A set of primer and probe combination for visual detection of langya virus RT-RPA, a kit and application thereof
By designing primer and probe combinations for visual detection of Langya virus using RT-RPA, and combining them with closed colloidal gold immunochromatographic test strips, the problems of cumbersome and time-consuming detection processes for Langya virus have been solved, achieving rapid, simple, and highly sensitive detection results, suitable for epidemiological investigations and non-disease diagnosis.
Patent Information
- Application Number
- CN202411925062.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-25
- Publication Date
- 2026-06-26
Smart Images

Figure CN122279099A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of nucleic acid visualization detection technology, specifically relating to a primer and probe combination, kit, and application of Langya virus RT-RPA visualization detection. Background Technology
[0002] LayV, belonging to the Paramyxoviridae family and the Hennipavirus genus, is a single-stranded, negative-sense RNA virus. LayV was first reported in 2022 as a novel form of Hennipa disease, causing symptoms such as fever, headache, vomiting, thrombocytopenia, and liver and kidney dysfunction in patients across multiple regions. Due to its relatively recent discovery, laboratory testing methods for LayV are limited, and a complete, infectious virus has not yet been isolated, thus hindering etiological detection. Most detection methods remain at the level of serological testing (IgG antibody detection) and nucleic acid testing. While virus isolation and culture are the gold standard for virological testing, possessing high specificity, the process is cumbersome and time-consuming. Serological tests such as enzyme-linked immunosorbent assay (ELISA) and neutralization tests are also feasible, but antibody detection has a certain lag, requiring the virus to induce an immune response in the human body before antibodies can be detected. Traditional nucleic acid detection methods, such as RT-PCR and Real-time RT-PCR, still require specialized equipment and personnel.
[0003] In summary, the above methods, due to their high requirements for operating environment and sophisticated equipment, limit their application scope and cannot yet achieve rapid LayV detection at the disease site or in grassroots laboratories. Therefore, there is an urgent need to establish a rapid, simple, and accurate diagnostic method to provide new detection technologies and material foundations for rapid on-site detection of LayV and pathogen monitoring and early warning. Furthermore, the continuous emergence of various emerging and re-emerging infectious disease viruses in recent years has seriously threatened public health security for all humanity. Developing sensitive and efficient detection methods for LayV can also provide an effective tool for detecting LayV and other emerging infectious disease pathogens and fill related prevention gaps. Summary of the Invention
[0004] To address the technical challenges of existing LayV detection methods, such as cumbersome processes, long processing times, inherent time lag, high requirements for operating environments and sophisticated equipment, and the inability to achieve rapid LayV detection at disease outbreak sites or grassroots laboratories, this invention compares the LayV genome published in the GeneBank database, screens multiple highly conserved gene sequence regions, and draws upon literature, national standards, and WHO-recommended laboratory detection targets for Hennipa virus. Ultimately, the conserved region of the LayVN protein gene was identified as the detection target for this invention. A primer and probe combination for visual detection of LayV using RT-RPA was designed, and a corresponding detection method was obtained.
[0005] To solve the above-mentioned technical problems and achieve the corresponding technical effects, the present invention specifically provides the following technical solutions:
[0006] The first objective of this invention is to provide a primer and probe combination for visual detection of Langya virus using RT-RPA, the primer and probe combination comprising an upstream primer with a nucleotide sequence as shown in SEQ ID NO.1, a downstream primer with a nucleotide sequence as shown in SEQ ID NO.2, and a single-stranded DNA probe with a nucleotide sequence as shown in SEQ ID NO.3.
[0007] In one embodiment of the present invention, the 5' end of the upstream primer is modified with biotin; the 5' end of the single-stranded DNA probe is labeled with carboxyfluorescein FITC, and the 30th base from the carboxyfluorescein group is replaced by tetrahydrofuran (THF), and the 3' end is modified with C3-Spacer.
[0008] A second objective of this invention is to provide the application of the aforementioned primer and probe combination in the preparation of reagents or kits for the visual detection of Langya virus RT-RPA.
[0009] A third objective of this invention is to provide the application of the above-described primer and probe combination in epidemiological investigations of Langya virus, or in detecting whether a sample contains Langya virus for non-disease diagnosis and treatment purposes.
[0010] A fourth objective of this invention is to provide a kit for visual detection of Langya virus using RT-RPA, the kit containing the aforementioned primer and probe combination.
[0011] In one embodiment of the present invention, the kit further contains a full-length positive plasmid of the Langya virus N gene with a nucleotide sequence as shown in SEQ ID NO.4.
[0012] In one embodiment of the present invention, the kit further contains RT-RPA nucleic acid amplification reagent.
[0013] Preferably, the RT-RPA nucleic acid amplification reagent includes rehydration buffer, AMV reverse transcriptase, RNase-free ddH2O, recombinase, polymerase, single-stranded binding protein, hydrolysis buffer, and magnesium acetate solution.
[0014] A fifth objective of this invention is to provide the application of the above-described kit in epidemiological investigations of Langya virus, or in detecting whether a sample contains Langya virus for purposes other than disease diagnosis and treatment.
[0015] The sixth object of the present invention is to provide a method for visually detecting Langya virus for non-diagnostic purposes, the method comprising the following steps:
[0016] (1) Using the RNA of the virus to be tested or the full-length positive plasmid of the N gene of Langya virus as a template, perform RT-RPA reaction using the primer and probe combination and RT-RPA nucleic acid amplification reagent described in any one of claims 1 or 2;
[0017] (2) RT-RPA reaction products were detected using a disposable closed nucleic acid visualization detection device;
[0018] (3) Visually inspect the results. If red bands appear at both the control line and the test line, the sample contains Langya virus. If red bands appear at the control line but no bands appear at the test line, the sample does not contain Langya virus. If no red bands appear at the control line, the test results are invalid.
[0019] In one embodiment of the present invention, the RT-RPA nucleic acid amplification reagent in step (1) includes rehydration buffer, AMV reverse transcriptase, RNase-free ddH2O, recombinase, polymerase, single-stranded binding protein, hydrolysis buffer, and magnesium acetate solution. The specific operation method of the RT-RPA reaction is as follows: the viral RNA to be tested is mixed with the above-mentioned primer and probe combination, rehydration buffer, AMV reverse transcriptase, and RNase-free ddH2O, and added to a reaction tube containing lyophilized powder (containing recombinase, polymerase, single-stranded binding protein, and hydrolysis buffer). The mixture is pipetted until completely dissolved, and then magnesium acetate solution is added. After thorough mixing, the mixture is centrifuged to perform the RT-RPA reaction.
[0020] Preferably, the RT-RPA reaction system in step (1) is 50 μL, consisting of 2.1 μL each of 10 μM upstream and downstream primers, 0.6 μL of 10 μM probe, 5 μL of RNA template, 25 μL of rehydration buffer, 0.5 μL of LAMV reverse transcriptase (5 U), and 12.2 μL of RNase-free ddH2O. The mixture is added to a reaction tube containing lyophilized powder (containing recombinase, polymerase, single-chain binding protein, and hydrolysis buffer), mixed well, and then 2.5 μL of 280 mM magnesium acetate solution is added. The temperature of the RT-RAA reaction is 37-42℃, and the time is 20-40 min.
[0021] Preferably, the RT-RAA reaction temperature is 42°C and the reaction time is 30 min.
[0022] In one embodiment of the present invention, the disposable closed nucleic acid visualization detection device is a closed colloidal gold immunochromatographic test strip.
[0023] A seventh objective of this invention is to provide the application of the above-described method in epidemiological investigations of Langya virus, or in detecting whether a sample contains Langya virus for purposes other than disease diagnosis and treatment.
[0024] Those skilled in the art should understand that in the application of detecting Langya virus, there are detection and identification purposes other than disease diagnosis, such as in port quarantine, to detect whether food, plants, cosmetics, feed, etc. are contaminated with Langya virus. In the above application scenarios, the primer and probe combination, reagent kit and visual detection method of Langya virus provided by this invention can be used.
[0025] The beneficial effects of this invention are:
[0026] (1) The detection method established in this invention can detect LayV with high specificity. In the early stages of this invention, the LayV gene sequence was analyzed and compared, and several conserved regions of the LayVN gene were ultimately screened as targets. Considering the high similarity of the Hennepa virus N gene, this invention performed sequence analysis on the screened target sequence group with Hennepa viruses such as NiV and HeV, ultimately determining the nucleotide sequence located at positions 1193-1441 of the LayV base sequence as the final detection target to ensure the specificity of the primer and probe combination. Primer and probe combinations suitable for RT-RPA visualization were designed for the target sequence on the LayV N protein gene. The target sequence is highly conserved in the LayVN gene, and specificity tests verified that the primer and probe combination used in this invention does not cross-react with Hennepa viruses such as NiV and HeV. Furthermore, this invention introduces a closed colloidal gold test strip, avoiding the aerosol contamination problem easily caused by traditional isothermal amplification techniques, and eliminating the dependence on precision equipment, making the operation process simpler.
[0027] (2) The detection method established in this invention has high sensitivity, with a detection limit of 1.22 copies / μL of positive plasmid, and the detection results are stable and reliable. When the method established in this invention is applied to the detection of virus-infected animal tissues and cell samples, the results show that, compared with the Real-time PCR method targeting the viral N gene, the method established in this invention can maintain the same order of magnitude of sensitivity while reducing the time by half.
[0028] (3) The kit of the present invention combines RT-RPA technology with closed colloidal gold immunochromatographic test strips. It does not require precise temperature-changing equipment and can obtain effective amplification of the LayV target gene under constant temperature conditions. The amplification results are interpreted by a fully closed nucleic acid rapid detection device, which not only realizes the visualization of the results, but also avoids false positive results caused by aerosols. The entire amplification and detection process can be completed within 30 minutes, which greatly shortens the detection time of conventional PCR, Real-time PCR and conventional RPA, and realizes rapid and visual detection at the epidemic site. Attached Figure Description
[0029] Figure 1 The image shows the results of detecting different concentrations of LayVN gene RNA using the Langya virus RT-RPA-VF detection method under a reaction condition of 42℃ for 30 min.
[0030] Figure 2 The figure shows the specificity evaluation results of the RT-RPA-VF detection method for Langya virus;
[0031] Figure 3 This image shows the results of testing clinical samples from wild animals using the Langya virus RT-RPA-VF detection method. Detailed Implementation
[0032] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings. The embodiments described in this invention are not all embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and the materials, reagents, and instruments used are all conventional materials, reagents, and instruments in the art, which can be obtained commercially by those skilled in the art unless otherwise specified.
[0033] The TwistAmp nfo Kit (RPA kit) was purchased from TwistDX; the AMV Reverse Transcriptase and Viral RNA / DNA Extraction Kit were purchased from Takara Bio Engineering (Dalian) Co., Ltd.; and the disposable closed nucleic acid visualization detection device (closed colloidal gold immunochromatographic test strip) was purchased from Hangzhou Ustar Biotechnology Co., Ltd.
[0034] Example 1: A primer and probe combination for visual detection of Langya virus using RT-RPA
[0035] This invention used MEGA7 software to compare the LayV genome sequence published in the GeneBank database, screening for several highly conserved gene sequence regions. Combining literature, national standards, and WHO-recommended laboratory detection targets for Hennipa virus, the LayV N protein gene was identified as the detection target gene for this invention. Considering the high similarity of N genes among Hennipa virus genus members, this invention analyzed and compared the screened conserved regions with Hennipa virus (NiV), Hendra virus (HeV), and other Hennipa virus genus viruses, ultimately determining nucleotides 1193-1441 of the LayV base sequence as the final detection target to ensure the specificity of the primer and probe combination. Based on RPA primer design principles, a large number of primer and probe combinations were designed and synthesized in the preliminary work, from which a pair of primers with high sensitivity and good amplification efficiency and their corresponding probe were selected. The nucleotide sequence of the upstream primer NF is shown in SEQ ID NO.1, the nucleotide sequence of the downstream primer NR is shown in SEQ ID NO.2, and the nucleotide sequence of the probe NP is shown in SEQ ID NO.3.
[0036] SEQ ID NO.1: 5'-[Biotin]TATATATTTCAAACTAGGACAAAATGCAGCTA-3';
[0037] SEQ ID NO.2: 5'-GAGAAGTATCTTGAACTAGTAATCTCGTCATC-3';
[0038] SEQ ID NO.3: 5'-[FITC]GAAAGAATGCGGGCTCTATAGATAGGAAAC[THF]AGCAGAAGAGTTAGG[C3-Spacer]-3', meaning the 5' end of the probe is labeled with FITC, and the 30th base from the carboxyl fluorescent group is replaced by THF, and the 3' end is modified with C3-Spacer.
[0039] Note: Biotin; FITC; THF; C3-spacer.
[0040] Example 2: A visualization method for isothermal amplification of nucleic acid by reverse transcription recombinase polymerase for detecting Langya virus.
[0041] (1) Establishment of a visualization detection method for reverse transcription recombinase polymerase isothermal amplification of nucleic acid by Langya virus (RT-RPA-VF)
[0042] Using LayV cDNA as a template, the N gene was amplified in vitro and cloned into the corresponding vector, ultimately constructing a plasmid containing the LayV N gene. This plasmid was used as a template for RT-RPA-VF detection, and TwistAmp from Twist was used. TM The RT-RPA-VF detection method was established using the nfo kit. The reaction system consisted of 50 μL, including 2.1 μL each of 10 μM forward and reverse primers, 0.6 μL of 10 μM probe, 25 μL of rehydration buffer, 5 μL of template, 0.5 μL of LAMV reverse transcriptase (5 U), and 12.2 μL of RNase-free ddH2O. The above 47.5 μL system was mixed and added to a reaction tube containing lyophilized powder (recombinase, polymerase, single-chain binding protein, and hydrolysis buffer). The mixture was pipetted until completely dissolved. 2.5 μL of 280 mM magnesium acetate was added to the reaction tube, mixed thoroughly, and incubated in a 37°C water bath for 30 min. Then, the reaction tube is placed into a fully enclosed rapid nucleic acid detection device for testing. The test results are interpreted by visual observation. If red bands appear at both the control line and the test line, the sample contains Langya virus; if a red band appears at the control line but no band appears at the test line, the sample does not contain Langya virus; if no red band appears at the control line, the test result is invalid.
[0043] The nucleotide sequence of the full-length positive plasmid of the Langya virus N gene used in this invention is shown in SEQ ID NO.4.
[0044] SEQ ID NO.4:
[0045]
[0046] GTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCA
[0047] AGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCT
[0048] ACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAG
[0049] ATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATC
[0050] AATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTG
[0051] AGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCG
[0052] TCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATG
[0053] ATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGC
[0054] CGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTA
[0055] TTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAAC
[0056] GTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCA
[0057] TTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAA
[0058] AAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAG
[0059] TGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCG
[0060] TAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGT
[0061] ATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACA
[0062] TAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCT
[0063] CAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAAC
[0064] TGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAG
[0065] GCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATA
[0066] CTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGA
[0067] TACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCC
[0068] CCGAAAAGTGCCACCTGGGTCGACATTGATTATTGACTAGTTATTAATAGTAATCA
[0069] ATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACG
[0070] GTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAAT
[0071] GACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGG
[0072] AGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGT
[0073] ACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTA
[0074] CATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTAT
[0075] TACCATGGTCGAGGTGAGCCCCACGTTCTGCTTCACTC-3'.
[0076] (2) Optimization of the reaction temperature of Langya virus RT-RPA-VF
[0077] The concentration was 1.22 × 10 10 Positive plasmids of copies / μL were serially diluted 10-fold to a concentration of 1.22 × 10⁻⁶ copies / μL. - 2 The positive plasmids at different concentrations were diluted to form copies / μL and used as standard templates for the RT-RPA-VF detection method. The reaction system described in step (1) was amplified at 37℃, 39℃, 40℃, and 42℃ for 30 min to screen for the optimal amplification temperature. The amplified products were detected using a disposable nucleic acid visualization detection device. The results showed that at 42℃, the concentration of the positive plasmid in the detection template was ≥1.22×10⁻⁶. 0 When the plasmid concentration is ≥10 copies / μL, both the control line and the test line show red bands, indicating a positive LayV result. However, at 37℃, 39℃, and 40℃, the positive plasmid concentration only shows positive results when the plasmid concentration is ≥10 copies / μL. 1 LayV positivity is only observed when the number of copies / μL is low. Therefore, the RT-RPA-VF detection method can be performed at a reaction temperature of 37-42℃, but the optimal reaction temperature is 42℃.
[0078] (3) Optimization of RT-RPA-VF reaction time for Langya virus
[0079] At a concentration of 1.22 × 10⁻⁶ 1 copies / μL, 1.22×10 0 copies / μL, 1.22×10 -1 copies / μL and 1.22×10 -2 Using plasmid standards of copies / μL as reaction templates, the reaction system in step (1) was amplified at the optimal reaction temperature of 42℃ for 20 min, 30 min, and 40 min, respectively. The amplified products were detected by a disposable nucleic acid visualization detection device to optimize the reaction time. Figure 1 It can be seen that when the amplification time is 30 min, a concentration of 1.22 × 10⁻⁶ can be detected. 0 The presence of plasmid standards at a concentration of 1.22 × 10⁻⁶ copies / μL indicates that amplification times exceeding 30 min can detect plasmids with a concentration of 1.22 × 10⁻⁶. 0 Plasmid standards were measured in copies / μL. Therefore, the optimal reaction time for RT-RPA-VF was 30 min.
[0080] (4) Specificity evaluation of the RT-RPA-VF detection method for Langya virus
[0081] The LayV N gene standard plasmid and ddH2O were used as positive and negative controls, respectively. RNA from LayV, NiV, HeV, and Sendai virus (SeV) was used as the test samples to evaluate the specificity of the RT-RPV-VF method established in Example 2 (reaction conditions: 42℃, amplification for 30 min). The results showed that only the detection result for LayV RNA was positive, while the detection results for other paramyxovirus RNAs were all negative (e.g., ...). Figure 2 This indicates that the RT-RPA-VF detection method established in this invention does not have cross-reaction with paramyxoviruses such as NiV, HeV, and SeV, and that the method has high specificity.
[0082] (5) Sensitivity evaluation of the RT-RPA-VF detection method for Langya virus
[0083] Tissue and cell samples were collected from LayV-positive animals (shrews), and RNA was extracted from these samples. The obtained RNA was serially diluted and then detected using the detection method described in Example 2 of this invention (reaction conditions: 42℃, amplification for 30 min). Simultaneously, primers were designed and synthesized for the LayV N gene to establish a Real-time RT-PCR detection method, and the samples were tested using this method. The results showed that for both animal tissue and cell samples, when the CT value of the Real-time RT-PCR result was ≥33.27, the RT-RPV-VF method yielded negative results; when the CT value of the Real-time RT-PCR result was ≤33.52, the RT-RPV-VF method still showed positive results (as shown in Table 1). Therefore, the RT-RPV-VF detection method provided in Example 2 of this invention has comparable sensitivity to the Real-time RT-PCR method.
[0084] Table 1. Comparison of sensitivity between the RT-RPV-VF and Real-time RT-PCR detection methods provided by this invention.
[0085]
[0086] Note: X indicates that the sample was not tested; + (weak) indicates a weak positive result; - indicates a negative result.
[0087] Example 3: Application of the Langya virus RT-RPA-VF detection method in the detection of clinical samples from wild animals
[0088] Total RNA was extracted from three LayV-positive animal (shrew) tissue samples and four healthy animal tissue samples, and detected using the detection method described in Example 2 (reaction conditions: 42℃, amplification for 30 min). Simultaneously, the RNA samples were also detected using Real-time RT-PCR. The results of the RT-RPV-VF detection method provided by this invention were completely consistent with the Real-time RT-PCR results; all three LayV-infected tissue samples tested positive, while all four healthy animal tissue samples tested negative (e.g., ...). Figure 3 This indicates that the RT-RPV-VF detection method provided in Example 2 of this invention is feasible for clinical screening of suspected LayV positive samples and can meet the needs of clinical testing.
[0089] Example 4: Assembly of a visual detection kit for reverse transcription recombinase polymerase isothermal amplification of nucleic acid by Langya virus.
[0090] The primers NF and NR and probe NP from Example 1, the full-length positive plasmid of the Langya virus N gene from Example 2, RT-RPA nucleic acid amplification reagent, a disposable closed nucleic acid visualization detection device, and eight tubes were assembled into a 96T Langya virus reverse transcription recombinase polymerase isothermal amplification nucleic acid visualization detection kit. The RT-RPA nucleic acid amplification reagent contains rehydration buffer, AMV reverse transcriptase, RNase-free ddH2O, recombinase, polymerase, single-stranded binding protein, hydrolysis buffer, and magnesium acetate solution.
[0091] Example 5: Application of the primer and probe combination of Example 1, the method of Example 2, and the kit of Example 4 in the detection of Langya virus.
[0092] Those skilled in the art should understand that in the application of detecting Langya virus, there are also detection and identification purposes other than disease diagnosis, such as in port quarantine, to check whether personnel, food, or imported animals carry Langya virus. Therefore, the Langya virus reverse transcription recombinase polymerase isothermal amplification nucleic acid visualization detection method can be used to apply the primer and probe combination in Example 1 or the kit in Example 4 to Langya virus epidemiological surveys or to detect whether samples contain Langya virus for non-disease diagnosis and treatment purposes.
[0093] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be defined by the claims.
Claims
1. A primer and probe combination for visual detection of Langya virus using RT-RPA, characterized in that, The primer and probe combination includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.1, a downstream primer with a nucleotide sequence as shown in SEQ ID NO.2, and a single-stranded DNA probe with a nucleotide sequence as shown in SEQ ID NO.
3.
2. The primer and probe combination according to claim 1, characterized in that, The upstream primer is modified with biotin at its 5' end; the single-stranded DNA probe is labeled with carboxyfluorescein FITC at its 5' end, and the 30th base from the carboxyfluorescein group is replaced with tetrahydrofuran, and the 3' end is modified with C3-Spacer.
3. The use of the primer and probe combination of any one of claims 1 or 2 in the preparation of reagents or kits for visual detection of Langya virus RT-RPA.
4. The use of the primer and probe combination of any one of claims 1 or 2 in epidemiological investigations of Langya virus, or in detecting whether a sample contains Langya virus for purposes other than disease diagnosis and treatment.
5. A kit for visual detection of Langya virus using RT-RPA, characterized in that, The kit contains the primer and probe combination as described in either claim 1 or 2.
6. The reagent kit according to claim 5, characterized in that, The kit also contains a full-length positive plasmid of the Langya virus N gene, with a nucleotide sequence as shown in SEQ ID NO.
4.
7. The use of the kit according to claim 5 or 6 in epidemiological investigations of Langya virus, or in detecting whether a sample contains Langya virus for purposes other than disease diagnosis and treatment.
8. A method for visually detecting Langya virus for non-diagnostic purposes, characterized in that, Includes the following steps: (1) Using the RNA of the virus to be tested or the full-length positive plasmid of the N gene of Langya virus as a template, perform RT-RPA reaction using the primer and probe combination and RT-RPA nucleic acid amplification reagent described in any one of claims 1 or 2; (2) RT-RPA reaction products were detected using a disposable closed nucleic acid visualization detection device; (3) Visually inspect the results. If red bands appear at both the control line and the test line, the sample contains Langya virus. If red bands appear at the control line but no bands appear at the test line, the sample does not contain Langya virus. If no red bands appear at the control line, the test results are invalid.
9. The method according to claim 8, characterized in that, The RT-RPA reaction is carried out at a temperature of 37-42℃ for 20-40 minutes.
10. The use of the method of claim 8 or 9 in epidemiological investigations of Langya virus, or in detecting whether a sample contains Langya virus for purposes other than disease diagnosis and treatment.