deletion rate greater than 20% and a minor allele frequency (MAF) less than 0.05%, thereby creating a basic SNP set containing only biallelic SNP markers; (2) using Plink (version 1.90b6.21) to filter the basic SNP set based on linkage disequilibrium (LD), setting the LD filter window size to 100 SNPs, the window step size to 50 SNPs, and the r2 threshold to 0.2, to obtain a core SNP marker set. The missing genotypes in the LD-filtered SNP marker set were then filled using Beagle software with default parameters. Similarly, VCFtools was used to filter Indel markers, retaining only biallelic markers with a deletion rate less than 20% and a MAF greater than 0.05%.

[0025] GWAS analysis was conducted using 2,043,025 high-quality SNP markers. Association analysis employed the FarmCPU (Fixed and random model Circulating Probability Unification) model, which iteratively combines fixed and random effects to reduce false positives and improve detection efficacy while controlling for population structure and kinship. Principal component analysis (PCA) was first performed on the SNP data, with the first three principal components used as covariates to correct for population structure; model reliability was assessed using QQ plots. GWAS results (including Manhattan plots and QQ plots) were visualized using the R package CMplot. Linkage disequilibrium (LD) analysis and visualization of associated SNPs were performed using LDBlockShow. Finally, a locus chr5_58795369, significantly associated with stem diameter under salt stress in alfalfa, was detected near chr5 at 58.79 Mb, with a LOD value of 7.22 and an explainable phenotypic contribution of 11.17%. Figure 1 ).

[0026] Example 2: Development of KASP marker at the chr5_58795369 locus The chr5_58795369 locus is located near 58.79 Mb on chromosome 5. Specific information: chromosome: chr5; location: 58795369; SNP genotype: G / T.

[0027] The reference genome "Zhongmu 4" yielded approximately 200 bp of sequences upstream and downstream of the chr5_58795369 site: SEQ ID No. 1, where lowercase letters represent SNP sites; TTTGCGACGTTAACCCTGCCAGCCTAAAATTGCATTTAAAAGAATATGTAAAAGGAGAAGCAACCAAAAAAAAAATTAATTATCAAAGAAGAAAGAAGAAATCATTGTTAACCTGCAGAGACACTGTCAATGATTTATATCCAGGAAg TGCGTACATACTTATCATCATTTAGTCATTCTGGAAATAAACATACATGAAAAGATACTTTTACATGGAATCCTAGAGTAAATGCATCTCAATTACTCAAGAAATAATGACAAAATCATTGCAGATAGCTCAACGTGCATCTTGAA.

[0028] SEQ ID No. 2, where lowercase letters represent SNP sites; TTTGCGACGTTAACCCTGCCAGCCTAAAATTGCATTTAAAAGAATATGTAAAAGGAGAAGCAACCAAAAAAAAAATTAATTATCAAAGAAGAAAGAAGAAATCATTGTTAACCTGCAGAGACACTGTCAATGATTTATATCCAGGAAt TGCGTACATACTTATCATCATTTAGTCATTCTGGAAATAAACATACATGAAAAGATACTTTTACATGGAATCCTAGAGTAAATGCATCTCAATTACTCAAGAAATAATGACAAAATCATTGCAGATAGCTCAACGTGCATCTTGAA.

[0029] KASP primers were designed using Bacthprimer 3 software for the chr5_58795369 locus and its flanking sequences (SEQ ID No. 1 and SEQ ID No. 2). Each KASP marker consisted of two specific primers and one universal primer. Fluorescent adapter sequences (GAAGGTGACCAAGTTCATGCT for FAM and GAAGGTCGGAGTCAACGGATT for HEX) were ligated to the 5' end of the specific primers. The KASP marker primers are as follows: Specific primer 1 (SEQ ID No. 3): GAAGGTGACC AAGTTCATGC TATTTGCCAG AGAGTATACTCAGGAAG; Specific primer 2 (SEQ ID No. 4): GAAGGTCGGA GTCAACGGAT TATTTGCCAG AGAGTATACTCAGGAAT; Universal primer (SEQ ID No. 5): GAGAGTGCATT TACTCTAGGA TTCCA.

[0030] Example 3: Use of Molecular Markers Another 108 alfalfa samples were selected as a validation population. They were planted, managed, sampled, and had genomic DNA extracted according to the method described in Example 1. The SNP molecular marker site chr5_58795369 (G / T) described in this invention was used as the detection target, and KASP genotyping analysis was performed using the Array Tape ultra-high-throughput genotyping system. The system may include Nexar for automated PCR reaction assembly, Soellex for high-throughput PCR amplification, Araya for endpoint fluorescence signal reading, and Intellics for experimental information management, fluorescence data management, and genotyping report output.

[0031] The PCR system was assembled using NEXAR, and the PCR reaction system is shown in Table 1.

[0032] Table 1 KASP Reaction System .

[0033] Touchdown PCR amplification was then performed on a Soellex under the following conditions: 94℃ for 15 min; 95℃ for 20 sec, 65–56℃ for 60 sec, 10 cycles, with the annealing extension temperature decreasing by 0.8℃ per cycle; 94℃ for 20 sec, 57℃ for 60 sec, 30 cycles. After the PCR reaction, the endpoint fluorescence signal was scanned using Araya, and Intellics performed clustering and genotyping based on the two-channel fluorescence intensity data.

[0034] BLUP value analysis of salt stress phenotypic data from two locations over three years revealed that only two genotypes remained for this molecular marker: G:G and G:T (as shown in Table 2). This indicates that the homozygous T:T genotype is salt-sensitive and has been completely eliminated through natural and artificial selection. This finding demonstrates that the G allele is a key marker determining salt-tolerant stem diameter and can be directly used for molecular breeding selection, exhibiting clear technical effectiveness and practicality.

[0035] Simultaneously, the stem diameter of each material under salt stress was measured, and the BLUP value of stem diameter was calculated as a phenotypic index based on multi-year / multi-repeated experimental data to reduce the influence of environmental differences on phenotype; a larger BLUP value indicates a larger overall stem diameter under salt stress (better performance). Of the 108 validation materials, 54 were of the G / G genotype and 54 were of the G / T genotype. As shown in Table 2, the BLUP value of stem diameter in the G / G group was generally higher than that in the G / T group (G / G group range: -0.584 to 0.666; G / T group range: -0.5 to 0.349). Further statistical analysis showed that the BLUP value of stem diameter in the G / G group was significantly higher than that in the G / T group (…). Figure 2The value , indicating a highly significant difference (P < 0.01), directly confirms that this molecular marker can serve as a key marker for salt-tolerant molecular breeding selection.

[0036] Table 2. Allelic types of 108 germplasm materials at this locus.

[0037] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some modifications or alterations to the above-disclosed technical content to create equivalent embodiments without departing from the scope of the present invention. Any simple modifications, equivalent changes and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.

Claims

1. A molecular marker associated with stem diameter under salt stress in Medicago sativa, characterized in that: Its locus information is as follows: Chromosome: chr5; Location: 58795369; SNP type: G / T.

2. The molecular marker of claim 1, wherein: The nucleotide sequence of the molecular marker is shown in SEQ ID No. 1 or / and SEQ ID No.

2.

3. A primer set for amplifying the molecular marker of claim 1 or 2, characterized in that: Its nucleotide sequence is shown in SEQ ID No. 3~5.

4. A molecular marker detection kit, characterized by: Includes the primers shown in SEQ ID No. 3~5.

5. A molecular marker chip, characterized in that: Includes the primers shown in SEQ ID No. 3~5.

6. The application of the molecular marker of claim 1 or 2, the primer set for amplifying the molecular marker of claim 3, the kit of claim 4, and / or the molecular marker chip of claim 5, characterized in that: It is at least one of the following: a. Predicting the stem diameter of alfalfa material under salt stress; b. Identification and screening of alfalfa materials with different stem diameters under salt stress conditions; c. Molecular marker-assisted breeding of alfalfa materials with different stem diameters under salt stress; d. Preparation of alfalfa materials with different stem diameters under salt stress conditions.

7. In the application according to claim 6, the characteristic is: If the classification is G / G, it is a coarse-stemmed alfalfa material; if the classification is G / T, it is a fine-stemmed alfalfa material.

8. A method for screening alfalfa materials with different stem diameters under salt stress or predicting the stem diameter of alfalfa materials under salt stress, characterized in that: The procedure includes the following steps: extracting genomic DNA from the alfalfa material to be tested; performing PCR amplification on the SNP molecular marker sites using the primers described in SEQ ID No. 3-5; and sequencing, genotyping, or prediction of the amplified products.

9. The method according to claim 8, characterized in that: The amplification program is as follows: 94℃ for 15 min; 95℃ for 20 sec, 65~56℃ for 60 sec, 10 cycles, with the annealing extension temperature decreasing by 0.8℃ in each cycle; 94℃ for 20 sec, 57℃ for 60 sec, 10 cycles.

10. The method according to claim 8, characterized in that: The criteria for genotyping or prediction are as follows: if the genotyping result is G / G, it is a coarse-stemmed alfalfa material; if the genotyping result is G / T, it is a fine-stemmed alfalfa material.

Images