Aonls nuclear localization signal and its application in enhancing the efficiency of zebrafish crisper / cas9 editing

By fusing the ultrashort nuclear localization signal AoNLS with the Cas9 protein in zebrafish embryos, the Pcs2-AoNLS-Cas9 system was constructed, which solved the problem of low nuclear input efficiency, significantly improved the gene editing efficiency of the CRISPR/Cas9 system, and achieved more efficient and stable gene editing results.

CN122325548APending Publication Date: 2026-07-03HUAZHONG AGRI UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
HUAZHONG AGRI UNIV
Filing Date
2026-04-02
Publication Date
2026-07-03

AI Technical Summary

Technical Problem

Existing nuclear localization signals are not efficient enough for nuclear input in zebrafish embryos, making it difficult to meet the requirements for rapid nuclear entry of Cas9 protein, resulting in low gene editing efficiency of the CRISPR/Cas9 system.

Method used

A short nuclear localization signal AoNLS (KRKREAE) derived from the endogenous proteome of zebrafish was used to efficiently mediate the entry of exogenous proteins into the cell nucleus through the charge-complementary synergistic effect of basic clusters and acid-enhancing motifs. The exogenous protein was then fused with the Cas9 protein to construct the Pcs2-AoNLS-Cas9 system.

Benefits of technology

It significantly improved the efficiency of Cas9 protein accumulation in the nucleus of zebrafish embryos, enhanced the gene editing efficiency of the CRISPR/Cas9 system, and improved the editing efficiency by 1.72 times and 1.82 times compared with the traditional SV40 NLS version. Moreover, the short AoNLS sequence length reduces the probability of mutation during DNA replication and repair, and simplifies the synthesis cost.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122325548A_ABST
    Figure CN122325548A_ABST
Patent Text Reader

Abstract

This application discloses a nuclear localization signal AoNLS and its application in enhancing CRISPR / Cas9 editing in zebrafish. The nuclear localization signal AoNLS is derived from the zebrafish proteome. Through bioinformatics mining and functional screening, a structurally unique amino acid, KRKREAE, was identified, with its amino acid sequence shown in SEQ ID NO:1. This sequence is composed of both basic and acidic amino acids, and its mode of action differs from the single charge-driven mechanism of traditional NLS, achieving a breakthrough improvement in nuclear input efficiency. The Pcs2-AoNLS-GFP system, constructed by fusing AoNLS with GFP protein, showed a 1.56-fold increase in nuclear input efficiency in zebrafish embryos compared to the traditional SV40 NLS. Simultaneously, the Pcs2-AoNLS-Cas9 system, constructed by fusing AoNLS with Cas9 protein, significantly enhanced the editing efficiency of the Stat3 and Amh target genes by 1.72 times and 1.82 times, respectively, compared to the Pcs2-SV40 NLS-Cas9 gene editing system. The AoNLS sequence provided in this application is short and highly efficient, and can be used as a core component of the next-generation gene editing tool nuclear delivery system, with good application prospects in the fields of aquaculture breeding and developmental biology research.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the fields of molecular biology and genetic engineering, specifically to a novel nuclear localization signal AoNLS derived from the zebrafish proteome, a nucleic acid sequence containing the signal and its fusion protein, and the application of an enhanced CRISPR / Cas9 gene editing system constructed based on the above elements in zebrafish embryos. Background Technology

[0002] CRISPR / Cas9 technology has become one of the most representative tools in the field of genome editing, widely used in functional genomics research, transgenic animal model construction, and gene therapy. The core of this technology lies in the Cas9 nuclease precisely cutting the target DNA sequence under the guidance of guide RNA, creating double-strand breaks, thereby activating intracellular repair mechanisms to achieve gene knockout or knock-in. However, the Cas9 protein originates from bacteria and has a molecular weight exceeding 160 kDa. Its editing function depends on its efficient crossing of the nuclear membrane and the highly selective nucleoplasmic transport barrier, the nuclear pore complex, into the nucleus of eukaryotic cells. The recognition of transport substrates by the nuclear pore complex relies on the precise interaction between nuclear transport receptors and nuclear localization signals on the substrate. Therefore, how to efficiently and rapidly deliver the Cas9 protein to the nucleus is crucial to determining gene editing efficiency.

[0003] Currently, the most widely researched and applied intranuclear delivery strategy is to fuse the Cas9 protein with a nuclear localization signal. The nuclear localization signal derived from the SV40 large T antigen (amino acid sequence PKKKRKV, abbreviated as SV40 NLS) is the mainstream choice in this field. However, existing studies have shown that SV40 NLS is ineffective in early fish embryos; for example, its nuclear import activity is almost undetectable in early medaka embryos. This is because in fish, especially in early zebrafish embryos, cells undergo rapid cell division, with the cleavage phase lasting only a few minutes. The SV40 NLS-mediated nuclear import process typically takes tens of minutes to move from the cytoplasm to the nucleus, making it difficult to efficiently transport the Cas9 protein into the nucleus within this extremely short time, ultimately leading to reduced editing efficiency.

[0004] To improve nuclear input efficiency, this study sought a superior alternative to NLS. It is known that flanking phosphorylation of SV40 NLS can optimize NLS conformation and improve nuclear input efficiency, but this method has certain drawbacks. In early embryos, phosphorylation is limited by the cell cycle, reducing the nuclear input efficiency of phosphorylation-dependent NLS. Therefore, the inventors attempted to achieve efficient nuclear input without relying on phosphorylation: searching for novel NLSs naturally containing acid-enhancing motifs, utilizing their flanking acidic amino acids to optimize their conformation, thereby improving nuclear input efficiency. A bioinformatics screening yielded an AoNLS sequence (SEQ ID NO:1) with this characteristic, which differs from existing NLSs. This sequence improved gene editing efficiency by 1.72-fold and 1.82-fold, respectively, in a zebrafish embryo CRISPR / Cas9 system. This not only helps expand the design ideas of existing NLSs but also has significant implications for overcoming current technological bottlenecks, reconstructing a more efficient CRISPR / Cas9 nuclear delivery system, and improving gene manipulation efficiency. In summary, there is an urgent need in this field to develop a novel nuclear localization signal that has high nuclear input efficiency in zebrafish embryos and can significantly enhance the gene editing efficiency of the CRISPR / Cas9 system. Summary of the Invention

[0005] To address the bottleneck problem of insufficient nuclear input efficiency of existing nuclear localization signals in zebrafish embryos, which makes it difficult to meet the rapid nuclear entry requirements of Cas9 protein, the inventors screened out multiple candidate NLS (hereinafter referred to as AoNLS) sequences with unique amino acid composition characteristics by performing bioinformatics prediction on eukaryotic proteomes. Among them, a 7-amino acid sequence (SEQ ID NO:1) has attracted special attention because it contains both a basic cluster and an acidic / neutral enhancing motif. Its amino acid sequence is shown in SEQ ID NO:1 (KRKREAE). This sequence mediates the nuclear input of exogenous proteins in a non-phosphorylation-dependent manner through the charge-complementary synergistic effect of the basic core and the acidic enhancing motif. Its nuclear input efficiency is 1.56 times higher than that of the traditional SV40 NLS. The Pcs2-AoNLS-Cas9 system, constructed by fusing this signal with the Cas9 protein, significantly enhanced the editing efficiency of the CRISPR / Cas9 system in zebrafish embryos. The target sites of two different genes were increased by 1.72 times and 1.82 times, respectively, compared with the traditional Pcs2-SV40 NLS-Cas9.

[0006] To achieve the above objectives, this application provides the following technical solution:

[0007] In a first aspect, this application provides a nuclear localization signal AoNLS, which is derived from the endogenous proteome of zebrafish and has the amino acid sequence KRKREAE (SEQ ID NO:1).

[0008] The aforementioned nuclear localization signal AoNLS is an ultrashort sequence of 7 amino acids, a special sequence composed of both basic and acidic amino acid motifs – “KRKREAE”. This sequence can efficiently mediate the nuclear input of exogenous proteins in a non-phosphorylation-dependent manner.

[0009] Secondly, this application provides a fusion protein comprising the nuclear localization signal AoNLS and the target protein described in the first aspect.

[0010] The aforementioned nuclear localization signal AoNLS can serve as a universal nuclear targeting tag, guiding its fused target proteins (such as reporter protein GFP and effector protein Cas9) to efficiently enter the cell nucleus, thereby achieving subcellular localization redirection of the target protein.

[0011] In some embodiments, the target protein is the Cas9 protein or a functional variant thereof.

[0012] By fusing the nuclear localization signal AoNLS with the Cas9 protein, the efficiency of Cas9 protein accumulation in the nucleus of zebrafish embryos can be significantly improved, thereby enhancing its gene editing activity.

[0013] In some embodiments, the amino acid sequence of the fusion protein is shown in SEQ ID NO:2.

[0014] SEQ ID NO:2 is the specific sequence of the fusion protein (Pcs2-AoNLS-Cas9), which significantly improves the editing efficiency of the two target genes Stat3 and Amh in zebrafish embryos compared to the SV40 NLS version.

[0015] Thirdly, this application provides a nucleic acid molecule encoding the nuclear localization signal AoNLS described in the first aspect or the fusion protein described in the second aspect.

[0016] By providing nucleic acid molecules encoding AoNLS and its fusion protein, it is convenient to produce the corresponding protein in the expression system through genetic engineering, or to directly inject it in the form of mRNA via microinjection.

[0017] Fourthly, this application provides a recombinant expression vector comprising the nucleic acid molecules described in the third aspect.

[0018] Recombinant expression vectors enable efficient synthesis of mRNA in in vitro transcription systems or are used for cell transfection to express fusion proteins, providing a basic tool for subsequent functional validation and applications.

[0019] Fifthly, this application provides an enhanced CRISPR / Cas9 gene editing system comprising the fusion protein described in the second aspect, and guide RNA targeting the target gene.

[0020] The CRISPR / Cas9 gene editing system (Pcs2-AoNLS-Cas9) provided in this application fuses the potent nuclear localization signal AoNLS with the Cas9 protein and, in conjunction with the targeting sgRNA, achieves efficient and stable gene editing in zebrafish embryos, with editing efficiency significantly superior to the SV40 NLS version.

[0021] In a sixth aspect, this application provides a method for enhancing the accumulation of a target protein in the nucleus of zebrafish embryonic cells, comprising the step of fusing or chemically coupling the nuclear localization signal AoNLS described in the first aspect with the target protein.

[0022] The above method is a general approach. By fusing AoNLS with the target protein, the accumulation efficiency of the target protein in the zebrafish embryonic cell nucleus can be significantly enhanced. This method is applicable to various target proteins such as reporter proteins and effector proteins.

[0023] The seventh aspect concerns the application of the nuclear localization signal AoNLS described in the first aspect, the fusion protein described in the second aspect, the nucleic acid molecule described in the third aspect, the recombinant expression vector described in the fourth aspect, or the gene editing system described in the fifth aspect in zebrafish embryo gene editing or the preparation of gene editing kits.

[0024] Eighthly, the application of the nuclear localization signal AoNLS described in the first aspect, the fusion protein described in the second aspect, the nucleic acid molecule described in the third aspect, the recombinant expression vector described in the fourth aspect, or the gene editing system described in the fifth aspect in the preparation of gene editing kits.

[0025] Compared with the prior art, this application has at least the following advantages and beneficial effects:

[0026] 1. The nuclear localization signal AoNLS provided in this application is an ultrashort sequence of 7 amino acids, a special sequence "KRKREAE" composed of both basic and acidic amino acid motifs. Verification using a zebrafish embryo in vivo imaging system showed that the fluorescence signal-to-cytoplasm ratio of the AoNLS-mediated EGFP fusion protein reached 2.5±0.5, which is 1.56 times that of the conventional SV40 NLS (1.6±0.5). This result indicates that the acidic enhancement motif unique to AoNLS may synergistically participate in the construction of an efficient nuclear transport interface with the basic core, and its mode of action differs from the single charge-driven mechanism of conventional NLS, achieving a breakthrough improvement in nuclear input efficiency.

[0027] 2. This application fuses the nuclear localization signal AoNLS with the Cas9 protein to construct an enhanced CRISPR / Cas9 gene editing system, Pcs2-AoNLS-Cas9. Editing of the endogenous genes Stat3 and Amh in zebrafish embryos was validated. The results showed that the gene editing efficiency of the Pcs2-AoNLS-Cas9 system was significantly improved by 1.72-fold and 1.82-fold, respectively, compared to the Pcs2-SV40 NLS-Cas9 system fused with SV40 NLS. This improvement is highly consistent with the nuclear input efficiency gain of AoNLS compared to SV40 NLS in the GFP reporter system, strongly demonstrating that the improvement in nuclear input efficiency directly translates into enhanced gene editing function, forming a complete closed loop of evidence from localization to function.

[0028] 3. The AoNLS sequence provided in this application is only 7 amino acids long, yet it achieves a nuclear input efficiency superior to SV40 NLS, exhibiting the characteristic of being "short but highly efficient." This ultrashort sequence has multiple advantages at the evolutionary and functional levels: First, the short coding sequence can reduce the probability of harmful mutations during DNA replication and repair, helping functional elements to be stably preserved during evolution; second, the short NLS can reduce interference with the three-dimensional conformation of proteins, distributing itself on the protein surface in an "embedded" manner without affecting the independent activity of other functional domains; third, the simplified structure reduces the synthesis cost, facilitating its application as a modular element in the development of various genetic engineering tools.

[0029] 4. Unlike existing technologies that commonly use viral NLS (such as SV40 NLS), the AoNLS in this application originates from the endogenous proteome of zebrafish. Its NLS is highly conserved evolutionarily, with its sequence and function optimized through millions of years of natural selection, forming a more stable and efficient fit with the nuclear transport mechanism of host cells. This endogenous origin endows AoNLS with superior nuclear input dynamics in fish embryos, providing a novel solution to overcome the species limitations of viral NLS.

[0030] 5. The Pcs2-AoNLS-Cas9 system, constructed based on AoNLS, achieved efficient and stable gene editing in zebrafish embryos, providing practical technical support for aquaculture breeding and developmental biology research. Through efficient and precise gene editing, breeding cycles can be shortened, R&D costs reduced, and the quality of farmed fish improved. Simultaneously, the improved Cas9 plasmid can be used for breeding more fish species, exploring gene functions, and promoting the development of sustainable aquaculture. Furthermore, AoNLS, as a universal nuclear targeting tag, can be widely applied in reporter protein localization, gene therapy vector construction, and other fields, showing promising industrialization and commercialization prospects. Attached Figure Description

[0031] Figure 1 A schematic diagram of the AoNLS filtering process for core positioning signals.

[0032] Figure 2 The plasmid maps are for Pcs2-GFP, Pcs2-AoNLS-GFP, and Pcs2-SV40 NLS-GFP.

[0033] Figure 3 Subcellular localization of GFP fusion proteins mediated by different nuclear localization signals in zebrafish embryonic cells.

[0034] Figure 4 This is a graph showing the quantitative analysis of the nucleocytoplasmic ratio of fluorescence signals of different NLS-GFP fusion proteins in zebrafish embryonic cells.

[0035] Figure 5 To construct plasmid maps of Pcs2-Cas9, Pcs2-SV40 NLS-Cas9, and Pcs2-AoNLS-Cas9.

[0036] Figure 6 Sanger sequencing peaks for target sites after different Cas9 mRNA treatments.

[0037] Figure 7 A statistical graph showing the gene editing efficiency of different Cas9 treatment groups. Detailed Implementation

[0038] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with embodiments and accompanying drawings. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application.

[0039] The materials used in the following embodiments are not limited to those listed below, and other similar materials may be used instead. Unless otherwise specified, the instruments shall be used under conventional conditions or as recommended by the manufacturer. Those skilled in the art should have relevant knowledge of the use of conventional materials and instruments.

[0040] To better understand this teaching and without limiting its scope, all figures and other numerical values ​​used in the specification and claims to express quantities, percentages, or proportions should, in all cases, be understood to be modified by the term "about." Therefore, unless otherwise stated, the numerical parameters set forth in the following specification and appended claims are approximate values ​​that may vary depending on the desired properties sought. At a minimum, each numerical parameter should be interpreted based at least on the reported significant figures and by applying common rounding techniques.

[0041] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the subject matter of this application pertains. Before providing a detailed description of this application, the following terms and definitions are provided to better understand it.

[0042] 1. Nuclear Localization Signal (NLS): A short peptide sequence present in a protein that can be recognized by nuclear transport receptors and mediate the active transport of the protein from the cytoplasm to the nucleus. Typical NLS are rich in basic amino acids (such as lysine K and arginine R), and their function depends on binding to importin α / β heterodimers.

[0043] 2. AoNLS: The nuclear localization signal defined in this application is an abbreviation for "-originated nuclear localization signal" with the amino acid sequence KRKREAE (SEQ ID NO:1). Its unique acid-enhancing motif and basic core work together to construct an efficient nuclear transport interface.

[0044] 3. Nucleus / Cytoplasm Ratio (N / C Ratio): This refers to the ratio of the average fluorescence intensity of the target protein (such as EGFP fusion protein) in the cell nucleus to the average fluorescence intensity in the cytoplasm. It is used to quantitatively evaluate the nuclear input efficiency of nuclear localization signals. A higher N / C ratio indicates stronger nuclear input efficiency. In this application, the N / C ratio was measured and calculated using ImageJ software.

[0045] 4. Editing Efficiency: In gene editing experiments, the percentage of embryos that underwent gene editing out of the total number of embryos tested. In this application, editing efficiency is determined based on Sanger sequencing peak patterns: if the sequencing peak pattern shows obvious overlapping peaks (overlapping peaks) near the target site, the embryo is considered edit-positive; if it shows a single, clear peak, it is considered edit-negative. Editing efficiency (%) = (Number of edit-positive embryos / Total number of embryos tested) × 100%.

[0046] 5. Pcs2-AoNLS-Cas9: This application describes an enhanced CRISPR / Cas9 gene editing system, characterized by fusing the nuclear localization signal AoNLS (SEQ ID NO:1) with the N-terminus and C-terminus of the Cas9 protein to construct a recombinant plasmid and its expression product.

[0047] 6. SV40 NLS: Refers to the nuclear localization signal derived from the large T antigen of Simian Virus 40, with the classic amino acid sequence PKKKRKV (SEQ ID NO:3). It is currently the most widely studied and applied viral-derived nuclear localization signal. It is used as a control in this application.

[0048] 7. Zebrafish embryo: refers to the embryo or juvenile zebrafish from fertilization to 72 hours after development. In this application, microinjection was performed in 1-cell stage embryos, fluorescence observation was performed 4 hours after injection, and gene editing efficiency was detected 72 hours after injection.

[0049] Based on a systematic screening of endogenous nuclear localization signals in zebrafish, the inventors of this application constructed a 7-amino acid short peptide sequence, KRKREAE (named AoNLS, SEQ ID NO:1), which exhibits excellent nuclear importation activity. This sequence synergistically mediates the nuclear importation of exogenous proteins in a non-phosphorylation-dependent manner, and its nuclear importation efficiency is significantly superior to that of the conventional SV40 NLS.

[0050] Based on the above findings, the inventors further applied AoNLS to the optimization of the CRISPR / Cas9 gene editing system, constructed an enhanced Cas9 fusion protein Pcs2-AoNLS-Cas9 (SEQ ID NO:2) that incorporates AoNLS, and systematically verified its nuclear input efficiency and gene editing function using a zebrafish embryo model.

[0051] Pcs2-AoNLS-Cas9 (SEQ ID NO:2):

[0052]

[0053] The following are specific examples:

[0054] Example 1: Filtering of AoNLS (Area of ​​Nucleus Localization) signals

[0055] This embodiment aims to illustrate the screening process of the nuclear localization signal AoNLS. The screening process is as follows: Figure 1 As shown.

[0056] Based on zebrafish proteome sequencing results (proteome version: Pride: PXD017896), amino acid sequences of highly expressed proteins in the nucleus of 32-cell-stage cells were selected as candidate sequence libraries. These candidate sequences were fragmented into multiple overlapping segments and submitted in batches to the cNLS Mapper online prediction platform for analysis.

[0057] The parameters are set as follows: the exploration cofactor is set to the default value of 0.1, which can be increased as needed to improve the discovery rate (but may introduce noise); single residue filtering is set to no filtering by default; stretch prediction is set to no stretching by default. After submitting the parameterized fragment, the prediction results are obtained, including the fragment sequence and its confidence / probability score.

[0058] A global search was conducted to match similar NLS sequences in the candidate library. Simultaneously, species mapping analysis was performed to compare NLS patterns across species and analyze evolutionary relationships. Ultimately, candidate NLS sequences were obtained, with a particular amino acid sequence, KRKREAE, identified and named AoNLS. Its amino acid sequence is shown in SEQ ID NO:1.

[0059] Example 2: Verification of the kernel input efficiency of the kernel localization signal AoNLS

[0060] This embodiment aims to verify the nuclear input efficiency of the selected nuclear localization signal AoNLS (SEQ ID NO:1) in zebrafish embryos and compare it with the conventional SV40 NLS.

[0061] 1.1 Construction of report plasmids

[0062] Based on the nuclear localization signal AoNLS (amino acid sequence: KRKREAE, SEQ ID NO:1) and the control SV40 NLS (amino acid sequence: PKKKRKV, SEQ ID NO:3) obtained through screening in this application, the corresponding encoding nucleotide sequences were designed and synthesized. These sequences were cloned into the Pcs2-GFP backbone vector, and recombinant reporter plasmids Pcs2-AoNLS-GFP and Pcs2-SV40 NLS-GFP were synthesized and constructed by Wuhan Tianyi Huiyuan Biotechnology Co., Ltd. The empty vector Pcs2-GFP was used as a negative control. All plasmids were verified to be correct by sequencing. Figure 2 As shown.

[0063] 1.2 In vitro transcription and purification of mRNA

[0064] Take 5 μg of each of the correctly constructed plasmids described above and digest them with Not I restriction endonuclease from New England Biolabs at 37 ℃ for 1 hour and 20 minutes to linearize the plasmids. Separate the digestion products by 1% agarose gel electrophoresis, excise the target band, and purify it using an Omega Bio-Tek gel purification kit (catalog number D6492-02). The specific steps are as follows:

[0065] (1) Add 4-5 times the volume of CP buffer to the PCR product or enzyme digestion product, mix well and transfer to the preparation tube, centrifuge at 12000 rpm for 1 min and discard the filtrate; (2) Add 700 μL of DNA wash buffer, centrifuge at 12000 rpm for 1 min and discard the filtrate; (3) Repeat the above steps once; (4) Centrifuge the empty column for 2 min and discard the filtrate; (5) Place the preparation tube in a 1.5 mL centrifuge tube, add 20 μL of DEPC water (which can be preheated), let stand at room temperature for 5 min, and centrifuge at 12000 rpm for 1 min to wash out the DNA; (6) Measure the concentration with a UV spectrophotometer (NanoDrop) and store at -20 ℃ for later use.

[0066] If the electrophoresis bands are not uniform, the target band needs to be excised and recovered using the EZNA® GelExtraction Kit for product purification. The specific steps are as follows:

[0067] (1) Cut the agarose gel containing the target DNA under UV light; (2) Weigh the 2 mL EP tube, put the cut gel into the tube, and calculate the weight of the gel; (3) Dissolve in a 50-60 ℃ water bath for 7-8 min, inject the dissolved gel into a DNA mini column, centrifuge at 10000 rpm for 1 min, and discard the filtrate; (4) Add the corresponding volume of binding buffer (add 100 μL of binding buffer to 100 mg of agarose gel), centrifuge at ≥13000 rpm for 1 min, and discard the filtrate; (5) Add 700 μL of wash buffer, centrifuge at 13000 rpm for 1 min; (6) Repeat step (5) once; (7) Centrifuge the empty column for 2 min, and discard the filtrate; (8) Place the preparation tube in a 1.5 mL centrifuge tube, add 20 μL of DEPC water (which can be preheated), let stand at room temperature for 5 min, and centrifuge at 12000 rpm for 1 min. (9) Elute DNA with a UV spectrophotometer (NanoDrop) and store at -20℃ for later use.

[0068] Using purified linearized DNA as a template, mRNA was synthesized using the Invitrogen SP6 in vitro transcription kit (catalog number AM1340). The reaction mixture consisted of 1 μg of linearized template DNA, 10 μL of 2×NTP / CAP mixture, 2 μL of 10× reaction buffer, 2 μL of SP6 enzyme mixture, and nuclease-free water to a final volume of 20 μL. The reaction mixture was incubated at 37 °C for 2 hours.

[0069] After transcription, mRNA was purified using LiCl precipitation: LiCl was added to a final concentration of 0.7 M and incubated overnight at -20 °C. The next day, the precipitate was centrifuged at 14,000 rpm for 15 minutes at 4 °C, and the supernatant was discarded. The precipitate was resuspended in 800 μL of 70% ethanol and centrifuged at 14,000 rpm for 5 minutes at 4 °C. All liquid was removed by pipetting, and the precipitate was dried at room temperature for 10 minutes. Finally, the precipitate was dissolved in 20 μL of nuclease-free water, and after concentration determination, it was aliquoted and stored at -80 °C for later use.

[0070] 1.3 Microinjection of Zebrafish Embryos

[0071] Adult zebrafish (wild-type, sourced from the Zebrafish Center of the Institute of Hydrobiology, Chinese Academy of Sciences) were raised in a recirculating aquaculture system under the following conditions: water temperature (28.5±0.5)℃, pH around 7.5, and a light / dark cycle of 14h / 10h. The evening before injection, male and female zebrafish were separated by a partition on opposite sides of the same breeding tank and kept in the dark overnight. The partition was removed the following morning, allowing them to mate and spawn naturally. One-cell embryos were collected for microinjection.

[0072] Using a glass capillary tube to draw the injection needle, 0.1 μL of the in vitro transcribed mRNA (concentration adjusted to an appropriate range) was aspirated and injected into the yolk sac of 100 one-cell stage zebrafish embryos under a stereomicroscope. The injection volume for each embryo was approximately 1 nL.

[0073] 1.4 Fluorescence Observation and Image Acquisition

[0074] Embryos injected with EGFP were cultured in a 28°C incubator. After 4 hours of development (cleavage or blastocyst stage), 20 normally developing embryos were randomly selected from each group. EGFP expression and subcellular localization were observed using a fluorescence microscope, and images were acquired. Images of at least 15 cells from each experimental group were randomly collected for subsequent quantitative analysis.

[0075] 1.5 Quantitative analysis of fluorescence signal nucleus-to-mass ratio

[0076] ImageJ software was used to measure the average fluorescence grayscale value and area ratio of the nucleus and the entire cell to obtain the fluorescence intensity value of the nucleus. The measurement result of the entire cell was subtracted from the measurement result of the nucleus to obtain the fluorescence intensity value of the cytoplasm. Finally, the ratio of the nuclear fluorescence intensity to the cytoplasmic fluorescence intensity (nucleocytoplasmic ratio) was used as a quantitative evaluation index of nuclear localization efficiency.

[0077] The formula for calculating the nucleus-to-mass ratio of fluorescence signal is:

[0078] The fluorescence signal nucleo-cytoplasmic ratio = nuclear fluorescence intensity / cytoplasmic fluorescence intensity, where cytoplasmic fluorescence intensity = total cell fluorescence intensity - nuclear fluorescence intensity.

[0079] 1.6 Experimental Results

[0080] 1.6.1 Subcellular localization observation

[0081] Figure 3 Subcellular localization of GFP fusion proteins mediated by different nuclear localization signals in zebrafish embryonic cells is shown in the images from left to right. The images depict the fluorescence microscopy of zebrafish embryonic cells 4 hours after microinjection of Pcs2-GFP (without NLS control), Pcs2-SV40 NLS-GFP, and Pcs2-AoNLS-GFP mRNA. As can be seen from the images, embryos injected with Pcs2-GFP (without NLS control) mRNA exhibit uniform green fluorescence distribution throughout the cell, with no nuclear enrichment. Embryos injected with Pcs2-SV40 NLS-GFP mRNA show some fluorescence signal in the nucleus, but significant fluorescence is still distributed in the cytoplasm. Embryos injected with Pcs2-AoNLS-GFP mRNA show significant green fluorescence enrichment in the nuclear region, indicating that AoNLS can efficiently mediate the entry of EGFP protein into the nucleus.

[0082] 1.6.2 Quantitative analysis of fluorescence signal nucleus-to-mass ratio

[0083] The nucleo-cytoplasmic ratio of fluorescence signals in the three experimental groups was quantitatively analyzed, and the results are shown in Table 1 and 2. Figure 4 As shown in the figure, the nucleo-cytoplasmic ratio of the fluorescence signal in the Pcs2-AoNLS-GFP group was 2.5±0.5, significantly higher than that in the Pcs2-SV40 NLS-GFP group (1.6±0.5, p<0.01, two-tailed t-test), while the nucleo-cytoplasmic ratio of the fluorescence signal in the Pcs2-GFP negative control group was 1.1±0.5. According to the nuclear localization signal intensity grading defined in Table 1, the Pcs2-AoNLS-GFP group was rated as "++" (strong nuclear localization signal), while the Pcs2-SV40NLS-GFP group and the Pcs2-AoNLS2-GFP group were rated as "+" (weak nuclear localization signal), and the Pcs2-GFP group was rated as "-" (no nuclear localization signal). These results indicate that the nuclear input efficiency of AoNLS is approximately 1.56 times that of the conventional SV40 NLS, and its nuclear localization signal intensity is significantly superior to that of the control group.

[0084] Table 1. Nucleoplasmic fluorescence intensity ratio of different NLS-GFP fusion proteins

[0085]

[0086] 1.7 Conclusion

[0087] This embodiment utilizes a GFP fusion reporter system to verify the nuclear input efficiency of the proposed nuclear localization signal AoNLS (KRKREAE) at the in vivo zebrafish embryo level. The results show that AoNLS can efficiently mediate the entry of exogenous proteins into the cell nucleus, with a fluorescence signal-to-nucleocytoma ratio of 2.5±0.5, which is 1.56 times that of the traditional SV40 NLS (1.6±0.5), confirming that AoNLS is a novel nuclear localization signal with superior performance.

[0088] Example 2: Validation of gene editing efficiency of the CRISPR / Cas9 system fused with AoNLS (Pcs2-AoNLS-Cas9)

[0089] This embodiment aims to verify whether fusing AoNLS with the Cas9 protein can significantly enhance the gene editing efficiency of the CRISPR / Cas9 system in zebrafish embryos.

[0090] 2.1 Construction of Pcs2-AoNLS-Cas9 expression vector

[0091] Using the Pcs2-SV40 NLS-Cas9 plasmid (catalog number P0747) purchased from Miaoling Biotechnology Co., Ltd. as the backbone, the original sequence of this plasmid contains SV40 NLS (SEQ ID NO:3). Wuhan Tianyi Huiyuan Biotechnology Co., Ltd. was commissioned to replace the SV40 NLS coding sequences fused at the N-terminus and C-terminus of the original plasmid with the coding sequence of AoNLS (SEQ ID NO:1) of this application using gene synthesis and molecular cloning techniques, thus constructing the recombinant plasmid Pcs2-AoNLS-Cas9. Simultaneously, a control plasmid Pcs2-Cas9 with all NLS sequences removed was constructed. All plasmids were verified to be correct by sequencing. A comparison of the plasmid maps of Pcs2-Cas9, Pcs2-SV40 NLS-Cas9, and Pcs2-AoNLS-Cas9 is shown below. Figure 5 As shown.

[0092] 2.2 In vitro transcription of Cas9 mRNA

[0093] According to Example 2, the Pcs2-Cas9, Pcs2-SV40 NLS-Cas9 and Pcs2-AoNLS-Cas9 plasmids were linearized by Not I restriction enzyme digestion, purified and transcribed in vitro by SP6 to obtain the corresponding Cas9 mRNA. After the concentration was determined, they were aliquoted and stored at -80 ℃ for later use.

[0094] 2.3 Design and in vitro transcription of sgRNA

[0095] This experiment selected two zebrafish endogenous genes as editing targets: Stat3 and Amh. The sgRNA targeting sequences and detection primer sequences for each target are shown in Table 2. When designing the sgRNA forward primer, the T7 promoter sequence was added before the target-specific sequence: GTAATACACTCACTATA (SEQ ID NO:4), followed by the sgRNA backbone sequence: GTTTAGAGCTAGAAATAGC (SEQ ID NO:5). The universal reverse primer sequence is: AAAAGCACCGACTCGGTGCC (SEQ ID NO:6).

[0096] Table 2. sgRNA and detection primer sequences for each target site.

[0097]

[0098] The sgRNA in vitro transcription template was prepared by PCR amplification. Amplification was performed using Kangwei Century's 2×EsTaqMasterMix (containing dye). The reaction system (20 μL) consisted of: 2 μL sgRNA plasmid template (approximately 10 ng / μL), 10 μL 2×EsTaq MasterMix, 1 μL sgRNA forward primer (10 μM), 1 μL sgRNA universal reverse primer (10 μM), and ddH2O to a final volume of 20 μL. PCR amplification conditions were: 95 ℃ pre-denaturation for 2 min; 95 ℃ denaturation for 30 s, 60 ℃ annealing for 10 s, 72 ℃ extension for 60 s, for a total of 35 cycles; and a final extension at 72 ℃ for 10 min. The amplified products were identified by 1% agarose gel electrophoresis. The target band was excised and purified using an Omega Bio-Tek gel purification kit (catalog number D6492-02).

[0099] Using the purified PCR product as a template, sgRNA was synthesized using the Thermo Scientific T7 in vitro transcription kit (catalog number K1991). The reaction mixture consisted of 1 μg template DNA, 4 μL 5× reaction buffer, 2 μL each of ATP / CTP / GTP / UTP mixture, 2 μL T7 enzyme mixture, and nuclease-free water to a final volume of 20 μL. The mixture was incubated at 37 °C for 2 hours. Then, 1 μL of LDNase I was added to digest the template DNA, and the mixture was incubated at 37 °C for 15 minutes. The sgRNA was purified using LiCl precipitation, dissolved in 20 μL of nuclease-free water, and aliquoted and stored at -80 °C for later use.

[0100] 2.4 Preparation of Microinjection Mixtures

[0101] Three types of Cas9 mRNA (Pcs2-Cas9, Pcs2-SV40 NLS-Cas9, and Pcs2-AoNLS-Cas9) were mixed with the sgRNA of each target gene at a 1:1 volume ratio. The final concentration was adjusted with nuclease-free water to ensure that the concentration of both sgRNA and Cas9 mRNA in the injected samples was 200 ng / μL. Each experimental group had three replicates.

[0102] 2.5 Microinjection and Embryo Culture

[0103] Following the method in Example 2, the prepared microinjection mixture was injected into 1-cell stage zebrafish embryos. Approximately 100 embryos were injected into each experimental group. The injected embryos were cultured in a 28 °C incubator for 72 hours (juvenile stage), during which the culture medium was changed daily and dead embryos were removed.

[0104] 2.6 Genomic DNA Extraction and PCR Amplification

[0105] After culturing for 72 hours, 24 normally developing juvenile fish were randomly selected from each group, and each juvenile fish was placed in one well of a 96-well PCR plate. 30 μL of NaOH lysis buffer (2 mg / mL) was added to each well, and the plates were sealed and incubated at 94 ℃ for 30 minutes for lysis. After lysis, the supernatant was collected after brief centrifugation and used as the PCR template.

[0106] PCR amplification was performed using Kangwei Century's 2×Es Taq MasterMix (containing dye, catalog number CW0690M). The reaction mixture (20 μL) consisted of: 2 μL DNA lysis buffer, 10 μL 2×Es Taq MasterMix, 1 μL Forward primer (10 μM) for the corresponding target gene, 1 μL Reverse primer (10 μM), and 6 μL ddH2O. PCR amplification conditions were: 95 ℃ pre-denaturation for 2 minutes; 95 ℃ denaturation for 30 seconds, 60 ℃ annealing for 30 seconds, and 72 ℃ extension for 60 seconds, for a total of 35 cycles; and a final extension at 72 ℃ for 10 minutes. The amplified products were characterized by band specificity by 1.5% agarose gel electrophoresis.

[0107] 2.7 Sanger Sequencing and Editing Efficiency Analysis

[0108] The PCR amplification products were sent to Wuhan Tianyi Huiyuan Biotechnology Co., Ltd. for Sanger sequencing. The sequencing results were opened using SnapGene or Chromas software to observe the peak patterns near the target site (sgRNA target region). The interpretation criteria for the sequencing peak patterns are as follows:

[0109] Edit positive: There are obvious overlapping peaks (double peaks) near the target point, and the peak height is similar to the main peak or forms a continuous double peak region;

[0110] Negative result: The target area shows a single, clear peak with no overlapping peaks.

[0111] Gene editing efficiency is expressed as the percentage of edited positive embryos out of the total number of embryos tested in the group. The formula is: Editing efficiency (%) = (Number of edited positive embryos / Total number of embryos tested) × 100%. Data from at least 20 embryos in each group are collected, and the mean and standard deviation are calculated.

[0112] 2.8 Experimental Results

[0113] 2.8.1 Sanger Sequencing Peak Diagram Analysis

[0114] Sanger sequencing was performed on the PCR products of the two target genes (Stat3 and Amh). Representative sequencing peaks are shown in the figure below. Figure 6As shown in the figure. The results showed that in embryos injected with Pcs2-Cas9 (without NLS control) mRNA, all sequencing results showed a single, clear peak near the target site, indicating that no effective editing occurred. In embryos injected with Pcs2-SV40 NLS-Cas9 (SV40 NLS) mRNA, some individuals showed superimposed peaks near the target site, indicating gene editing, but a considerable proportion of individuals still showed a single peak. In embryos injected with Pcs2-AoNLS-Cas9 (this application) mRNA, the sequencing results of the vast majority of individuals showed obvious superimposed peaks near the target site, and the signal intensity of the double peaks was comparable to that of the main peak, indicating that gene editing events occurred frequently and to a high degree.

[0115] 2.8.2 Gene Editing Efficiency Statistics

[0116] The editing efficiency of the two target genes in two independent experiments was statistically analyzed, and the results are shown in Table 3 and 4. Figure 7 As shown.

[0117] Table 3. Analysis of the percentage knockout efficiency of different Cas9 proteins in different genes.

[0118]

[0119] The above results indicate that:

[0120] (1) In the group of embryos injected with Pcs2-Cas9 (without NLS control), all sequencing results showed a single clear peak and the editing positivity rate was extremely low (0% for Stat3 and 4.17% and 16.7% for Amh in two experiments, respectively), confirming that the presence of NLS is crucial for Cas9 protein to enter the cell nucleus and perform editing function.

[0121] (2) In the embryo group injected with Pcs2-AoNLS-Cas9 (this application), the vast majority of sequencing results showed obvious superposition peaks near the target site. The editing efficiencies in the two independent experiments were 60% and 69% for the Stat3 gene, and 70.8% and 75% for the Amh gene, respectively. The positive editing rate was significantly increased by approximately 1.72 times and 1.82 times compared with the Pcs2-SV40 NLS-Cas9 group, respectively. Figure 7 (See Table 3). This improvement is highly consistent with the nuclear input efficiency gain of AoNLS compared to SV40 NLS in the GFP reporter system in Example 2.

[0122] 2.9 Conclusion

[0123] This embodiment successfully constructed an enhanced CRISPR / Cas9 system, Pcs2-AoNLS-Cas9, incorporating the nuclear localization signal AoNLS of this application, and validated its editing efficiency for two endogenous genes in zebrafish embryos. The results showed that at the target sites of the two different genes, the gene editing efficiency of the Pcs2-AoNLS-Cas9 system was significantly improved by approximately 1.72-fold and 1.82-fold compared to the Pcs2-SV40 NLS-Cas9 system fused with SV40 NLS (editing efficiency approximately 35%-50%), respectively. This improvement is highly consistent with the nuclear input efficiency gain of AoNLS compared to SV40 NLS in the GFP reporter system in Example 2, strongly demonstrating that the enhanced nuclear input efficiency mediated by AoNLS directly translates into enhanced gene editing function of the CRISPR / Cas9 system in zebrafish embryos.

[0124] The AoNLS-containing fusion protein Pcs2-AoNLS-Cas9 constructed based on the above embodiments exhibited highly efficient and stable gene editing capabilities in zebrafish embryos. Its editing efficiency for the two endogenous genes Stat3 and Amh was significantly improved by 1.72 times and 1.82 times, respectively, compared to the traditional SV40NLS version. Therefore, the nuclear localization signal AoNLS, the fusion protein containing it, the encoding nucleic acid, the recombinant expression vector, and the CRISPR / Cas9 gene editing system described in this application can be applied to gene editing in zebrafish embryos, and to the preparation of kits for gene editing in zebrafish embryos.

[0125] The present application has been described in detail above. Specific examples have been used to illustrate the principles and implementation methods of the present application. The descriptions of the embodiments above are only for the purpose of helping to understand the present application and its core ideas. It should be noted that those skilled in the art can make several improvements and modifications to the present application without departing from the principles of the present application, and these improvements and modifications also fall within the protection scope of the claims of the present application.

Claims

1. The nuclear localization signal AoNLS, which is derived from the zebrafish proteome, has the amino acid sequence shown in SEQ ID NO:

1.

2. A fusion protein comprising the nuclear localization signal AoNLS as described in claim 1 and a target protein.

3. The fusion protein according to claim 2, wherein it is a Cas9 protein or a functional variant thereof.

4. The fusion protein according to claim 3, wherein the amino acid sequence is shown in SEQ ID NO:

2.

5. A nucleic acid molecule encoding the nuclear localization signal AoNLS as described in claim 1 or the fusion protein as described in any one of claims 2-4.

6. A recombinant expression vector comprising the nucleic acid molecule of claim 5.

7. An enhanced CRISPR / Cas9 gene editing system comprising the fusion protein of any one of claims 2-4, and a guide RNA targeting a target gene.

8. A method for enhancing the accumulation of a target protein in the nucleus of zebrafish embryonic cells, comprising the step of fusing or chemically coupling the nuclear localization signal AoNLS of claim 1 with the target protein.

9. The application of the nuclear localization signal AoNLS of claim 1, the fusion protein of any one of claims 2-4, the nucleic acid molecule of claim 5, the recombinant expression vector of claim 6, or the gene editing system of claim 6 in zebrafish embryo gene editing or the preparation of gene editing kits.

10. The use of the nuclear localization signal AoNLS of claim 1, the fusion protein of any one of claims 2-4, the nucleic acid molecule of claim 5, the recombinant expression vector of claim 6, or the gene editing system of claim 6 in the preparation of a gene editing kit.