Method for identifying the gender of a zamiaceae plant

By developing specific molecular markers and primer pairs, the sex of *Zeimi* plants can be rapidly identified using PCR technology, solving the problem of sex identification in the seedling stage and improving the efficiency of conservation and population restoration.

CN122279090APending Publication Date: 2026-06-26SHENZHEN XIANHU BOTANICAL GARDEN ADMINISTRATION
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
SHENZHEN XIANHU BOTANICAL GARDEN ADMINISTRATION
Filing Date
2026-05-18
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

Current technologies cannot quickly and effectively identify the sex of plants in the seedling stage of the genus *Zemi*, resulting in low efficiency in conservation and population restoration efforts.

Method used

We developed specific molecular markers and primer pairs to detect the genome of *Zemi* plants using PCR technology, and used molecular markers linked to the Y chromosome to rapidly identify plant sex.

Benefits of technology

This technology enables rapid sex identification of plants in the genus *Zemitera*, shortens observation time, improves the efficiency of horticultural research and management, and promotes the protection and ex-situ conservation management of endangered germplasm resources.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122279090A_ABST
    Figure CN122279090A_ABST
Patent Text Reader

Abstract

This invention belongs to the field of plant sex identification technology, and particularly relates to the application of a molecular marker in identifying the sex of *Zephyranthes* plants. The molecular marker is linked to the Y chromosome of *Zephyranthes* plants and comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO:1. The molecular marker provided by this invention can be tightly linked to the Y chromosome of *Zephyranthes* plants, thereby achieving the purpose of early and rapid sex detection. This has significant practical implications for sex selection and proportioning of ornamental garden plants, understanding and protecting endangered *Zephyranthes* germplasm resources, and improving the effectiveness of ex-situ and in-situ conservation management.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant sex identification technology, and particularly relates to a method for identifying the sex of plants in the genus *Zemitera*. Background Technology

[0002] *Zamiaceae*, a genus of plants belonging to the order Cycadales and family Zamiaceae, is mainly distributed in tropical and subtropical regions of the Americas. Due to their beautiful appearance, overexploitation of wild resources, and evolutionary deficiencies (weak natural regeneration capacity and low seed germination rate), 95% of species in this genus are listed on the IUCN Red List of Threatened Species, making it a flagship group for global biodiversity conservation. The male-to-female sex ratio is a core factor influencing population reproductive capacity and stability, and its study plays a crucial role in in-situ and ex-situ conservation practices for this group.

[0003] The genus *Zemys* comprises 86 species, all of which are dioecious. Distinguishing between male and female plants during the seedling stage is difficult, and previously, sex could only be determined upon sexual maturity (the formation of sporophyll cones). However, *Zemys* plants typically take several years or even decades to reach sexual maturity. The lack of simple and effective methods for sex identification during the seedling stage severely restricts the efficiency of effective conservation and population restoration efforts for this genus. Field reintroduction practices in conservation work often lack a basis for sex matching, and ex-situ conservation practices also struggle to establish a reasonable allocation of male and female plants in the early stages.

[0004] Existing technologies have reported on sex identification of Cycadaceae plants (such as molecular markers developed based on the Y chromosome of Cycadaceae plants). However, it should be clarified that although *Zemitera* and Cycadaceae belong to the same order Cycadales, they diverged independently at the end of the Paleozoic era, exhibiting significant morphological differences and being taxonomically classified as an independent family, *Zemitera* family. More importantly, their chromosome numbers and genome sequences differ significantly; therefore, molecular markers developed for Cycadaceae cannot be directly applied to *Zemitera* plants. Therefore, developing specific molecular markers and corresponding sex identification methods for *Zemitera* plants is of great significance for the scientific conservation and germplasm resource utilization of this genus. Summary of the Invention

[0005] To address the issue of sex identification in *Zemitera* plants before sexual maturity, this invention provides a specific molecular marker and a corresponding sex identification method for rapid sex identification of *Zemitera* plants.

[0006] The first aspect of the present invention provides the application of a molecular marker in identifying the sex of plants of the genus *Zemitera*, wherein the molecular marker is linked to the Y chromosome of the *Zemitera* plant, and the molecular marker comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 1.

[0007] Furthermore, the molecular marker has a sequence as shown in SEQ ID NO: 1.

[0008] Furthermore, the application includes: detecting the genome of the target plant by PCR, and identifying whether the target plant is male by whether the result is positive.

[0009] A second aspect of the present invention provides a primer pair, Used to verify the sequence shown in SEQ ID NO: 1, wherein the primer pair includes an upstream primer sequence shown in SEQ ID NO: 2 and a downstream primer sequence shown in SEQ ID NO: 3, or: a sequence that differs from the sequence shown in SEQ ID NO: 2 by one nucleotide and a sequence that differs from the sequence shown in SEQ ID NO: 3 by one nucleotide.

[0010] A third aspect of this invention provides a method for identifying the sex of plants in the genus *Zemitera*, comprising: The genome of the *Zemitera* species to be tested is detected to determine whether it contains the sequence shown in SEQ ID NO: 1. If it contains the sequence shown in SEQ ID NO: 1, it is identified as male; otherwise, it is identified as female.

[0011] Furthermore, the identification method includes: performing PCR amplification on the target *Zemitera* plant using the above primer pairs, and determining whether the obtained PCR amplification product contains the sequence shown in SEQ ID NO: 1.

[0012] Furthermore, the *Zemitera* plants to be tested include *Zemitera* plants of any age.

[0013] Furthermore, the identification method also includes the step of extracting plant genome.

[0014] Furthermore, the PCR amplification procedure includes: Pre-denaturation: 95℃ for 4 minutes; Cycle: 95℃ denaturation for 30 seconds, 55℃ annealing for 45 seconds, 72℃ extension for 2 minutes, run 35 cycles; Final extension: 72℃ for 10 minutes; Incubation: The amplification products were incubated at 4℃.

[0015] Furthermore, the *Zamia* species include: *Zamia furfuracea*, *Zamiapygmaea*, *Zamia integrifolia*, *Zamia floridana* (Z. pumila), *Zamia loddigesii*, and *Zamia lindenii*.

[0016] Compared with the prior art, the beneficial effects of the present invention are as follows: The method for sex identification of *Zephyranthes* plants provided by this invention allows for rapid sex identification of *Zephyranthes* plants of any age, especially seedlings, without waiting for sexual maturity. This significantly shortens the observation time for sex identification and improves the efficiency of horticultural research and management. Furthermore, early sex identification of *Zephyranthes* plants is of significant practical importance for the sex selection and proportioning of ornamental garden plants, understanding and protecting endangered *Zephyranthes* germplasm resources, and improving the effectiveness of ex-situ and in-situ conservation management. Attached Figure Description

[0017] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0018] Figure 1 This is a schematic diagram showing the results of PCR amplification of DNA from the genomes of 61 species of *Zemitera* plants using primer pairs, as described in an embodiment of the present invention. Detailed Implementation

[0019] To make the technical problem to be solved, the technical solution, and the beneficial effects of the present invention clearer, the present invention will be further described in detail below with reference to embodiments and accompanying drawings. It should be understood that the specific embodiments described herein are merely illustrative of the present invention and are not intended to limit the present invention.

[0020] The present invention provides a molecular marker that is linked to the Y chromosome of plants of the genus *Zemi*.

[0021] The molecular markers described in this embodiment can link genomic DNA sequences with the sex chromosomes of plants in the Cyperaceae family, thereby facilitating the establishment of sex identification for Cyperaceae plants using molecular markers. Furthermore, since the molecular markers are located on the Y chromosome of Cyperaceae plants, the sex of Cyperaceae plants can be obtained simply, quickly, and in high throughput, which is beneficial for sex identification in conservation biology and horticultural cultivation practices of Cyperaceae plants.

[0022] Specifically, the molecular marker comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO: 1.

[0023]

[0024] In some embodiments, the molecular marker is the fragment shown in SEQ ID NO: 1 in the *Zemi* genome, meaning that the nucleotide sequence other than the 5' and / or 3' ends of SEQ ID NO: 1 is also a sequence in the *Zemi* genome. In some embodiments, the molecular marker also includes upstream and downstream sequences of the 5' and / or 3' ends of SEQ ID NO: 1 in the *Zemi* genome.

[0025] It should be noted that as long as the genomic DNA of *Ichthyophthirius multifiliis* strain to be amplified or detected contains this molecular marker, the sequence shown in SEQ ID NO. 1 can be detected or amplified. The length of the upstream and downstream sequences at the 5' and / or 3' ends of SEQ ID NO. 1 is appropriate and not particularly limited in this invention. For example, the length of the molecular marker can be less than 10000 bp, less than 5000 bp, less than 2000 bp, less than 1500 bp, less than 1200 bp, less than 1000 bp, or less than 800 bp.

[0026] In some embodiments, the molecular marker can be obtained by amplifying the DNA of the male genome of *Zemitera* plants using primer pairs as a template; in other embodiments, the molecular marker can be obtained by DNA chemical synthesis methods.

[0027] A second aspect of the present invention provides a primer pair, comprising primer 1 and primer 2, for amplification using DNA from the genome of male plants of the genus *Zemitera* as a template to obtain the aforementioned molecular markers.

[0028] Specifically, primer 1 includes the sequence shown in SEQ ID NO: 2 (GTGAGATAACGGCCAAACGTC).

[0029] Specifically, primer 2 includes the sequence shown in SEQ ID NO: 3 (GCTGCAACCGAAATGCAAGA).

[0030] In some embodiments, primer 1 and primer 2 may each have 1 to 10 bases added to their 5' or 3' ends. The type of bases added can be determined based on the base types in the regions on the Zemi iron genomic DNA that match SEQ ID NO: 2 and SEQ ID NO: 3, and according to base pairing principles. The resulting primer pair is substantially the same as the amplification products of SEQ ID NO: 2 and SEQ ID NO: 3 (the DNA sequences between the upstream and downstream primers are identical). Therefore, primer pairs that have 1 to 10 bases added to the 5' or 3' ends of SEQ ID NO: 2 and SEQ ID NO: 3 and can amplify substantially the same DNA fragments should all be included in the primer pairs of the present invention.

[0031] A third aspect of the present invention provides the application of the above-mentioned molecular markers in identifying the sex of plants in the genus *Zemitera*.

[0032] A fourth aspect of this invention provides a method for identifying the sex of plants in the genus *Zemitera*, comprising: The steps for detecting whether the sex chromosomes of the *Zemitera* species to be tested are linked to the aforementioned molecular markers are as follows: Alternatively, the above primer pairs can be used to perform PCR amplification on the target *Zemitera* plants, and the steps can be taken to determine whether the obtained PCR amplification product contains the molecular markers described above.

[0033] The following description is based on specific embodiments: Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available, and techniques not described in detail were performed according to standard methods well known to those skilled in the art.

[0034] Example 1: Sex determination of plants in the genus *Zemitera* 1. Steps for extracting genomic DNA from leaves of different sexes of *Zemitera* species The plant materials used in this embodiment were all from Nanning Botanical Garden, specifically including the following species: *Zamia furfuracea*, *Zamia pygmaea*, *Zamia integrifolia*, *Zamia floridana* (Z. pumila), *Zamia loddigesii*, and *Zamialindenii*. Genomic DNA was extracted from the leaves of 61 male and female plants of the above-mentioned *Zamia* species using the cetyltrimethylammonium bromide (CTAB) method.

[0035] 2. Preparation steps of molecular markers Using the extracted leaves of different sexes of *Zemitera* plants as templates, PCR amplification was performed using primer pairs (SEQ ID NO: 2 and SEQ ID NO: 3).

[0036] The PCR reaction system is shown in Table 1.

[0037] Table 1 PCR reaction system The PCR reaction procedure is as follows: Pre-denaturation: 95℃ for 4 minutes; Cycle: 95℃ denaturation for 30 seconds, 55℃ annealing for 45 seconds, 72℃ extension for 2 minutes, run 35 cycles; Final extension: 72℃ for 10 minutes; Incubation: The amplification products were incubated at 4℃.

[0038] 3. Result Determination The PCR products were subjected to agarose gel electrophoresis, and the results are as follows: Figure 1 As shown, the numbers are not completely consecutive, and a total of 61 plants were tested. The results showed that a specific band of approximately 2051 bp was amplified in all male *Zemys* plants tested (e.g., samples numbered 12, 13, 20, 21, 23, 24, 26, 27, 33, 34, 35, 39, 41, 42, 43, 45, 46, 47, 48, 50, 51, 52, 54, 55, 59, 61, 62, 63, 64, 65, 66, 68, 69, 70, 78, 79); while this band was not amplified in female plants.

[0039] In summary, the identification method of this invention can quickly detect the sex of any species of *Zemitera* plant without needing to determine sex based on the presence or absence of male and female reproductive organs, thus effectively improving the efficiency of garden research and management.

[0040] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The application of a molecular marker in identifying the sex of plants in the genus *Zemitera*, characterized in that, The molecular marker is linked to the Y chromosome of *Zemi* plants, and the molecular marker comprises a sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO:

1.

2. The application as described in claim 1, characterized in that, The molecular marker has a sequence as shown in SEQ ID NO:

1.

3. The application as described in claim 1, characterized in that, The application includes: detecting the genome of the target plant by PCR, and identifying whether the target plant is male by whether the result is positive.

4. A primer pair for verifying a sequence as shown in SEQ ID NO: 1, characterized in that, The primer pair includes an upstream primer sequence as shown in SEQ ID NO: 2 and a downstream primer sequence as shown in SEQ ID NO: 3, or: a sequence that differs from the sequence shown in SEQ ID NO: 2 by one nucleotide and a sequence that differs from the sequence shown in SEQ ID NO: 3 by one nucleotide.

5. A method for identifying the sex of plants in the genus *Zemitera*, comprising: The genome of the *Zemitera* species to be tested is detected to determine whether it contains the sequence shown in SEQ ID NO:

1. If it contains the sequence shown in SEQ ID NO: 1, it is identified as male; otherwise, it is identified as female.

6. The identification method as described in claim 5, characterized in that, include: The primer pair described in claim 4 was used to perform PCR amplification on the test plant of the genus *Zemitera*, and it was determined whether the obtained PCR amplification product contained the sequence shown in SEQ ID NO:

1.

7. The method for identifying the sex of *Zemitera* plants as described in claim 5, characterized in that, The *Zemitera* plants to be tested include *Zemitera* plants of any age.

8. The method for identifying the sex of *Zemitera* plants as described in claim 5, characterized in that, It also includes the step of extracting plant genomes.

9. The identification method as described in claim 6, characterized in that, The PCR amplification procedure includes: Pre-denaturation: 95℃ for 4 minutes; Cycle: 95℃ denaturation for 30 seconds, 55℃ annealing for 45 seconds, 72℃ extension for 2 minutes, run 35 cycles; Final extension: 72℃ for 10 minutes; Incubation: The amplification products were incubated at 4℃.

10. The identification method according to any one of claims 5-9, characterized in that, The Zemiidae species include: Zemiidae scabra; Zemiidae dwarf; Zemiidae scabra; Zemiidae floridata; Zemiidae floridata; Zemiidae floridata; and Zemiidae lindenensis.