Insect rdl gene mutant and its application in detection of drug resistance molecules
By detecting the V332I mutation in the insect Rdl gene, the problem of detecting insect resistance to bromutamide has been solved, achieving highly sensitive molecular detection and guiding pesticide use and resistance management.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
- Filing Date
- 2024-12-23
- Publication Date
- 2026-06-23
Smart Images

Figure CN122256363A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology and relates to a gene mutant that causes insects to develop resistance to bromutamide and its application in the detection of insect resistance. Background Technology
[0002] Brombutamide is a novel meta-diamid insecticide with broad-spectrum, high-efficiency, and systemic properties, showing great promise for application in agricultural pest control. This pesticide was registered and marketed in my country on December 28, 2020. It exhibits high activity against a variety of pests, including Isoptera, Hemiptera, Thysanoptera, Diptera, Lepidoptera, and Coleoptera, such as the yellow flea beetle. Phyllotretastriolata Diamondback moth Plutella xylostella Beet armyworm Spodoptera small , cotton bollworm Helicoverpaarmigera Melon moth Diaphania indica Flower thrips Frankliniella intonsa thrips Thripspalms Yellow-breasted thrips Thripshawiensis American thrips Echinothrips americanus , Aphisgossypii Peach aphid Myzus persica This drug does not exhibit cross-resistance with existing insecticides on the market, making it a crucial active ingredient for controlling resistant pests.
[0003] Currently, over 600 pest species have developed resistance to more than 300 pesticide compounds. Western flower thrips has been reported to be among them. Frankliniella occidentalis We found bean-sized thrips in the field, despite their low sensitivity to bromonitrile dibenzodiamide. Megalurothripsusitatus Some populations have developed resistance to brofentanil. This resistance leads to a decrease or ineffectiveness of brofentanil in controlling target pests, posing a new challenge to pest control.
[0004] Clarifying the molecular mechanism by which pests develop resistance to bromutraz can enable the development of molecular detection methods to assess the resistance level of pests to bromutraz, guiding the selection of pesticides and the management of resistance. Compared with traditional bioassay methods, molecular detection has advantages such as high sensitivity, small sample size required, no need for live insect testing, and reduced labor costs.
[0005] This invention has discovered that a mutation in the Rdl gene leads to insect resistance to bromfenac, providing a molecular target for the molecular detection of bromfenac resistance. Summary of the Invention
[0006] The purpose of this invention is to provide an Rdl gene mutant that mediates insect resistance to bromutamide and its application in the detection of insect resistance to bromutamide.
[0007] This invention discovered an insect Rdl (Resistance to Dieldrin) gene mutant, which contains a V332I mutation. This mutation site is similar to that in the Drosophila melanogaster. Drosophila melanogaster The 332nd amino acid position of the wild-type valine (V) encoded by the Rdl gene is homologous to the third transmembrane domain of the γ-aminobutyric acid receptor subunit encoded by the Rdl gene. The base at the above mutation site is mutated from GTT, GTC, or GTA to ATT, ATC, or ATA, and the encoded amino acid is mutated from wild-type valine (V) to isoleucine (I), resulting in the insect changing from a sensitive to bromutrin dibenzonitrate to a resistant state.
[0008] The Rdl gene described above can be obtained from various insects. Those skilled in the art should understand that the Rdl gene described in this invention includes genes homologous to the Drosophila melanogaster Rdl gene. These homologous genes include those with at least 75% sequence similarity to the amino acid sequence encoded by the Drosophila melanogaster Rdl gene, but are not limited to methods for identifying gene similarity through amino acid sequences. The percentage of sequence similarity can be obtained using well-known bioinformatics algorithms, such as the Needleman-Wunsch global alignment (J Mol Biol, 48:443-453, 1970) and the Smith-Waterman local alignment (J Mol Biol, 147:195-197, 1981). This is familiar to those skilled in the art.
[0009] Based on the above findings of the present invention, the present invention provides an application of the Rdl gene mutant as described above in detecting insect resistance to bromoxynil dimethicone, wherein the V332I mutation on the mutant serves as the detection target.
[0010] Furthermore, the method of using the V332I mutation as a target to detect insect resistance to bromutamide includes extracting DNA or RNA and detecting the nucleic acid at the target site.
[0011] Furthermore, those skilled in the art should understand that the detection methods for the V332I mutation target include those based on conventional PCR, quantitative real-time PCR, and KASP (…). Competitive allele specific PCR ), LAMP (Loop-Mediated Isothermal Amplification), RPA (Recombinase Polymerase Amplification), but not limited to the above detection methods.
[0012] Furthermore, the insects tested for resistance to bromutamide include, but are not limited to, flea beetles. Phyllotretastriolata Diamondback moth Plutella xylostellaTomato leafminer Absolutely safe , borer Chilo suppressalis Beet armyworm Spodoptera small Cabbage moth Brassica napus , cotton bollworm Helicoverpaarmigera Melon moth Diaphania indica Fruit flies ( Bactrocera spp, Zeugadacus spp., fruit flies Drosophila spp., mosquitoes Mosquito spp, House spp, Anopheles spp., thrips ( Frankliniella spp, Thrips spp, Echinothrips spp), melon aphid Aphisgossypii Peach aphid Myzus peaches .
[0013] Furthermore, if the nucleic acid encoding the 332nd amino acid of the Rdl gene of the tested insect is GTT, GTC, or GTA, then the tested insect is a homozygous individual sensitive to bromutamide; if it is ATT, ATC, or ATA, then it is a resistant homozygous individual; if both of the above nucleic acids are present, then it is a resistant heterozygous individual.
[0014] This invention marks the first discovery of a mutant of the insect Rdl gene. The V332I mutation in this mutant leads to resistance to bromutamide in insects. This mutation can serve as a biomarker for detecting bromutamide resistance in insects. By detecting whether pests carry this mutation, the resistance status of pests to bromutamide can be diagnosed, providing guidance for the scientific use and resistance management of bromutamide. Furthermore, it can lay the foundation for the development and application of agents targeting the γ-aminobutyric acid receptor encoded by insect Rdl. Attached Figure Description
[0015] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the structures shown in these drawings without creative effort.
[0016] Figure 1 To identify the V332I mutation in the Rdl gene of soybean thrips. Whole-genome scanning analysis of three bromosulfanilamide-resistant populations of soybean thrips revealed significant selection signals in the Rdl gene across all three populations. Further analysis of the mutation sites on this gene revealed the presence of the V332I mutation in the resistant populations.
[0017] Figure 2 This study investigated the correlation between the V332I mutation frequency in the Rdl gene of soybean thrips and its resistance to brofentanil (LC50). The LC50 value was calculated by determining the resistance to brofentanil in each population, and the V332I mutation frequency in each population was obtained through molecular detection. Correlation analysis revealed a significant correlation between the two mutations. Detailed Implementation
[0018] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0019] All technical and scientific terms used in the following embodiments, unless otherwise specified, have the same meaning as commonly understood by one of ordinary skill in the art. Unless otherwise indicated, the techniques used or mentioned in this invention are standard techniques recognized by one of ordinary skill in the art. Unless otherwise specified, the test materials are all commonly used in the field of this invention. Unless otherwise specified, the test reagents used in the following embodiments were all purchased from conventional biochemical reagent stores.
[0020] From January to December 2023, 12 populations of adult bean thrips were collected from different regions across China for bioassay to obtain populations resistant to and susceptible to brofentanil. The test agent was 10% brofentanil suspension produced by BASF Europe.
[0021] The Potter spray tower method (Burkard Manufacturing Co. Ltd.) was used for determination. For the bioassay, based on preliminary experiments, 5-7 concentration gradients of each agent were prepared using purified water in a proportional or arithmetic manner, with corresponding blank controls without the agent. Leaves were cut into 6 cm diameter circles, and approximately 3 mm thick agar was poured into 6 cm diameter plastic boxes. After cooling, the leaves were placed in the agar in the plastic boxes, and the edges of the leaves were sealed with agar. Approximately 30 adult thrips (about the size of a bean) were inhaled into each box, stunned with carbon dioxide, and then precisely sprayed under the Potter spray tower. Each spray volume was 2 ml, the spray pressure was 15 kPa, and the solution settled for 30 seconds after each spray. The treated thrips were reared in an environment of approximately 25°C, 60% relative humidity, and a 16:8 light ratio. Mortality was checked after 48 hours. Thrips were considered alive if they moved normally; if unsure of their condition, the insects were gently touched with a small brush; those that did not move were considered dead. The number of dead insects was counted. Repeat each treatment 3 times.
[0022] The toxicity assay was performed using DPS v12.01 statistical software to calculate the toxicity regression equation, the median lethal concentration (LC50), and its 95% confidence interval, followed by analysis of variance and regression analysis. This is familiar to those skilled in the art.
[0023] Ultimately, three populations resistant to brofentanil were obtained, LC. 50 = 778.7229 ~ 3358.7152 mg / L, 3 susceptible populations were obtained, LC 50 = 0.3232 mg / L.
[0024] Table 1. Median lethal concentration (LC50) of brofenoxam against different populations of bean thrips. 50 )
[0025] Female adult insects with intact bodies, strong activity, and normal vital characteristics were selected from the populations of bromutrin resistant and susceptible to bromutrin bismuth subtilis selected by bioassay. The insects were preserved by soaking them in anhydrous ethanol while they were in good health. 200 individuals from each population were used for whole genome resequencing to identify bromutrin bismuth subtilis resistance mutation sites.
[0026] First, DNA was extracted from all bean thrips specimens from each population.
[0027] Preferably, the required DNA from *Thrips lentigines* is extracted using a magnetic bead method to extract high-molecular-weight DNA, and the extracted DNA is stored at -20°C for later use. Specific extraction steps:
[0028] (1) Sonicate the tweezers and place them in anhydrous ethanol; turn on the ultra-clean workbench and sterilize them by ultraviolet irradiation.
[0029] (2) At room temperature, each sample is prepared as follows: 45 μL PureLink Digestion buffer + 10 μL ProtK (20 mg / mL), add a steel ball with a diameter of 1 mm, and aspirate 110 μL of reagent into the 8-row of the tissue sample.
[0030] (3) Tighten the lid and grind the insect body into fine fragments using a tissue grinder (1200 rpm, 3 min).
[0031] (4) Digest in a metal bath at 58 °C (950 rpm) for 2-3 h without heating the lid, and mix by inverting once every 15 min during the process.
[0032] (5) Immediately separate the sample and cool it to room temperature. Using a pipette, add 2.5 μL of RNase A (DNase-free) to each sample, gently invert and mix, and let it stand at room temperature for 10 min.
[0033] (6) Instantaneous separation: using a wide-mouth pipette tip, add 90 uL of Purelink Lysis buffer to each sample, gently invert and mix, and incubate at 58°C with shaking (950 rpm) for 30 min.
[0034] (7) At room temperature, 4000× g Centrifuge for 15 min to pelletize undigested tissue or solids.
[0035] (8) Take out the new 8-row, and add 35 μL of magnet to each hole.
[0036] (9) Take 37.5 μL of supernatant with a wide-mouth pipette tip and add it to a new 8-cell column containing a magnet. Gently and thoroughly beat the column 5-10 times. Let it stand at room temperature for 15 min and then remove it instantly.
[0037] (10) Place the 8 rows on the magnetic rack for 3 minutes.
[0038] (11) Remove the supernatant and wash twice with 75 uL of 80% ethanol for 2 min each time.
[0039] (12) Remove all the ethanol and leave it at room temperature for 1 min, but do not let it dry completely.
[0040] (13) Remove the 8-pack from the magnetic rack and add 25 uL of 10 mM Tris to each well at pH = 8 to elute the DNA. Cover the wells but do not mix.
[0041] (14) Let stand at 45 ℃ for 15 min, then gently invert 5-10 times to reset the magnetic ball.
[0042] (15) Place at room temperature for 20 min, place the 8-row on a magnetic rack for 2 min, and use a wide-mouth pipette tip to remove the supernatant to a new 8-row.
[0043] Secondly, the extracted DNA was used to construct and sequence a sequencing library.
[0044] Preferably, the Illumina platform is used for sequencing.
[0045] (1) The DNA was randomly fragmented and sorted according to fragment length. A sequencing library was constructed using the VAHTS Universal DNALibrary Prep Kit for Illumina V4 with an insert fragment length of 350 bp. The procedure can be found in the kit instructions. This is familiar to those skilled in the art.
[0046] (2) Paired-end sequencing was performed on the Illumina X plus platform with a read length of 150 bp, a sequencing data volume of 10 Gb per individual, and a sequencing depth of 20X. The above-described procedure and method for paired-end sequencing on the Illumina X plus platform are familiar to those skilled in the art.
[0047] (3) Use bcl2fastq v2.0 software to convert the output basecall files into FASTQ files corresponding to each library on each lane in FlowCell, thereby obtaining raw sequencing data that has not undergone quality control.
[0048] (4) FastP v0.23.4 (CHEN, 2023) was used with default parameters to perform quality checks and filtering on the raw resequencing data to avoid data contamination caused by base mismatches and adapters added during library construction. The following data will be filtered: 1) adapter sequences; 2) more than 5 unknown sequences N in the Reads; 3) the total number of sites with a quality value less than 15 in the Reads exceeds 40% of the Read length.
[0049] Third, obtain whole-genome variation data.
[0050] Preferably, genome-wide variations were obtained using Genome Analysis Toolkit (GATK) v4.3.0.0 software. The Great Sequence Dictionary command in GATK v4.3.0.0, the "index" command in Burrows-WheelerAligner (BWA) software, and the faidx command in SAMtools v1.9 software were used to create an index for the soybean thrips reference genome. The published soybean thrips genome (Ma et al., Scientific Reports, 2023, 10, 252) was used as the reference genome. The BWAmem command was used to align clean reads to the reference genome, resulting in a SAM file. The "view" command in SAMtools was used to convert the SAM file to a BAM file, and the "sort" command was used for sorting. GATK software was used to perform statistical analysis on the alignment rate, coverage, and sequencing depth of the deduplicated data. To improve analysis efficiency, the chromosome segment VCF files were analyzed separately. The SelectVariants command was used to select insertion / deletion (INDEL) and SNP sites. Hard filtering using GATK is a crucial step in ensuring the quality of the variant data. For INDEL filtering, the parameters were set as follows: "QD<2.0||FS>200.0||SOR>10.0||MQRankSum<-12.5||ReadPosRankSum<20.0". When processing SNPs (single nucleotide polymorphisms), specific filtering criteria were also applied, including: QD<2.0||MQ<40.0||FS>60.0||SOR>3.0||MQRankSum<-12.5||ReadPosRankSum<8.0. Finally, the "bcftoolsconcat" command was used to merge the chromosomes to obtain the SNP variant data.
[0051] Fourth, screen for mutation sites associated with resistance to bromofenac.
[0052] The neutrality theory states that at the molecular level, most mutations are neutral or near-neutral, and therefore natural selection has no significant effect on them. Unselected genomic loci are typically in a state of random drift, and the linkage disequilibrium effects gradually weaken with long-term recombination, leading to a reduction in haplotype length. When a population is under selection pressure, the frequency of favorable alleles increases rapidly in a short period, causing the frequency of neutral alleles near the selected locus to also rise. This principle can be used to perform whole-genome scanning analysis to identify selected mutation sites, including but not limited to using SweepFinder2 and comparative analysis... FST (Fixation index) and methods for calculating zinc plating (pi). F ST The fixation index is a statistical measure used to measure genetic variation among populations. It assesses the degree of genetic differentiation between populations by comparing the degree of variation within and between populations. F ST The value range is between 0 and 1. F ST A value of 0 indicates no genetic differentiation within or between populations. F ST A value of 1 indicates significant genetic differentiation within and between populations.
[0053] Using the SNP variation data obtained above, different geographical populations of *Thrips peatus* were compared, and the differences between populations were calculated. F ST Value, set sliding window 100 kb. Through a comprehensive scan of genomic data, the V332I mutation site on the Rdl gene was identified ( Figure 1 Its nucleic acid sequence was mutated from GTC encoding valine (V) to ATC encoding isoleucine (I).
[0054] To verify that the V332I mutation causes resistance of bean thrips to bromutamide, the sensitivity of 10 populations of bean thrips to bromutamide and the mutation frequency of V332I were determined. The sensitivity determination method was the same as in Example 1. Those skilled in the art should be familiar with the methods for detecting the V332I mutation described above. Primers for molecular detection can be designed by analyzing the sequence near the V332I mutation site in the Rdl gene of the target insect species, or whole-genome resequencing of the specimens can be performed using high-throughput sequencing.
[0055] Preferably, KASP is used to detect the V332I mutation in soybean thrips.
[0056] (1) Select populations that have been tested for sensitivity to bromoxynil dimethicone, and select 24 female adults from each population. Extract DNA from single specimens using the magnetic bead method described in Example 2.
[0057] (2) Extract the genomic DNA sequence of 500 bp above and below the V332I mutation site of the Rdl gene of soybean thrips, and design F1 primer CCTACGTCAAATCGATCGACG, F2 primer CCTACGTCAAATCGATCGACA and R primer CGCTGCCAAAGATTTCCTATGTAAAATC using Primer 3.
[0058] (3) The reagent used for KASP detection was 2 × KASP master mixture (LGC). The reaction system consisted of 1.5 ng of dry powdered genomic DNA, 0.14 μL of primer mixture (the upstream primer concentration in the primer mixture was 12 μmol / L and the downstream primer concentration was 30 μmol / L), and 3 μL of 2 × KASP master mixture.
[0059] (4) The landing reaction procedure includes: pre-denaturation at 94 °C for 15 min; followed by 10 cycles, each cycle including denaturation at 94 °C for 20 s and annealing at 61~55 °C for 1 min, with a decrease of 0.6 °C in each cycle; then 40 cycles, each cycle including denaturation at 94 °C for 20 s and annealing at 55 °C for 1 min.
[0060] (5) Finally, check the genotyping results on the genotyping instrument and count the genotype frequencies. If the fluorescence signal data of the amplified product is G:G, it is a homozygous resistant individual; if the fluorescence signal data is A:A, it is a homozygous sensitive individual; if the fluorescence signal data is G:A, it is a heterozygous individual. Count the frequency of the resistance allele G in the tested population, that is, the mutation frequency of V332I.
[0061] In DPS v12.01 statistical software, linear regression was used to analyze the mutation frequency of V332I and log(LC) 50 The correlation between the two was found to be R² = 0.7875. Figure 2 This indicates a high correlation between V332I and the resistance of soybean thrips to bromonitrile dimethicone.
[0062] To determine whether the V332I mutation also leads to resistance to bromutamide in other insects, four field populations of flea beetles were collected, and the mutation site and sensitivity were measured in each population.
[0063] Preferably, KASP was used to detect the V332I mutation in soybean thrips, and the detection method was the same as in Example 3. Specifically, the Rdl gene sequence was found in the genome of the yellow striped flea beetle (GenBank ID: GCA_918026865.1), and the genomic DNA sequence of 500 bp above and below the V332I mutation site of the Rdl gene was extracted. Using Primer 3, F1 primer ACGTGAAATCCATCGATG, F2 primer ACGTGAAATCCATCGATA, and R primer GTTTCTTCTGCTCGGCTAT were designed respectively.
[0064] The sensitivity determination method is the same as in Example 1.
[0065] The correlation between the mutation frequency of V332I and log(LC50) was analyzed using linear regression in DPS software (Table 2). The correlation coefficient R was found to be... 2 = 0.9176, indicating a high correlation between the V332I mutation and the resistance of the flea beetle to bromonitrile dimethicone.
[0066] Table 2. Median lethal concentration (LC50) of bromofenac in different populations of flea beetles. 50 )
[0067] To determine whether the tomato leafminer population has developed resistance to bromutamide, a tomato leafminer population in the Beijing area was selected, and 48 larvae were randomly selected to test the V332I mutation frequency.
[0068] Preferably, the region of the Rdl gene containing the V332I mutation is amplified using PCR and followed by Sanger sequencing.
[0069] (1) DNA extraction from single-head specimens was performed using the magnetic bead method described in Example 2.
[0070] (2) The Rdl gene was searched in the genome of the tomato leafminer moth (GenBank No.: GCA_918026865.1), and the F1 primer CAATTTGTCCGCTCCA and the R1 primer tutaRDL-exon7-8-R1CACCTCCCTAATGTACTCA were designed using Primer 3.
[0071] (3) The PCR reaction system consisted of 15 μL of ddH2O, 8.6 μL of ddH2O, 1.5 μL of buffer, 1.5 μL of dNTPs, 0.6 μL each of primers C1-J-2195 and R-BQ-2819, 0.2 μL of LA Taq enzyme (TaKaRa), and 1.5 μL of DNA template. After pre-denaturation at 94 ℃ for 30 s, the reaction system underwent 40 cycles of the following: denaturation at 98 ℃ for 10 s, annealing at 50 ℃ for 50 s, extension at 72 ℃ for 40 s, and a final extension at 72 ℃ for 10 min. The PCR amplification products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing using an ABI 3730xl sequencer.
[0072] (4) The sequencing peaks encoding the 332nd amino acid site were found in the sequencing results. All of them were A, which means that the amino acid encoded at this position is valine (V). No amino acid mutation occurred in the tested population at this position, indicating that the population is sensitive to bromuconazole. It is recommended to use this agent to control this population of tomato leafminer.
[0073] Further bioassays were used to verify the above inferences.
[0074] (1) The Potter spray tower method (Burkard Manufacturing Co. Ltd.) was used for determination. A fresh tomato leaf that had not been exposed to any pesticide was picked, and the petiole was immersed in a 1.5 ml centrifuge tube containing purified water. The centrifuge tube opening was plugged with degreased cotton and placed in a 6 cm diameter plastic box. Second-instar tomato leafminer larvae were picked up with a paintbrush and transferred to a prepared petri dish with tomato leaves. 20 larvae per dish, repeated 4 times. Then, the spray was precisely sprayed under a Potter spray tower. The spray volume was 2 ml each time, the spray pressure was 15 kPa, and the solution settled for 30 seconds after each spray. The treated tomato leafminers were kept in an environment with a temperature of about 25 ℃, a relative humidity of 60%, and a light ratio of 16:8. The mortality was checked after 48 h. Tomato leafminers that were crawling normally were considered alive. If it was impossible to determine whether they were alive or dead, the insects were touched lightly with a small paintbrush. Those that did not move were considered dead. The number of dead insects was counted.
[0075] (2) The toxicity assay was performed using DPS v12.01 statistical software to calculate the toxicity regression equation and the median lethal concentration (LC50). 50 The LC-150 of the tomato leafminer population and its 95% confidence interval are familiar to those skilled in the art. Calculations revealed that the LC-150 of this population to bromofenac induciazole... 50 (95% confidence interval) = 0.325 (0.190-0.426) mg / L, which proves that this population is highly sensitive to bromuconazole.
[0076] Furthermore, a field efficacy experiment was conducted on tomato leafminer on greenhouse tomatoes using 10% bromofenozide suspension produced by BASF Europe, diluted to a 2000-fold liquid concentration.
[0077] Preferably, the tomato plants in the experimental field were spaced 30×80 cm apart. Chicken manure was used as base fertilizer before transplanting, and no chemical fertilizers or pesticides were applied after transplanting except for watering, which resulted in relatively severe damage. Controls were provided using 1000-fold dilutions of 6% spinosad suspension, 5% emamectin benzoate microemulsion (emamectin benzoate), and water. Each treatment was replicated four times, with a total of 20 plots, each approximately 15 square meters in size, arranged in a randomized block design. The pesticides were applied using a Spanish-made Medeby backpack sprayer for uniform spraying of the entire plant, at a rate of 450 kg / hm².
[0078] The results showed that the control efficacy of bromutoxonil against tomato leafminer in the field reached 91.7% ± 2.2% 7 days after application (Table 3), indicating that the agent has a good control effect.
[0079] Table 3. Field control efficacy of different insecticides against tomato leafminer
[0080] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.
Claims
1. A mutant of the Rdl gene in insects, characterized in that... The mutant gene encoding the 332nd amino acid is mutated from GTT, GTC, or GTA to ATT, ATC, or ATA, and the encoded amino acid is mutated from wild-type valine (V) to isoleucine (I). The 332nd amino acid sequence is homologous to the 332nd amino acid site encoded by the Drosophila melanogaster Rdl gene.
2. An application of using the nucleic acid encoding the 332nd amino acid on the gene mutant of claim 1 as a detection target in the detection of insect resistance to bromoxynil dimethicone.
3. A method for detecting insect resistance to bromutrin dimethicone as described in claim 3, characterized in that... Extract DNA or RNA samples and detect the nucleic acid encoding the 332nd amino acid on the Rdl gene; if the nucleic acid encoding the 332nd amino acid is GTT, GTC, or GTA, it is a homozygous individual sensitive to bromuconazole; if it is ATT, ATC, or ATA, it is a resistant homozygous individual; if both of the above nucleic acids are present, it is a resistant heterozygous individual.