Acinetobacter baumannii DL27 and application thereof in degrading acetaminophen

By screening Acinetobacter DL27, the problem of acetaminophen accumulation in the environment was solved, and efficient degradation in complex environments was achieved, especially in sewage treatment plant wastewater and agricultural soil, with a degradation rate of over 94%, demonstrating its application potential in practical applications.

CN122303095APending Publication Date: 2026-06-30HEBEI UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610526628.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-04-21
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

The widespread use of acetaminophen in the environment in the present technology has led to its accumulation in aquatic and soil environments, causing ecological and health risks, and its ability to be degraded by microorganisms in complex environments is insufficient.

Method used

Acinetobacter DL27, taxonomically named Acinetobactersp., with accession number CGMCC No. 38039, was used to degrade acetaminophen. It is suitable for wastewater from sewage treatment plants and agricultural soils. The inoculum amount is 5%-25%, the degradation temperature is 10-50℃, the pH is 4-10, and the rotation speed is 50-250 rpm.

Benefits of technology

Acinetobacter DL27 efficiently degrades acetaminophen in complex environments, achieving a degradation rate of over 94% within 60 minutes. It can completely degrade 15-75 mg/L in wastewater from sewage treatment plants and achieve a degradation rate of 93.81% in soil, demonstrating broad-spectrum environmental adaptability and high-efficiency degradation capabilities.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122303095A_ABST
    Figure CN122303095A_ABST
Patent Text Reader

Abstract

This invention discloses an Acinetobacter DL27 strain and its application in the degradation of acetaminophen, belonging to the field of microbial technology. This strain is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 38039, deposited on April 3, 2026, and taxonomically named Acinetobacter. Acinetobacter sp . This invention has screened a strain of Acinetobacter DL27 that can efficiently degrade acetaminophen, and it can efficiently degrade acetaminophen in wastewater from actual sewage treatment plants and agricultural soils, which has important application value in the bioremediation of acetaminophen in complex environments.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbial technology, and more specifically to an Acinetobacter DL27 strain and its application in the degradation of acetaminophen. Background Technology

[0002] Acetaminophen, also known as paracetamol or acetaminophen, with the chemical formula C8H9NO2, is one of the most widely used antipyretic and analgesic drugs globally and is listed in the World Health Organization's Essential Medicines List. In recent years, with global population growth, rapid urbanization, and improved medical conditions, the production and consumption of acetaminophen have steadily increased, making it one of the top ten most consumed drugs worldwide. However, due to its unavoidable widespread use and incomplete metabolism in the human body, large amounts of acetaminophen are released into the environment through human feces and urine, and emissions from hospitals and pharmaceutical plants.

[0003] Acetaminophen's high water solubility contributes to its accumulation in aquatic environments. It has been widely detected in coastal sediments, wastewater, surface water, groundwater, and drinking water systems, with concentrations ranging from ng / L to mg / L. The persistent presence of acetaminophen in the environment poses significant risks to aquatic organisms and ecosystems even at extremely low concentrations. For example, the harmful effects of acetaminophen on fish include reproductive and endocrine dysfunction, hepatotoxicity, oxidative stress, neurotoxicity, and developmental abnormalities. Acetaminophen can also accumulate in agricultural soils through wastewater irrigation, posing a potential risk to agro-ecosystems. Furthermore, acetaminophen can affect human health through bioaccumulation and dissemination via the food chain. Excessive human exposure to acetaminophen can have serious effects, such as liver damage, fetal maldevelopment, urogenital abnormalities, myocardial infarction, and neurotoxicity.

[0004] Microbial degradation of acetaminophen is a promising method due to its low cost, high efficiency, and sustainability. Although some early studies on the microbial degradation of acetaminophen have been conducted, most were limited to laboratory culture conditions, with less attention paid to the bio-enhanced degradation capabilities of strains in complex in-situ environments.

[0005] Therefore, how to develop a strain that can efficiently degrade acetaminophen is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0006] In view of this, the purpose of the present invention is to provide an Acinetobacter DL27 strain and its application in the degradation of acetaminophen, so as to overcome the shortcomings of the prior art.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] Acinetobacter DL27, deposited at the China General Microbiological Culture Collection Center (CGMCC), Institute of Microbiology, Chinese Academy of Sciences, No. 3, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCCNo. 38039, deposited on April 3, 2026, and taxonomically named Acinetobacter. Acinetobacter sp . .

[0009] A microbial inoculant containing the aforementioned Acinetobacter DL27.

[0010] The present invention also claims protection for the use of the above-mentioned Acinetobacter DL27 in the degradation of acetaminophen.

[0011] Furthermore, the degradation conditions described above are: acetaminophen concentration of 15-450 mg / L, Acinetobacter DL27 inoculum amount of 5%-25%, degradation temperature of 10-50℃, pH of 4-10, and rotation speed of 50-250 rpm.

[0012] The present invention also claims protection for the use of the above-mentioned Acinetobacter DL27 in the degradation of acetaminophen in wastewater.

[0013] Furthermore, the degradation conditions were as follows: the concentration of acetaminophen was 15-75 mg / L, the inoculum amount of Acinetobacter DL27 was 10%, the degradation temperature was 30℃, and the rotation speed was 150 rpm.

[0014] The present invention also claims protection for the use of the above-mentioned Acinetobacter DL27 in the degradation of acetaminophen in soil.

[0015] Furthermore, the degradation conditions were as follows: the concentration of acetaminophen was 15-75 mg / L, the inoculum amount of Acinetobacter DL27 was 10%, and the degradation temperature was 30℃.

[0016] As can be seen from the above technical solution, compared with the prior art, the beneficial effects of the present invention are as follows: 1. This invention screened Acinetobacter DL27, a strain that can efficiently degrade acetaminophen, and it can efficiently degrade acetaminophen in wastewater from actual sewage treatment plants and agricultural soils, which has important application value in the bioremediation of acetaminophen in complex environments.

[0017] 2. The Acinetobacter DL27 of this invention can tolerate high concentrations of acetaminophen. When the concentration of acetaminophen is 15-450 mg / L, the inoculum amount of Acinetobacter DL27 is 5%-25%, the degradation temperature is 10-50℃, the pH is 4-10, and the rotation speed is 50-250 rpm, acetaminophen can be effectively degraded.

[0018] 3. Under the conditions of 15% inoculum, 35℃ temperature, pH of culture medium, and rotation speed of 200 r / min, the degradation rate of acetaminophen by Acinetobacter DL27 of the present invention within the range of 15-450 mg / L reached more than 94% within 60 min.

[0019] 4. The Acinetobacter DL27 of this invention, after being cultured in wastewater from a sewage treatment plant (with a acetaminophen concentration of 15-75 mg / L) for 60 min, completely degraded acetaminophen at concentrations of 15 mg / L and 45 mg / L, and the degradation rate of acetaminophen at concentration of 75 mg / L was as high as 90.34%, that is, the degradation rate of acetaminophen can reach 90.34%-100%.

[0020] 5. After being cultured in agricultural soil (acetaminophen concentration of 15-75 mg / kg) for 240 min, Acinetobacter DL27 of the present invention completely degraded acetaminophen at concentrations of 15 mg / L and 45 mg / L, and the degradation rate of acetaminophen at concentration of 75 mg / L was as high as 93.81%, that is, the degradation rate of acetaminophen can reach 93.81%-100%. Attached Figure Description

[0021] Figure 1 The scanning electron microscope morphology of Acinetobacter DL27; Figure 2 Phylogenetic tree of Acinetobacter DL27 16S rRNA; Figure 3 The effect of temperature on the degradation of acetaminophen by Acinetobacter DL27; Figure 4 The effect of pH on the degradation of acetaminophen by Acinetobacter DL27; Figure 5 The effect of inoculum size on the degradation of acetaminophen by Acinetobacter DL27; Figure 6 The effect of rotation speed on the degradation of acetaminophen by Acinetobacter DL27; Figure 7 The effect of substrate concentration on the degradation of acetaminophen by Acinetobacter DL27; Figure 8 The effect of Acinetobacter DL27 on the degradation of acetaminophen in wastewater from sewage treatment plants; Figure 9 The effect of Acinetobacter DL27 on the degradation of acetaminophen in agricultural soil. Detailed Implementation

[0022] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0023] Example 1: Screening of Acinetobacter DL27 1. Material Preparation Sample source: Wastewater treatment plant in a city in Shaanxi Province.

[0024] Culture medium: LB liquid medium: NaCl 10.0 g, peptone 10.0 g, yeast extract 5.0 g, deionized water to 1 L, adjust pH to 7.4 ± 0.2 using NaOH. Add an additional 1.5%–2% agar powder to obtain LB solid medium, sterilize at 121℃ for 20 min before use.

[0025] Inorganic salt culture medium: composed of 0.5 g NH4Cl, 0.5 g KH2PO4, 1.5 g K2HPO4, 0.15 g MgSO4·7H2O, 0.5 g NaCl and 1.0 mL trace elements, including 0.3 g MnSO4·4H2O, 0.2 g ZnSO4·7H2O, 0.02 g (NH4)6Mo7O2·4H2O, 0.1 g CuSO4·5H2O, 0.5 g CoCl2·6H2O, 0.05 g CaCl2·2H2O, and 0.5 g FeSO4·7H2O. Deionized water is added to a final volume of 1 L. The medium is then sterilized at 121℃ for 20 min before use.

[0026] 2. Preliminary screening of strains Activated sludge samples were collected from a wastewater treatment plant in a city in Shaanxi Province for screening acetaminophen-degrading bacteria. Five mL of sludge was inoculated into 100 mL of sterile MSM medium containing 20 mg / L acetaminophen. The culture was incubated at 30°C and 200 rpm for 3 days. Similarly, acclimation was repeated at 5% (v / v) inoculation amounts in MSM medium containing 50, 100, 150, 200, and 500 mg / L acetaminophen. Subsequently, enrichment culture was carried out in 500 mg / L acetaminophen MSM medium for 3 months, with inoculation into fresh MSM medium every 3 days to remove non-acetaminophen-degrading bacteria as much as possible.

[0027] Then the bacterial suspension was diluted 10... -1 10 -2 10 -3 10 -4 and 10 -5 The culture was then spread on an inorganic salt solid medium containing 500 mg / L acetaminophen. Single colonies of different morphologies were picked and streaked until single colonies were obtained. The colonies were then stored in 50% glycerol at -80°C for later use.

[0028] 3. Secondary screening of strains The pure strains obtained in the above steps were inoculated into LB liquid medium for activation culture until OD... 600 =1.0, and then inoculated at a rate of 5% into an inorganic salt liquid culture medium with acetaminophen as the sole carbon source. The medium was cultured with shaking at 30℃ and 200 r / min. The concentration of acetaminophen was determined by high performance liquid chromatography, and the degradation rate was calculated. Acinetobacter DL27, which can efficiently degrade acetaminophen, was screened.

[0029] 4. Method for determining acetaminophen concentration The sample was centrifuged at 10,000 rpm for 2 min. The supernatant was filtered through a 0.22 μm microporous membrane, and the concentration of acetaminophen was then determined by high performance liquid chromatography.

[0030] High-performance liquid chromatography (HPLC) detection conditions: Octadecylsilane-bonded silica gel was used as the stationary phase; the mobile phase consisted of methanol (A) and 0.1% formic acid water (B) in proportions of 20% and 80%, respectively. The detection wavelength was 254 nm; the injection volume was 10 μL, and the flow rate was set to 1.0 mL / min.

[0031] Example 2: Morphological and Molecular Biological Identification of Acinetobacter DL27 1. Observation of morphological characteristics The morphology of Acinetobacter DL27 was observed using transmission electron microscopy. For example... Figure 1As shown, Acinetobacter DL27 is rod-shaped and lacks flagella.

[0032] 2. Molecular biological identification of Acinetobacter DL27 2.1 Genome Extraction The method for extracting genomic DNA from Acinetobacter DL27 is as follows: (1) Collect 1-5 mL (OD) using a 1.5 mL tube. 600 Centrifuge bacterial cells (=1.0) at 12,000 rpm for 2 min and discard the supernatant; (2) Add 180 μL of Buffer GL, 20 μL of Proteinase K (20 mg / mL) and 10 μL of RNase A (10 mg / mL), shake well and incubate in a water bath at 56℃ for 10 min. At this time, the solution should be transparent and clear. (3) Add 200 μL of Buffer GB and 200 μL of 100% ethanol, and mix thoroughly by suction and whisking. (4) Install the Spin Column on the Collection Tube, transfer the solution into the Spin Column, centrifuge at 12,000 rpm for 2 min, and discard the filtrate; (5) Add 500 μL of Buffer WA to the Spin Column, centrifuge at 12,000 rpm for 1 min, and discard the filtrate; (6) Add 700 μL of Buffer WB to the Spin Column, centrifuge at 12,000 rpm for 1 min, and discard the filtrate. Confirm that the specified volume of 100% ethanol has been added to the Buffer WB. Add Buffer WB along the perimeter of the Spin Column tube, repeating twice; (7) Place the Spin Column on the Collection Tube and centrifuge at 12,000 rpm for 2 min; (8) Place the Spin Column on a new 1.5 mL centrifuge tube, add 50 μL of sterile water heated to 65°C to the center of the Spin Column membrane, and let it stand at room temperature for 5 min. (9) Elute DNA by centrifuging at 12,000 rpm for 2 min.

[0033] 2.2 Bacterial genome PCR amplification Primer sequences: 27F: AGAGTTTGATCCTGGCTCAG (as shown in SEQ ID NO.1 in the sequence listing); 1492R: GGTTACCTTGTTACGACTT (as shown in SEQ ID NO.2 in the sequence listing).

[0034] PCR amplification reaction system: Table 1 PCR amplification reaction system

[0035] Gently tap to mix, then briefly centrifuge to collect the droplets on the tube wall to the bottom. Perform the PCR reaction on a PCR amplification instrument with the following reaction parameters: Table 2 PCR amplification reaction procedure

[0036] After the reaction was completed, the PCR products were recovered using the Takara DNA gel extraction kit and then sent to Beijing Qingke Biotechnology Co., Ltd. for 16S rRNA sequencing.

[0037] 2.3 Sequencing Results Sequencing revealed that the 16S rRNA gene sequence of Acinetobacter DL27 was 1534 bp in length. Comparison with the EzBioCloud database showed that the 16S rRNA sequence of Acinetobacter DL27 matched that of the strain. Acinetobacter oryzae B23 T The highest similarity was 99.44%. According to... Figure 2 Phylogenetic tree analysis, Acinetobacter DL27 and Acinetobacterjohnsonii CIP64.6 T and Acinetobacter oryzae B23 T The strain is most closely related to *Acinetobacter*. It is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with accession number CGMCC No. 38039 and deposit date of April 3, 2026. Its taxonomic name is *Acinetobacter*. Acinetobacter sp . .

[0038] The 16S rRNA sequence of Acinetobacter DL27 is shown in SEQ ID NO.3 of the sequence listing, as follows:

[0039] Example 3: Degradation characteristics of Acinetobacter DL27 1. Effect of temperature on the degradation of acetaminophen by Acinetobacter DL27 Temperature is a key factor affecting the biodegradation of pollutants and can significantly influence microbial activity. Each pollutant-degrading strain has an optimal degradation temperature.

[0040] Take the above-mentioned Acinetobacter DL27 and culture it in LB liquid medium until OD. 600 After reaching a concentration of 1.0, take 15% of the bacterial culture, centrifuge at 8000 rpm for 2 min, discard the supernatant LB medium, resuspend three times with sterile PBS solution to remove residual LB medium, and then inoculate into inorganic salt medium containing 150 mg / L acetaminophen. The culture temperatures were set at 10℃, 15℃, 20℃, 25℃, 30℃, 35℃, 40℃, 45℃, and 50℃, with a shaker speed of 200 r / min and a pH of 7.0. Each group was divided into three replicates, with an uninoculated treatment serving as a control. After 30 min, samples were taken to determine the residual concentration of acetaminophen and calculate the degradation rate.

[0041] Wherein, degradation rate (%) = (C0 - C) t ) / C0×100; In the formula: C0 is the concentration of acetaminophen in the control group sample, mg / L; C t The concentration of acetaminophen in the experimental group samples is mg / L.

[0042] from Figure 3 It can be seen that Acinetobacter DL27 can effectively degrade 150 mg / L of acetaminophen at all set temperatures. Clearly, 30-40℃ is the optimal temperature range for Acinetobacter DL27 to degrade acetaminophen, with the highest degradation rate of 97.90% observed at 35℃. Above 35℃, the degradation rate gradually decreases. These results indicate that at temperatures below or above 35℃, the enzyme activity involved in the degradation of acetaminophen is inhibited, leading to a decrease in degradation efficiency. Therefore, 35℃ was chosen as the optimal temperature for acetaminophen degradation. Encouragingly, although Acinetobacter DL27 exhibits the highest degradation rate at 35℃, the degradation rates remain high at 49.49% and 54.10% after culturing at 15℃ and 50℃ for 40 min, respectively. This ability to efficiently degrade acetaminophen over a broad temperature range is undoubtedly uncommon among other reported acetaminophen-degrading bacteria.

[0043] 2. Effect of pH on the degradation of acetaminophen by Acinetobacter DL27 pH significantly affects cell membrane permeability and the activity of proteins related to metabolic processes, playing a crucial role in the biodegradation of various pollutants. Different pollutant-degrading bacteria in the environment have different optimal pH conditions.

[0044] Take the above-mentioned Acinetobacter DL27 and culture it in LB liquid medium until OD. 600 After reaching a concentration of 1.0, take 15% of the bacterial culture, centrifuge at 8000 rpm for 2 min, discard the supernatant LB medium, resuspend three times with sterile PBS solution to remove residual LB medium, and then inoculate into inorganic salt medium containing 150 mg / L acetaminophen. The pH of the medium was set to 4, 5, 6, 7, 8, 9, and 10, respectively, and the incubation temperature was set to 30℃. The shaking speed was set to 200 r / min. Each group was divided into three replicates, and a sterile treatment was set as a control. After 30 min, samples were taken to determine the residual concentration of acetaminophen and calculate the degradation rate.

[0045] Wherein, degradation rate (%) = (C0 - C) t ) / C0×100; In the formula: C0 is the concentration of acetaminophen in the control group sample, mg / L; C t The concentration of acetaminophen in the experimental group samples is mg / L.

[0046] from Figure 4 It was found that under all set pH conditions, Acinetobacter DL27 could degrade more than 55% of 150 mg / L acetaminophen after 30 min of culture, with a degradation rate exceeding 75% in the pH range of 5-10, demonstrating its efficient acetaminophen degradation capacity across a broad pH range. pH 7-9 is the optimal range for Acinetobacter DL27 to degrade acetaminophen, with the highest degradation rate reaching 97.51% at pH 8.0. Although the degradation rate decreased somewhat at pH 9.0-10.0, it still reached relatively high levels of 91.45% and 83.30%, respectively. Furthermore, it is particularly interesting that Acinetobacter DL27 still achieved degradation rates of 55.04% and 75.71% of acetaminophen under acidic conditions of pH 4.0 and pH 5.0, respectively, within such a short culture time. It is well known that most pollutant-degrading strains struggle to maintain efficient degradation capabilities under acidic conditions. These results undoubtedly indicate the potential for practical applications of Acinetobacter DL27.

[0047] 3. Effect of inoculum size on the degradation of acetaminophen by Acinetobacter DL27 Inoculation dosage has been recognized as an important indicator in the practical application of contaminant remediation.

[0048] Take the above-mentioned Acinetobacter DL27 and culture it in LB liquid medium until OD. 600 After reaching a concentration of 1.0, bacterial cultures with inoculum volumes of 5%, 10%, 15%, 20%, and 25% were centrifuged at 8000 rpm for 2 min, respectively. The supernatant LB medium was discarded, and the culture was resuspended three times with sterile PBS solution to remove residual LB medium. The culture was then inoculated into an inorganic salt medium containing 1500 mg / L acetaminophen. The culture temperature was set at 30℃, pH at 7, and the shaking speed at 200 r / min. Each group was divided into three replicates, with a sterile treatment serving as a control. After 30 min, samples were taken to determine the residual concentration of acetaminophen and calculate the degradation rate.

[0049] Wherein, degradation rate (%) = (C0 - C) t ) / C0×100; In the formula: C0 is the concentration of acetaminophen in the control group sample, mg / L; C t The concentration of acetaminophen in the experimental group samples is mg / L.

[0050] from Figure 5 It can be seen that under inoculum sizes of 5%, 10%, 15%, 20%, and 25% (v / v), the biodegradation efficiencies of Acinetobacter DL27 for acetaminophen were 80.01%, 87.95%, 96.16%, 91.3%, and 90.67%, respectively, with degradation rates exceeding 80% under all tested inoculum sizes. When the inoculum size was 5%-10%, the low biomass resulted in a low acetaminophen degradation rate after 30 min of culture. The acetaminophen degradation rate of Acinetobacter DL27 reached its highest level when the inoculum size increased to 15%. This may be because the higher inoculum size caused Acinetobacter DL27 to enter a quiescent state earlier, resulting in more enzymatic reactions related to metabolism, which is beneficial for promoting acetaminophen degradation. With a further increase in inoculum size to 20%, the degradation rate of acetaminophen by Acinetobacter DL27 decreased slightly. This may be because excessive biomass leads to intraspecific resource competition, ultimately reducing its efficiency in degrading pollutants.

[0051] 4 Effect of rotational speed on the degradation of acetaminophen by Acinetobacter DL27 Rotation speed is also a key parameter affecting the bacterial degradation process, mainly by changing the dissolved oxygen in the culture system, thereby affecting bacterial growth and metabolic enzyme activity.

[0052] Take the above-mentioned Acinetobacter DL27 and culture it in LB liquid medium until OD. 600After reaching a concentration of 1.0, take 15% of the bacterial culture, centrifuge at 8000 rpm for 2 min, discard the supernatant LB medium, resuspend three times with sterile PBS solution to remove residual LB medium, and then inoculate into an inorganic salt medium containing 150 mg / L acetaminophen. The pH of the medium is set to 7, the incubation temperature is set to 30℃, and the shaking speed is set to 50, 100, 150, 200, and 250 r / min, with three replicates for each group. A sterile treatment is also included as a control. After 30 min, samples are taken to determine the residual concentration of acetaminophen and calculate the degradation rate.

[0053] Wherein, degradation rate (%) = (C0 - C) t ) / C0×100; In the formula: C0 is the concentration of acetaminophen in the control group sample, mg / L; C t The concentration of acetaminophen in the experimental group samples is mg / L.

[0054] Figure 6 The results showed that within all set rotation speed ranges (50-250 r / min), Acinetobacter DL27 achieved a degradation rate of over 94% for acetaminophen, with minimal differences in degradation rates across different rotation speeds. When the rotation speed increased from 50 r / min to 100 r / min, the degradation rate also increased from 94.63% to 97.33%, likely due to the increased dissolved oxygen in the culture system, which enhanced the strain's metabolic capacity. There was almost no significant difference in degradation rates within the 100-200 r / min range. These results indicate that Acinetobacter DL27 exhibits highly efficient acetaminophen degradation capabilities under various rotation speed conditions, highlighting its potential for practical applications.

[0055] 5. Effect of substrate concentration on Acinetobacter DL27 degradation of acetaminophen Take the above-mentioned Acinetobacter DL27 and culture it in LB liquid medium until OD. 600 After reaching a concentration of 1.0, a 15% inoculum was centrifuged at 8000 rpm for 2 min, the supernatant LB medium was discarded, and the culture was resuspended three times with sterile PBS to remove residual LB medium. The culture was then inoculated into inorganic salt media containing initial concentrations of 15, 45, 75, 150, 225, 300, and 450 mg / L acetaminophen, respectively. The culture temperature was set at 35℃, pH at 8.0, and the shaking speed at 200 rpm. Each group was divided into three replicates, with an uninoculated treatment serving as a control. Samples were taken every 10 min to determine the residual concentration of acetaminophen and to calculate the degradation rate.

[0056] Wherein, degradation rate (%) = (C0 - C) t) / C0×100; In the formula: C0 is the concentration of acetaminophen in the control group sample, mg / L; C t The concentration of acetaminophen in the experimental group samples is mg / L.

[0057] Depend on Figure 7 Acinetobacter DL27 exhibited highly efficient acetaminophen degradation within a concentration range of 15-450 mg / L. Complete degradation was achieved within 30 min in the 15-45 mg / L range, and over 90% degradation remained within 30 min in the 75-150 mg / L range. However, the degradation rate decreased significantly as the initial concentration increased to the 225-450 mg / L range, likely due to the inhibition of bacterial metabolic activity by high substrate concentrations. Surprisingly, even at the highest tested concentration of 450 mg / L, Acinetobacter DL27 successfully degraded 90.40% of acetaminophen within 50 min. In conclusion, these findings highlight the highly efficient acetaminophen degradation capacity of Acinetobacter DL27, underscoring its potential in environmental bioremediation.

[0058] IV. Degradation Effect of Acinetobacter DL27 in Actual Wastewater and Agricultural Soil To evaluate the application potential of Acinetobacter DL27 in the bioremediation of acetaminophen, its degradation capacity in wastewater from sewage treatment plants and agricultural soils was determined.

[0059] 1. The effect of Acinetobacter DL27 on the degradation of acetaminophen in wastewater from sewage treatment plants Untreated wastewater was collected from the influent section of a wastewater treatment plant in Hebei Province. The wastewater experimental group measured the OD (Oxygen Demand)... 600 A bacterial suspension with a concentration of 1.0 was inoculated at a rate of 10% into wastewater containing concentrations of 15 mg / L, 75 mg / L, and 150 mg / L. The control group was supplemented with only acetaminophen. The mixtures were incubated in the dark at 30°C and 150 rpm. Samples were collected every 10 min to determine the acetaminophen concentration.

[0060] like Figure 8As shown, at three initial concentrations of 15 mg / L, 45 mg / L, and 75 mg / L, the spontaneous degradation rate of wastewater in the control group without Acinetobacter DL27 inoculation was low. Conversely, compared to the control group, the experimental group inoculated with Acinetobacter DL27 showed a significant reduction in acetaminophen concentration within 60 min. Specifically, at concentrations of 15 mg / L and 45 mg / L, Acinetobacter DL27 completely degraded acetaminophen in the wastewater after 60 min. At a concentration of 75 mg / L, the acetaminophen concentration in the wastewater was only 6.28 mg / L after 60 min, with a degradation rate as high as 90.34%.

[0061] 2. The effect of Acinetobacter DL27 on the degradation of acetaminophen in agricultural soil The agricultural soil used in the study was taken from a plot of farmland in Shaanxi Province used for growing vegetables and wheat. Soil samples from the top 2-25 cm were taken and sieved through a 2 mm sieve before use for subsequent bioremediation research. The soil experimental group will use OD... 600 A bacterial suspension with a concentration of 1.0 was inoculated at a rate of 10% into soil samples containing concentrations of 15 mg / kg, 45 mg / kg, and 750 mg / kg. The control group received only acetaminophen. All samples were thoroughly mixed and incubated at 30°C in the dark. During incubation, the moisture content was maintained at 15%–35%. 2 g of soil samples were collected every 40 min to determine the acetaminophen concentration.

[0062] like Figure 9 As shown, Acinetobacter DL27 exhibited a significant degradation capacity for acetaminophen in the soil environment. At three different initial concentrations, compared to the control group, the acetaminophen concentration in the Acinetobacter DL27-inoculated experimental groups showed a continuous decreasing trend over time. After 240 min of incubation, acetaminophen was completely degraded in the 15 mg / kg and 45 mg / kg groups, while the acetaminophen concentration in the 75 mg / kg group was only 3.89 mg / kg, with a degradation rate as high as 93.81%.

[0063] These results fully demonstrate that Acinetobacter DL27 has high application potential in the bioremediation of acetaminophen in real complex in-situ environments.

[0064] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Acinetobacter sp. DL27, characterized in that, The strain is preserved in the China General Microbiological Culture Collection Center, the preservation number is CGMCC No. 38039, the preservation date is April 3, 2026, and the taxonomic name is Acinetobacter Acinetobacter sp . .

2. A microbial inoculant, characterized in that, The Acinetobacter DL27 according to claim 1.

3. The use of the Acinetobacter DL27 according to claim 1 in degrading acetaminophen.

4. Use according to claim 3, characterized in that, The degradation conditions are: the concentration of acetaminophen is 15-450 mg / L, the inoculation amount of Acinetobacter DL27 is 5%-25%, the degradation temperature is 10-50℃, the pH is 4-10, and the rotation speed is 50-250 rpm.

5. The use of the Acinetobacter DL27 according to claim 1 in degrading acetaminophen in sewage.

6. Use according to claim 5, characterized in that, The degradation conditions are: the concentration of acetaminophen is 15-75 mg / L, the inoculation amount of Acinetobacter DL27 is 10%, the degradation temperature is 30℃, and the rotation speed is 150 rpm.

7. The use of the Acinetobacter DL27 according to claim 1 in degrading acetaminophen in soil.

8. Use according to claim 7, characterized in that, The degradation conditions are: the concentration of acetaminophen is 15-75 mg / L, the inoculation amount of Acinetobacter DL27 is 10%, and the degradation temperature is 30℃.