A receptor-binding domain polypeptide and its application in the preparation of fish lymphocystis virus inhibitors
By identifying the 22-29aa binding domain of LCDV-VAP32 to the VDAC2 receptor, the polypeptide ACGSCSAF was developed, which solved the problem of the inability to accurately block viral invasion in the existing technology, and achieved effective inhibition of LCDV and broad-spectrum antiviral effect.
Patent Information
- Application Number
- CN202610693154.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-20
- Publication Date
- 2026-06-30
AI Technical Summary
Current technology has not been able to precisely locate the binding domain between the fish lymphocystis virus (LCDV) adhesion protein VAP32 and the host cell receptor VDAC2, which hinders the development of antiviral invasion inhibitors and the effective blocking of viral infection.
Using systematic truncation mutation, immunoprecipitation, bimolecular fluorescence complementation, and multifluorescence colocalization techniques, the polypeptide sequence (ACGSCSAF) with a minimum core functional domain of 22-29aa for LCDV-VAP32 and VDAC2 receptor was identified. FITC-labeled polypeptide fragments were synthesized for in vitro validation and cellular binding capacity analysis.
This polypeptide fragment can significantly inhibit LCDV infection of cells in a concentration-dependent manner, with a half-maximal effective concentration of 80 μg/mL, showing potential as an anti-LCDV drug. It is almost completely conserved in different LCDV subtypes, providing a target for novel polypeptide drugs and neutralizing antibodies.
Smart Images

Figure CN122302007A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of immune peptides and molecular virology and aquatic animal disease prevention and control technology, specifically relating to a receptor-binding domain peptide and its application in the preparation of fish lymphocystis disease virus (LCDV) inhibitors. Background Technology
[0002] Lymphocystis virus (LCDV), belonging to the genus LCDV of the family Iridoviridae, is the pathogen that causes lymphocystitis in fish. This virus has a wide host range, infecting over 140 species of marine, freshwater, and brackish water fish from more than 42 families worldwide, including many economically important aquaculture species. Since its introduction to my country in the 1990s, the disease has rapidly spread to major aquaculture areas nationwide, seriously jeopardizing the healthy aquaculture of many important economic fish species, such as the rockfish, grouper, turbot, and sea bass. Infected individuals develop typical cauliflower-like cystic lesions on their body surface, eyes, and mouth. In severe cases, internal organs are affected, resulting in loss of commercial value and increased mortality due to secondary bacterial infections, causing continuous economic losses to the fish farming industry. Currently, there is a lack of effective specific treatments. It is noteworthy that some infected fish can recover spontaneously or become latently infected. These outwardly healthy carriers continuously release the virus into the environment, becoming potential sources of infection, and can easily trigger disease outbreaks under high-density farming conditions.
[0003] Extensive research has been conducted by scholars both domestically and internationally regarding the pathogenic characteristics and mechanisms of LCDV. Whole-genome sequencing of the European isolate (LCDV-1) and the Chinese isolate (LCDV-C) has been completed, laying the foundation for functional gene analysis. Sensitive cell models, such as the turbot gill cell line (FG) and the embryonic cell line (HINAE), have been developed based on various detection technologies including PCR, RT-PCR, and immunoarrays. While inactivated and DNA vaccine strategies have been explored in vaccine development, no commercially available vaccine has yet been developed. Through transcriptomics and microarray analysis, preliminary findings have revealed the changes in host gene expression profiles after LCDV infection.
[0004] Viral invasion of host cells begins with the specific binding of viral adhesion proteins to receptors on the host cell surface. This binding, mediating viral adsorption onto susceptible cells, is the primary step in viral infection. The binding ability of adhesion proteins to their receptor-binding domains directly affects viral infection efficiency and pathogenicity, making them important targets for antiviral drug development. The inventors' laboratory previously identified the LCDV receptor protein—voltage-dependent anion channel protein 2 (VDAC2, ABH07379.1)—on the FG cell membrane and a 32 kDa adhesion protein (VAP32, YP_073546.1) on LCDV. They confirmed that VAP32 is encoded by the LCDV-C open reading frame (ORF) 038 gene and demonstrated that VAP32 can specifically bind to the VDAC2 receptor, invading host cells via a peptidon / lipid raft-mediated endocytosis pathway using activators and microtubules. This discovery provides a significant breakthrough for elucidating the LCDV invasion mechanism and developing related antiviral inhibitors, and also points the way for screening antiviral targets.
[0005] Although previous studies have clearly established that the interaction between the LCDV-VAP32 adhesion protein and the VDAC2 receptor mediates viral entry into host cells, the precise location and spatial conformation of the functional domain on this protein that binds to VDAC2 remain unclear. This lack of crucial information not only hinders a deeper understanding of the molecular mechanisms of LCDV infection but also impedes the development of antiviral invasion inhibitors based on strategies that block virus-receptor interactions. If the core peptide in the VAP32 adhesion protein that specifically binds to the VDAC2 receptor can be precisely located and demonstrated to block the interaction between LCDV-VAP32 and the VDAC2 receptor, effectively inhibiting viral infection of host cells, it would not only provide a direct target for designing novel peptide-based anti-LCDV invasion inhibitors but also open new avenues for the development of subunit vaccines and neutralizing antibodies. Summary of the Invention
[0006] The purpose of this invention is to provide a receptor-binding domain polypeptide and its application in the preparation of fish lymphocystis virus inhibitors. The provided receptor-binding domain polypeptide can be used to prepare products that inhibit LCDV infection, thereby overcoming the shortcomings of the prior art.
[0007] This invention first provides a receptor-binding domain polypeptide, wherein the binding domain polypeptide comprises: 1) The amino acid sequence of LCDV-VAP32 is a polypeptide with the amino acid sequence of alanine-cysteine-glycine-serine-cysteine-serine-alanine-phenylalanine (SEQ ID NO: 1), and its English abbreviation is Ala-Cys-Gly-Ser-Cys-Ser-Ala-Phe (ACGSCSAF). 2) A polypeptide that has one or more amino groups substituted, deleted, or added to the amino acid sequence of the polypeptide in 1), and has the ability to bind to the VDAC2 receptor.
[0008] Another aspect of the present invention also provides an use of the aforementioned receptor-binding domain polypeptide in the preparation of articles that inhibit LCDV infection in fish; The aforementioned inhibition of infection is achieved by competitively binding the peptide to the VDAC2 receptor to inhibit LCDV infection in fish, as described in 1).
[0009] The present invention also provides an article for inhibiting LCDV infection in fish, comprising a pharmacologically effective concentration of the above-mentioned receptor-binding domain polypeptide.
[0010] This invention also provides the application of the aforementioned peptide in the labeling and localization of the LCDV-VAP32 interacting receptor VDAC2; The present invention also provides a method for localizing and labeling the LCDV-VAP32 interaction receptor VDAC2, which involves immunofluorescence labeling of the above-mentioned polypeptide and then incubating it with gill cells of turbot.
[0011] The beneficial effects of this invention are: 1. This invention is the first to accurately identify the smallest core functional domain (SEQ ID NO: 1) on the LCDV-VAP32 adhesion protein that binds to the VDAC2 receptor. The sequence is clear, filling a gap in the field.
[0012] 2. A variety of techniques, including systematic truncation mutation, immunoprecipitation, bimolecular fluorescence complementarity, multi-fluorescence co-localization, and artificial intelligence structural modeling, were used for cross-validation. The screening and validation methods were rigorous, and the results were highly reliable.
[0013] 3. In vitro experiments have demonstrated that the artificially synthesized binding domain peptide can significantly inhibit LCDV infection of FG cells in a concentration-dependent manner. The half-maximal effective concentration is low, and the maximum inhibitory effect can be achieved at 80 μg / mL, which clearly reveals its potential as a lead peptide anti-LCDV drug.
[0014] 4. Evolutionary conservation analysis showed that the binding domain sequence was almost completely conserved in different LCDV subtypes (LCDV-1, LCDV-2 / C, LCDV-Sa, LCDV-4), suggesting that it could be a potential target for the development of broad-spectrum anti-LCDV peptide drugs.
[0015] 5. The polypeptide sequence provided by this invention is short and easy to synthesize, providing a direct core sequence and theoretical basis for the development of novel anti-LCDV polypeptide drugs, neutralizing antibodies or subunit vaccines targeting them, and has important value for the green prevention and control of fish lymphocytic cysts. Attached Figure Description
[0016] Figure 1 Image showing the results of the first screening of the LCDV VAP32-VDAC2 receptor binding domain.
[0017] Figure A shows the detection results of the binding of the LCDV VAP32 protein L1-1 truncated variant (1-122aa) to the receptor protein VDAC2; Figure B shows the detection results of the binding of the LCDV VAP32 protein L1-2 truncated variant (61-178aa) to the receptor protein VDAC2; Figure C shows the detection results of the binding of the LCDV VAP32 protein L1-3 truncated variant (123-240aa) to the receptor protein VDAC2; Figure D shows the detection results of the binding of the LCDV VAP32 protein L1-4 truncated variant (180-310aa) to the receptor protein VDAC2; Figure E shows the series of truncated variants of LCDV VAP32 protein: L1-1 (VAP32 1-122aa), L1-2 (VAP32 61-178aa), L1-3 (VAP32 123-240aa), L1-4 ...1-122aa), L1-3 (VAP32 1-122aa), L1-4 (VAP32 1-122aa), L1-2 (VAP32 1-122aa), L1-3 (VAP32 1-122aa), L1-4 (VAP32 1-122aa), L1-2 (VAP32 1- Schematic diagram of 180-310aa); 3HA-VDAC2 in the figure is pcDNA3.1-3HA plasmid with VDAC2 receptor; 3Flag-L1-1 is pcDNA3.4-3Flag plasmid with L1-1 truncated form; HA and Flag are the names of tag proteins, and aa is amino acid.
[0018] Figure 2 Figure: Results of the second screening of the LCDV VAP32-VDAC2 receptor binding domain.
[0019] In the figure: A shows the detection results of the binding of the LCDV VAP32 protein V-L2-1 truncated variant (62-310aa) to the receptor protein VDAC2; B shows the detection results of the binding of the LCDV VAP32 protein V-L2-2 truncated variant (38-310aa) to the receptor protein VDAC2; C shows the detection results of the binding of the LCDV VAP32 protein V-L2-3 truncated variant (22-310aa) to the receptor protein VDAC2; D shows the detection results of the binding of the LCDV VAP32 protein V-L2-4 truncated variant (6-310aa) to the receptor protein VDAC2; E shows the series of truncated variants of LCDV VAP32 protein V-L2-1 (VAP32 62-310aa), V-L2-2 (VAP32 38-310aa), V-L2-3 (VAP32 62-310aa), V-L2-2 (VAP32 38-310aa), V-L2-3 (VAP32 62-310aa), V-L2-2 (VAP32 62 ... Schematic diagram of the composition of 22-310aa and V-L2-4 (VAP32 6-310aa).
[0020] Figure 3 Figure: Results of the third screening of the LCDV VAP32-VDAC2 receptor binding domain.
[0021] In the figures: A shows the detection results of the binding of LCDV VAP32 protein 22-23 deletion truncated variant (V-L3-1) to receptor protein VDAC2; B shows the detection results of the binding of LCDV VAP32 protein 24-25 deletion truncated variant (V-L3-2) to receptor protein VDAC2; C shows the detection results of the binding of LCDV VAP32 protein 26-27 deletion truncated variant (V-L3-3) to receptor protein VDAC2; D shows the detection results of the binding of LCDV VAP32 protein 28-29 deletion truncated variant (V-L3-4) to receptor protein VDAC2; E shows the detection results of the binding of LCDV VAP32 protein 30-31 deletion truncated variant (V-L3-5) to receptor protein VDAC2; F shows the detection results of the binding of LCDV VAP32 protein 32-33 deletion truncated variant (V-L3-6) to receptor protein VDAC2; G shows the detection results of LCDV VAP32 protein 32-33 deletion truncated variant (V-L3-6) to receptor protein VDAC2; G shows the detection results of the binding of LCDV VAP32 protein 22-23 deletion truncated variant (V-L3-6) to receptor protein VDAC2; A schematic diagram of the composition of a series of amino acid deletion truncated variants of VAP32 protein: V-L3-1 (V-L2-3 Δ22-23aa), V-L3-2 (V-L2-3 Δ24-25aa), V-L3-3 (V-L2-3 Δ26-27aa), V-L3-4 (V-L2-3 Δ28-29aa), V-L3-5 (V-L2-3 Δ30-31aa), and V-L3-6 (V-L2-3 Δ32-33aa); "Δ" represents the specific position of the deleted amino acid.
[0022] Figure 4 Figure: Validation results of the interaction between the complete VAP32 variant and the 22-29aa deletion mutant and the VDAC2 receptor.
[0023] In the figure: A shows the Co-IP verification results of the interaction between the VAP32 22-29aa deletion mutant and the VDAC2 receptor; B shows the Co-IP verification results of the interaction between the complete VAP32 and the VDAC2 receptor; C shows the BIFC verification results of the interaction between the complete VAP32 and the 22-29aa deletion mutant and the VDAC2 receptor. In the figure, VC155-VAP32 is the pBiFC-VC155 plasmid containing the VAP32 adhesion protein; VN173-VDAC2 is the pBiFC-VN173 plasmid containing the VDAC2 receptor; VC155 and VN173 are fluorescently active molecular fragments.
[0024] Figure 5 Immunofluorescence image of co-localization of FITC-ACGSCSAF peptide with VDAC receptor.
[0025] In the figure: A is an immunofluorescence image showing the co-localization of the FITC-ACGSCSAF peptide with the VDAC2 receptor; B is a co-localization coefficient graph of the FITC-ACGSCSAF peptide with the VDAC2 receptor; C is a bar chart of the Pearson coefficient and overlap coefficient of the co-localization of the FITC-ACGSCSAF peptide with the VDAC2 receptor. ACGSCSAF in the figure refers to the receptor-binding domain peptide provided in this patent: alanine-cysteine-glycine-serine-cysteine-serine-alanine-phenylalanine, abbreviated as Ala-Cys-Gly-Ser-Cys-Ser-Ala-Phe (ACGSCSAF).
[0026] Figure 6 : Analysis diagram of the three-dimensional structure model of VAP32 protein based on AlphaFold prediction.
[0027] In the figure: A is a three-dimensional structural model of the VAP32 protein; B is the amino acid sequence of the VAP32 protein, where the green area is the β-sheet, the yellow area is the α-helix, and the purple box area is the binding domain in VAP32 that interacts with the receptor protein VDAC2; C is a schematic diagram of the relative positions of the ACGSCSAF peptide in the VAP32 protein and the ball-and-stick model, cartoon model, and stick model.
[0028] Figure 7 : Analysis diagram of VAP32-VDAC2 interaction model based on AlphaFold prediction.
[0029] In the figure: A shows the overall surface model and cartoon model of the VAP32-VDAC2 interaction; B shows the intermolecular interaction model between VAP32 and VDAC2; C shows the key amino acid labeling diagram of the VAP32-VDAC2 interaction; D shows the hydrogen bond connection model between cysteine at position 23 of VAP32 and glutamic acid at position 189 of VDAC2; E shows the hydrogen bond connection model between alanine at position 28 of VAP32 and lysine at position 236 of VDAC2; F shows the hydrogen bond connection model between glycine at position 49 of VAP32 and lysine at position 15 of VDAC2.
[0030] Figure 8 Statistical graph of the inhibitory effect of different concentrations of ACGSCSAF peptide on LCDV-infected FG cells (qPCR).
[0031] Figure 9 Statistical graph of the inhibitory effect of different concentrations of ACGSCSAF peptide on LCDV-VAP32 protein expression (Western Blot).
[0032] In the figure: A is a Western blotting diagram showing the inhibitory effect of different concentrations of ACGSCSAF peptide on LCDV-VAP32 protein expression; B is a semi-quantitative analysis diagram of the Western blotting diagram in A.
[0033] Figure 10 Evolutionary conservation analysis diagram of the combined domain ACGSCSAF in different LCDV subtypes.
[0034] In the figure: A is a comparative analysis of the amino acid sequences of the ACGSCSAF peptide in different LCDV subtypes; B is a logo diagram of the conserved amino acid analysis of the ACGSCSAF peptide in different LCDV subtypes; C is a diagram of the conservation of each amino acid in the ACGSCSAF peptide in different LCDV subtypes. Detailed Implementation
[0035] This invention targets the key mechanism by which LCDV invades host cells, identifies the precise binding domain of its VAP32 adhesion protein that interacts with the host cell receptor VDAC2, and verifies its potential as an antiviral neutralizing target.
[0036] The objective of this invention is achieved through the following technical solution: 1. Identification of key binding domains for the interaction between LCDV-VAP32 and receptor VDAC2 To identify the precise binding domain of the interaction between amino acids 1-310 (1-310aa) of the VAP32 protein and the receptor VDAC2, this invention employs a series of truncation and deletion mutation strategies, combined with co-immunoprecipitation (Co-IP) and bimolecular fluorescence complementation (BiFC) assays for screening and validation.
[0037] First, through preliminary truncation experiments, the VAP32 protein (1-310 aa) was divided into four segments (1-122 aa, 61-178 aa, 123-240 aa, and 180-310 aa). A eukaryotic expression plasmid with a Flag tag was constructed and co-transfected into HEK293T cells with a VDAC2 eukaryotic expression plasmid with an HA tag. Co-IP experiments using Flag magnetic beads showed that VDAC2 interacts with the 1-122 aa fragment.
[0038] Based on this, further fine-tuning was performed, and a series of truncated variants of VAP32 with C-terminal deletion (62-310aa, 38-310aa, 22-310aa, 6-310aa) were constructed. Immunoprecipitation experiments confirmed that the interaction region was located between 22-38aa. To further refine the localization, a series of mutant plasmids with deletions of every two amino acids starting from amino acid 22 were constructed. Co-IP results showed that when 22-29aa (amino acid sequence ACGSCSAF) was deleted, the interaction between the VDAC2 receptor and the VAP32 adhesion protein completely disappeared. To further verify this, Flag tag plasmids for VAP32 wild-type (WT) and 22-29aa deletion variants (Δ22-29) were constructed and subjected to immunoprecipitation and bimolecular fluorescence complementation experiments with HA-VDAC2. The results showed that VDAC2 only interacted with / produced fluorescence signals with the WT protein, while showing no interaction / no fluorescence signal with the Δ22-29 deletion variant, thus confirming the interaction. 22 ACGSCSAF 29 It is a key core domain for the binding of VAP32 adhesion protein to the VDAC2 receptor.
[0039] 2. In vitro binding verification and localization analysis of the ACGSCSAF domain To verify the direct binding ability of the screened receptor-binding domain peptide to the VDAC2 receptor at the cellular level, a fluorescein isothiocyanate (FITC)-labeled peptide, FITC-ACGSCSAF, was chemically synthesized. The labeled peptide was pre-incubated with turbot FG cells, followed by immunofluorescence staining using an anti-VDAC2 specific antibody. Confocal microscopy revealed a high degree of colocalization between the fluorescence signal of FITC-ACGSCSAF and the VDAC2 antibody signal, directly demonstrating that the synthesized peptide could specifically bind to the receptor.
[0040] 3. Analysis of the structural characteristics and interaction patterns of the domain ACGSCSAF To understand the functional and structural basis of the receptor-binding domain, a three-dimensional structural model of the VAP32 protein was constructed using the AlphaFold artificial intelligence system. The model shows that the protein consists of 5 folds, 17 helices, and a disordered region. Crucially, 22 ACGSCSAF 29 The peptide is located in a randomly coiled region, exposed at the tip of a protrusion in the protein structure. These structural features indicate that the binding domain is located in a spatial position that is easily accessible to the VDAC2 receptor.
[0041] A VAP32-VDAC2 complex model was further constructed using AlphaFold-Multimer. The model showed that the VAP32 protein, containing peptides 22-29, extends into the VDAC2 pore. Interfacial analysis revealed that all residues in peptides 22-29, except for serine at position 27, participate in the interaction. Key hydrogen bonds are formed between cysteine (Cys) 23 and glutamate (Glu) 189 of VDAC2, and between alanine (Ala) 28 and lysine (Lys) 236 of VDAC2. These model results are highly consistent with the aforementioned biochemical experimental results, elucidating the interaction mechanism at the structural level.
[0042] 4. Evaluation of the antiviral potential and neutralizing effect of the peptide ACGSCSAF Different concentrations (0, 5, 10, 20, 40, 80, 160 μg / mL) of the synthetic peptide ACGSCSAF were pre-incubated with turbot FG cells for 1 h, and then inoculated with LCDV. After a certain period of infection, the copy number of the LCDV genome in the cells was detected by real-time quantitative PCR, and the expression level of LCDV VAP32 protein was detected by Western blotting.
[0043] The results showed that pretreatment with the synthetic peptides significantly reduced LCDV copy number and VAP32 protein expression levels in a concentration-dependent manner. Specifically, the ACGSCSAF peptide achieved maximum inhibition of viral copy number at 80 μg / mL, while its inhibitory effect on viral protein continued to increase within the tested concentration range. This indicates that peptides that mimic or competitively bind to this key domain can effectively block LCDV invasion via the VDAC2 receptor-mediated pathway, demonstrating potential as candidate peptide drugs against LCDV.
[0044] 5. Evolutionary conservation analysis of the combined domain ACGSCSAF in different LCDV subtypes Evolutionary conservation analysis of VAP32 homologous protein sequences of different LCDV subtypes (LCDV-1, LCDV-2 / C, LCDV-Sa, LCDV-4) was performed using MEGA.X, Jalview software, and iTOL and WebLogo 3 online servers. The results showed that the binding domain ACGSCSAF was almost completely conserved in different LCDV subtypes.
[0045] The present invention will now be described in detail with reference to the embodiments and accompanying drawings.
[0046] Example 1: Identification of key binding domains for the interaction between LCDV-VAP32 and receptor VDAC2 1. Construction of LCDV-VAP32 mutant and VDAC2 receptor eukaryotic plasmid Based on the ORF038 sequence of LCDV-C (GenBank accession number YP_073546.1) and the VDAC2 receptor sequence (GenBank accession number DQ821474.2), specific primers carrying homologous arms were designed using Primer 6.0 and SnapGene 4.3.7 software (Table 1), and synthesized by a biotechnology company. L1-1 (VAP32 1-122aa), L1-2 (VAP32 61-178aa), L1-3 (VAP32 123-240aa), L1-4 (VAP32 180-310aa), V-L2-1 (VAP3262-310aa), V-L2-2 (VAP32 38-310aa), V-L2-3 (VAP32 22-310aa), V-L2-4 (VAP32 6-310aa), V-L3-1 (V-L2-3 Δ22-23aa), V-L3-2 (V-L2-3 Δ24-25aa), V-L3-3 (V-L2-3 Δ26-27aa), V-L3-4 (V-L2-3 The full-length gene fragments of V-L2 (Δ28-29aa), V-L3-5 (V-L2-3 Δ30-31aa), V-L3-6 (V-L2-3 Δ32-33aa), LCDV VAP32 (Δ22-29aa), and LCDV-VAP32 were amplified. The amplified products were then purified by agarose gel electrophoresis and gel extraction, and cloned into the corresponding pcDNA3.4-3Flag-C and pBiFCVN155 vectors using a homologous recombination kit. The full-length gene fragment of the VDAC2 receptor was amplified as described above and cloned into the corresponding pcDNA3.1-3HA-N and pBiFCVC173 vectors. These recombinant plasmids were transformed into *E. coli* DH5α and plated onto LB agar plates containing ampicillin or kanamycin, and incubated overnight at 37 °C. The following day, several colonies were selected and sent to Qingke Biotechnology Co., Ltd. for sequencing. All correctly sequenced positive bacteria were inoculated into 200 mL of LB medium containing the corresponding antibiotics and cultured overnight at 37 ℃ in a shaker. The next day, the bacterial cells were collected, and plasmids were extracted using an endotoxin-free plasmid mini-extraction kit. The purity and concentration of the plasmids were determined, and the plasmids were aliquoted and frozen at -80 ℃ for subsequent experiments.
[0047] Table 1: Primer Details Table Primer Sequence 5’-3’ pcDNA3.4-3Flag-L1-1-F <![CDATA[ TAGTCCAGTGTGGTGGAATTC ATGTCTGTCATAGGATTTACTCTAC]]> pcDNA3.4-3Flag-L1-1-R <![CDATA[ TGCTGGATATCTGCAGAATTC ACAATAATTTTCAGCTACAACATC]]> pcDNA3.4-3Flag-L1-2-F <![CDATA[ TAGTCCAGTGTGGTGGAATTCATG ATTTCTAAAAAAGATTGTAATATAG]]> pcDNA3.4-3Flag-L1-2-R <![CDATA[ TGCTGGATATCTGCAGAATTC ATTCACTCTATTAATACATTTACA]]> pcDNA3.4-3Flag-L1-3-F <![CDATA[ TAGTCCAGTGTGGTGGAATTC ATGCAACCGAGTAAAAATAAT]]> pcDNA3.4-3Flag-L1-3-R <![CDATA[ TGCTGGATATCTGCAGAATTC CGATACATCTTTAATAGACACATC]]> pcDNA3.4-3Flag-L1-4-F <![CDATA[ TAGTCCAGTGTGGTGGAATTC ATGCCCCTTTATCAAAAAATAAA]]> pcDNA3.4-3Flag-L1-4-R <![CDATA[ TGCTGGATATCTGCAGAATTC AAAAGTCAAATAAAATATTAAATC]]> pcDNA3.4-3Flag-V-L2-1-F <![CDATA[ TAGTCCAGTGTGGTGGAATTC ATGTCTAAAAAAGATTGTAATATAGGGA]]> pcDNA3.4-3Flag-V-L2-2-F <![CDATA[ TAGTCCAGTGTGGTGGAATTC ATGAATGAATCTTTAGTAAGTTATGCTT]]> pcDNA3.4-3Flag-V-L2-3-F <![CDATA[ TAGTCCAGTGTGGTGGAATTC ATGGCTTGTGGATCTTGTTCAGCATTTA]]> pcDNA3.4-3Flag-V-L2-4-F <![CDATA[ TAGTCCAGTGTGGTGGAATTC ATGTTTACTCTACAAAAAGATAAATCAG]]> pcDNA3.4-3Flag-V-L2-1 / 2 / 3 / 4-R <![CDATA[ TGCTGGATATCTGCAGAATTC AAAAGTCAAATAAAATATTAAATC]]> pcDNA3.4-3Flag-V-L3-1-F <![CDATA[ TAGTCCAGTGTGGTGGAATTC ATGGGATCTTGTTCAGCATTTAC]]> pcDNA3.4-3Flag-V-L3-2-F <![CDATA[ TAGTCCAGTGTGGTGGAATTC ATGGCTTGTTGTTCAGCATTTACTTCTCG]]> pcDNA3.4-3Flag-V-L3-3-F <![CDATA[ TAGTCCAGTGTGGTGGAATTC ATGGCTTGTGGATCTGCATTTACTTCTCGGCAAA]]> pcDNA3.4-3Flag-V-L3-4-F <![CDATA[ TAGTCCAGTGTGGTGGAATTC ATGCTTGTGGATCTTGTTCAACTTCTCGGCAAACATGTG]]> pcDNA3.4-3Flag-V-L3-5-F <![CDATA[ TAGTCCAGTGTGGTGGAATTC ATGGCTTGTGGATCTTGTTCAGCATTTCGGCAAACATGTGCTGATA]]> pcDNA3.4-3Flag-V-L3-6-F <![CDATA[ TAGTCCAGTGTGGTGGAATTC ATGGCTTGTGGATCTTGTTCAGCATTTACTTCTACATGTGCTGATAATCTT]]> pcDNA3.4-3Flag-V-L3-1 / 2 / 3 / 4 / 5 / 6-R <![CDATA[ TGCTGGATATCTGCAGAATTC CGATACATCTTTAATAGACACATC]]> pcDNA3.4-3Flag-VAP32Δ22-29-F <![CDATA[ TAGTCCAGTGTGGTGGAATTC ATGTCTGTCATAGGATTTACTCTACAAAAAGATAAATCAGGTATAAAAATAGTTGGTCCATGTACTTCTCGGCAAACATGTG]]> pcDNA3.4-3Flag-VAP32Δ22-29-R <![CDATA[ TGCTGGATATCTGCAGAATTC AAAAGTCAAATAAAATATTAAATC]]> pcDNA3.4-3Flag-VAP32-F <![CDATA[ TAGTCCAGTGTGGTGGAATTC ATGTCTGTCATAGGATTTACTCTAC]]> pcDNA3.4-3Flag-VAP32-R <![CDATA[ TGCTGGATATCTGCAGAATTC AAAAGTCAAATAAAATATTAAATC]]> pBiFC-VC155-VAP32Δ22-29-F <![CDATA[ CCGAGATCTCTCGAGGTACC ATGTCTGTCATAGGATTTACTCTACAAAAAGATAAATCAGGTATAAAAATAGTTGGTCCATGTACTTCTCGGCAAACATGTG]]> pBiFC-VC155-VAP32Δ22-29-R <![CDATA[ TTGCACGCCGGACGGGTACC AAAAGTCAAATAAAATATTAAATC]]> pBiFC-VC155-VAP32-F <![CDATA[ CCGAGATCTCTCGAGGTACC ATGTCTGTCATAGGATTTACTCTAC]]> pBiFC-VC155-VAP32-R <![CDATA[ TTGCACGCCGGACGGGTACC AAAAGTCAAATAAAATATTAAATC]]> pcDNA3.1-3HA-VDAC2-F <![CDATA[ GGATCCACTAGTCCAGTGTGGTGGAATTCT ATGGCCGTGCCTCCCACA]]> pcDNA3.1-3HA-VDAC2-R <![CDATA[ GCCACTGTGCTGGATATCTGCAGAATTCCA TTAGGCTTCCAGTTCCAAGCCC]]> pBiFC-VN173-VDAC2-F <![CDATA[ AAGACGATGACGACAAGCTT ATGGCCGTGCCTCCCACA]]> pBiFC-VN173-VDAC2-R <![CDATA[ GAATTCGCGGCCGCAAGCTT GGCTTCCAGTTCCAAGCCC]]> Note: Homologous arms in primers are used underline Mark it.
[0048] 2. Identification and verification of the immunoprecipitation of LCDV-VAP32 with the receptor VDAC2 binding domain ① HEK293T cells were seeded in 6 cm culture dishes. When the cell confluence reached approximately 60%, the following cell types were co-transfected: pcDNA3.4-3Flag-L1-1 / 2 / 3 / 4 + pcDNA3.1-3HA-VDAC2, pcDNA3.4-3Flag-L1-1 / 2 / 3 / 4 + pcDNA3.1-3HA-C, pcDNA3.4-3Flag-C + pcDNA3.1-3HA-VDAC2, pcDNA3.4-3Flag-V-L2-1 / 2 / 3 / 4 + pcDNA3.1-3HA-VDAC2, pcDNA3.4-3Flag-V-L2-1 / 2 / 3 / 4 + pcDNA3.1-3HA-C, and pcDNA3.4-3Flag-V-L3-1 / 2 / 3 / 4 / 5 / 6 + pcDNA3.1-3HA-VDAC2. The plasmid combinations used were: pcDNA3.4-3Flag-V-L3-1 / 2 / 3 / 4 / 5 / 6 + pcDNA3.1-3HA-C, pcDNA3.4-3Flag-VAP32Δ22-29 + pcDNA3.1-3HA-VDAC2, pcDNA3.4-3Flag-VAP32Δ22-29 + pcDNA3.1-3HA-C, pcDNA3.4-3Flag-VAP32 + pcDNA3.1-3HA-VDAC2, and pcDNA3.4-3Flag-VAP32 + pcDNA3.1-3HA-C. Each plasmid was used in an amount of 2500 ng.
[0049] ② 24 h after transfection, remove the culture medium, wash the cells twice with pre-cooled phosphate-buffered saline (PBS), scrape the cells off with a cell scraper, collect them into a pre-cooled 1.5 mL EP tube, and collect the cell pellet by low-speed centrifugation.
[0050] ③ Add 400 μL of NP-40 lysis buffer containing 1 mM benzyl sulfonyl fluoride, repeatedly blow and then place on a rotary apparatus at 4°C for lysis for 30 min.
[0051] ④ 14000 × g Centrifuge for 20 min to collect the supernatant, add 40 μL of 2×SDS loading buffer (final concentration 1×) and denature at 100 °C for 10 min as the input sample. Add 10 μL of pretreated Anti-Flag magnetic beads to the remaining supernatant and incubate at 4 °C for 2 h on a rotary instrument.
[0052] ⑤ After washing the magnetic beads 6 times with pre-cooled NP-40 lysis buffer, add 80 μL of 1×SDS loading buffer and denature at 100 °C for 10 min to obtain the IP sample.
[0053] ⑥ Western blot was performed on the Input and IP samples using Flag rabbit monoclonal antibody and HA rabbit monoclonal antibody as the primary antibodies.
[0054] Results: An interaction exists between receptor VDAC2 and LCDV-VAP32 at doses 1-122aa. Figure 1 Further screening of binding domains based on these results revealed interactions between VDAC2 and VAP32 at 6-310aa and 22-310aa, but no interactions with 38-310aa and 62-310aa, indicating that the binding domain is located between 22-38aa. Figure 2 Further precise screening of the binding domain revealed that VDAC2 and VAP32 share 22-29aa ( 22 ACGSCSAF 29 There are interactions between them. Figure 3 To verify the accuracy of the screening results, Flag tag plasmids for the VAP32 WT type and the 22-29aa deletion type were constructed, and immunoprecipitation experiments were performed with the VDAC2 eukaryotic plasmid with the HA tag. The results showed that VDAC2 interacted with the WT type, but not with the deletion type, verifying that the interaction binding domain of VAP32 and VDAC2 is... 22 ACGSCSAF 29 ( Figure 4 ).
[0055] 3. Verification of bimolecular fluorescence complementarity between LCDV-VAP32 and the receptor VDAC2 binding domain ① HEK293T cells were seeded into 24-well cell culture plates with sterile coverslips. When the cell confluence reached about 40%, the cells were co-transfected with the following plasmid combinations: pBiFC-VC155-VAP32Δ22-29 + pBiFC-VN173-VDAC2, pBiFC-VC155-VAP32 + pBiFC-VN173-VDAC2, and pBiFC-VC155-VAP32 + pBiFC-VN173-C. The amount of each plasmid used was 2500 ng.
[0056] ② 24 h after transfection, remove the culture medium, wash 3 times with PBS, add 4% paraformaldehyde to fix at room temperature for 15 min, and wash 3 times with PBS.
[0057] ③ Add the fluorescent dye Hoechst 33342 and incubate at room temperature for 15 min, then wash three times with PBS.
[0058] ④ The sterile coverslip is sealed onto the slide with an anti-fluorescence quenching attenuator and observed and photographed under a laser confocal microscope.
[0059] Results: To verify the screening results, VAP32 WT type and 22-29aa deletion type VC155 eukaryotic plasmids were constructed respectively. Bimolecular fluorescence complementation experiments were performed with the VDAC2 VN173 eukaryotic plasmid. Positive yellow fluorescence was observed between VDAC2 and the WT type, but no positive fluorescence was observed between VDAC2 and the deletion type. These results further verified that the interaction binding domain between VAP32 and VDAC2 is... 22 ACGSCSAF 29 ( Figure 4 ).
[0060] Example 2: In vitro binding verification and localization analysis of the ACGSCSAF domain ① The synthesized ACGSCSAF peptide (1 mg / mL) was mixed with an equal concentration of FITC solution and placed on a rotary mixer and incubated overnight at 4 ℃ in the dark.
[0061] ② Inject the mixture into a HisTrap HP chromatography column and equilibrate with binding buffer to remove free FITC.
[0062] ③ After eluting FITC-ACGSCSAF with Elution buffer, dialyze in PBS at 4 °C for 24 h, changing the dialysate every 4-6 h. Finally, adjust the FITC-ACGSCSAF concentration to 1 mg / mL with PBS containing 1% BSA.
[0063] ④ FG cells were seeded in 24-well cell culture plates containing sterile coverslips. When the cell confluence reached 40-60%, the cells were washed three times with PBS.
[0064] ⑤ Add 200 μL of FITC-ACGSCSAF, incubate at 4 ℃ in the dark for 1 h, then wash 3 times with PBS. Add 4% paraformaldehyde, fix at room temperature for 15 min, remove the paraformaldehyde, and wash 3 times with PBS.
[0065] ⑥ Add immunostaining blocking solution containing 0.3% Triton X-100, and incubate at room temperature for 1 h. Discard the blocking solution, add VDAC2 rabbit polyclonal antibody (1:500 dilution), and incubate at room temperature for 1 h.
[0066] ⑦ Remove excess antibody, wash 3 times with PBS, add Alexa Fluor 649-labeled goat anti-rabbit IgG diluted 1:1000, and incubate at room temperature for 1 h.
[0067] ⑧ Discard excess antibody, soak in PBS 3 times, add Hoechst 33342 (1:1000 dilution), and incubate at room temperature for 15 min.
[0068] ⑨ Discard Hoechst 33342, soak in PBS 3 times, carefully remove sterile coverslips from the well plate and seal them onto a glass slide with an anti-fluorescence quenching attenuator. Observe and photograph with a laser confocal microscope, and analyze the co-localization using ImageJ software.
[0069] Results: Abundant FITC-ACGSCSAF green fluorescence signals were observed on the cell membrane and in the cytoplasm of FG cells, accompanied by widely distributed red VDAC2 signals. The synthesized images showed abundant yellow colocalization signals on the cell membrane and in the cytoplasm. Figure 5 ImageJ software analysis of the synthesized images showed that the scatter plot of colocalization between ACGSCSAF and VDAC2 was diagonal, indicating a high level of colocalization. Furthermore, the Pearson correlation coefficient > 0.5, proving the direct binding of ACGSCSAF and VDAC2. Figure 5 ).
[0070] Example 3: Analysis of the structural characteristics of the combined domain ACGSCSAF and its interaction mode with VDAC2 Based on the LCDV VAP32 sequence (YP_073546.1) and the receptor VDAC2 sequence (ABH07379.1), three-dimensional models of the protein monomer and complex were constructed using the online server AlphaFold (https: / / alphafoldserver.com / ). The structural features of the binding domain and the VAP32-VDAC2 interaction interface were visualized and analyzed using UCSF ChimeraX software.
[0071] Results: For the first time, an LCDV-VAP32 protein model was constructed using the artificial intelligence AlphaFold. This model consists of 5 folds, 17 helices, and a disordered region. The binding domain ACGSCSAF is located in the disordered region and exposed at the apex of the VAP32 protrusion; this structural feature facilitates receptor binding. Figure 6 A VAP32-VDAC2 interaction model was constructed using AlphaFold. The results showed that the apex of VAP32 extends into the interior of VDAC2. Analysis of the interaction interface and statistical analysis of amino acid residues involved in the formation of polar and nonpolar forces revealed that amino acids 22-29aa (ACGSCSAF) participated in the interaction except for position 27. Specifically, cysteine (Cys) 23 and alanine (Ala) 28 of VAP32 formed hydrogen bonds with glutamic acid (Glu) 189 and lysine (Lys) 236 of VDAC2, respectively, which is consistent with the results of previous screening of interaction domains. Figure 7 ).
[0072] Example 4: Evaluation of the antiviral potential and neutralization application of the peptide ACGSCSAF ① FG cells were seeded in 6-well culture plates and cultured. When the cell confluence reached more than 80%, the culture medium was discarded and the cells were washed three times with PBS.
[0073] ② Add the synthetic peptide ACGSCSAF to the MEM maintenance medium to make the final concentrations 5, 10, 20, 40, 80, and 160 μg / mL. Use MEM maintenance medium without synthetic peptide as a blank control. Incubate at 4 ℃ for 1 h and wash three times with PBS.
[0074] ③ Add LCDV with a multiplicity of infection (MOI) of 1, use serum-free MEM medium as a blank control, incubate at 22 ℃ for 1 h, wash 3 times with PBS, and then add freshly prepared MEM maintenance medium.
[0075] ④ 48 h after infection, a portion of cells from each treatment group were washed once with PBS. After being scraped off with a cell scraper, the cells were divided into two aliquots. DNA was extracted from one aliquot using a marine animal tissue genomic DNA extraction kit, and the LCDV copy number was detected by qPCR. The other aliquot was resuspended in 100 μL of NP-40 lysis buffer for the preparation of total cell protein, and the relative expression level of LCDV-VAP32 was detected by Western blot.
[0076] Results: As the peptide concentration increased, the LCDV copy number decreased significantly, with no significant difference between the 80 and 160 μg / mL treatment groups; as the peptide concentration increased, the LCDV-VAP32 protein level remained significantly reduced even in the 160 μg / mL treatment group. These results indicate that the peptide ACGSCSAF can significantly inhibit LCDV infection in a concentration-dependent manner, suggesting its application potential in the prevention and treatment of LCDV.
[0077] Example 5: Evolutionary conservation analysis of the binding domain ACGSCSAF in different LCDV subtypes VAP32 homologous protein sequences of different LCDV isoforms were downloaded from the NCBI database, including LCDV-1 (NP_078745.1), LCDV-2 (BCB67432.1), LCDV-C (YP_073546.1), LCDV-Sa (YP_009342142.1), and LCDV-4 (YP_010087899.1). A phylogenetic tree was constructed from 1000 guided replicates using the neighbor-joining method in MEGA.X software. The tree was then uploaded to the iTOL online server (https: / / itol.embl.de / ) for refinement and enhancement. Multiple sequence alignment of the VAP32 homologous protein amino acid sequences was performed using Jalview software, and the sequence surrounding the binding domain ACGSCSAF was extracted and placed at the end of the corresponding phylogenetic branch. A logo diagram showing the amino acid frequencies of different subtypes of LCDV ACGSCSAF binding domains, generated using the WebLogo 3 online server (http: / / weblogo.threeplusone.com / ).
[0078] The results show that the binding domain 22 ACGSCSAF 29 The LCDV subtypes are nearly completely conserved, with only two random mutations (A22T and A22M) at position 22, with biomass rates of 40% and 20%, respectively. All other positions show 100% concordance. Figure 10 This indicates its potential application as a broad-spectrum anti-LCDV peptide drug.
[0079] Those skilled in the art will understand that modifications, additions, and substitutions to the above embodiments are possible within the scope of protection of this invention, and none of them exceed the scope of protection claimed by this invention.
Claims
1. A receptor binding domain polypeptide, characterized in that, The receptor-binding domain polypeptide comprises: 1) A polypeptide with the amino acid sequence SEQ ID NO: 1; 2) A polypeptide that has one or more amino groups substituted, deleted, or added to the amino acid sequence of the polypeptide in 1), and has the ability to bind to the voltage-dependent anion channel protein 2 receptor.
2. The use of the receptor-binding domain polypeptide of claim 1 in the preparation of fish lymphocystis virus inhibitors.
3. An article for inhibiting infection of fish by an LCDV, comprising, The product contains a pharmacologically effective concentration of the receptor-binding domain polypeptide of claim 1.
4. The application of the receptor-binding domain peptide of claim 1 in the labeling and localization of the interacting receptor VDAC2.
5. A method of identifying a voltage-dependent anion channel protein 2 of Paralichthys olivaceus, characterized by, The method involves immunofluorescence labeling of the receptor-binding domain polypeptide described in claim 1, followed by incubation with gill cells of turbot.
6. A product for localizing and labeling voltage-dependent anion channel protein 2 in turbot, characterized in that, The product contains an immunofluorescently labeled receptor-binding domain polypeptide as described in claim 1.