Recombinant pichia pastoris genetically engineered bacteria with high yield of lactoferrin and construction method and application thereof

Abstract

The application discloses a recombinant Pichia pastoris genetic engineering bacterium with high yield of lactoferrin, and simultaneously satisfies the following three modifications: overexpression of a bovine lactoferrin expression gene, mutation of an alpha mating factor signal peptide at position E86 to F, and overexpression of a PDI molecular chaperone gene. The application also discloses a construction method of the recombinant Pichia pastoris genetic engineering bacterium, and application of the recombinant Pichia pastoris genetic engineering bacterium in production of bovine lactoferrin. The 5L fermenter test result of the bacterium strain shows that the yield of exogenous protein is significantly improved, and is increased from 10.04 mg / L in a flask fermentation to 95.78 mg / L, nearly 10 times. The application is based on the Pichia pastoris system and is not related to complex culture condition change, and is low in cost and easy to enlarge. The method is not only suitable for production of bovine lactoferrin, but also provides a new modification idea for high-efficiency expression of other heterologous proteins in the yeast system.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering and fermentation engineering technology, specifically relating to a recombinant Pichia pastoris genetically engineered strain that produces high levels of lactoferrin, its construction method, and its application. Background Technology

[0002] Lactoferrin is a non-heme iron-binding glycoprotein widely found in the milk of mammals. Besides milk, it is also widely distributed in secretions such as saliva, tears, bile, pancreatic juice, and intestinal juice. Currently, commercially available lactoferrin is mainly extracted from bovine milk. Although colostrum has the highest lactoferrin content, colostrum resources are scarce, and the extraction and separation process is cumbersome and costly, placing enormous pressure on large-scale production. Therefore, solving the supply and cost issues of lactoferrin is of significant practical importance.

[0003] Pichia pastoris is one of the most commonly used hosts for recombinant protein secretion expression. It possesses numerous advantages, including low culture costs, a clear genetic background, and complete post-translational modifications, and has long been widely used as a cellular factory for synthesizing various important proteins. Although thousands of exogenous proteins have been successfully expressed in Pichia pastoris, the expression levels of different exogenous proteins vary significantly. For example, in Pichia pastoris, the expression level of human serum albumin can reach as high as 11 g / L, while the expression level of hamster prions is less than 0.1 mg / L. Therefore, improving Pichia pastoris expression elements has become a crucial step in advancing the Pichia pastoris expression system into a powerful tool for exogenous protein expression. Summary of the Invention

[0004] This invention addresses the shortcomings of existing technologies by providing a recombinant Pichia pastoris genetically engineered strain that produces high levels of lactoferrin, along with its construction method and applications.

[0005] To achieve the above objectives, the present invention adopts the following technical solution: A recombinant Pichia pastoris genetically engineered strain that produces high levels of lactoferrin, wherein the Pichia pastoris genetically engineered strain simultaneously satisfies the following three modifications: Overexpression of the bovine lactoferrin expression gene, wherein the NCBI accession number for the bovine lactoferrin cDNA is L08604.1. The α-mating factor signal peptide E86 position is mutated to F. Overexpression of the PDI molecular chaperone gene.

[0006] A method for constructing the recombinant Pichia pastoris genetically engineered strain includes the following steps: Step 1: After codon optimization based on yeast codon preference, a plasmid pY26-BLF containing the bovine lactoferrin expression gene was synthesized. Using 9K-BLF-1 and 9K-BLF-2 as primers and pY26-BLF as a template, the target gene fragment was obtained by PCR. Using 9K-1 and 9K-2 as primers and pPIC9K as a template, the vector fragment was obtained by PCR. The recovered target gene fragment and vector fragment were ligated using a seamless cloning enzyme. After ligation, the cells were transformed into competent cloning host cells. Colony PCR and sequencing were performed using primers 9K-BLF-JP-1 and 9K-BLF-JP-2 to verify that the correctly constructed single-clone colonies contained the successfully constructed recombinant plasmid pPIC9K-BLF. The sequences of 9K-BLF-JP-1 and 9K-BLF-JP-2 are as follows: 9K-BLF-JP-1:CAGCACAAATAACGGGTTATTG, 9K-BLF-JP-2: GACAATAGCTTCCAGATTAAATCTTC; Step 2: Using a86F-1 and a86F-2 as primers and recombinant plasmid pPIC9K-BLF as template, PCR amplification was performed. After purification and recovery of the PCR product, it was directly introduced into the cloning host competent cells. Colony PCR and sequencing were performed using primers a86F-1 and a86F-2 to verify the colony. The verified single colony contained the successfully constructed recombinant plasmid pPIC9K-BLF-F86 with the α-mating factor signal peptide E86 position mutated to F. The sequences of a86F-1 and a86F-2 are as follows: a86F-1: GAAGCTATGCATCATCATCATCATCATGAGAATCTATATTTC; a86F-2:GATGATGATGCATAGCTTCAGCTTTTCTTTCTC; Step 3: The recombinant plasmid pPIC9K-BLF-F86 was introduced into Pichia pastoris, and colony PCR was performed using primers 9K-BLF-JP-1 and 9K-BLF-JP-2 to verify the correct strain, which was Pichia pastoris strain BLF-F86. Step 4: Using GAPZ-1 and GAPZ-2 as primers and pGAPZ A vector as a template, PCR amplification was performed, and the recovered product was used as the vector fragment. Using PDI-1 and PDI-2 as primers and Pichia pastoris KM71 strain genomic DNA as a template, the gene DNA fragment encoding the molecular chaperone protein PDI was amplified by PCR. The gene DNA fragment encoding the molecular chaperone protein PDI and the vector fragment were ligated, and the ligated cells were transformed into competent cells of the cloning host. Colony PCR verification was performed using primers PDI-1 and PDI-2, and sequencing verification was performed. The verified single-clone colonies contained the successfully constructed recombinant plasmid pGAPZ A-PDI. The sequences of GAPZ-1 and GAPZ-2, PDI-1 and PDI-2 are as follows: GAPZ-1:GAATTCACGTGGCCCAGCCGGCCGTCT, GAPZ-2:ATAGTTGTTCAATTGATTGAAATAGGGACAAATAAA, PDI-1: AATCAATTGAACAACTATATGCAATTCAACTGGAATATTAAAACTGTGGC, PDI-2:GCTGGGCCACGTGAATTCTTAAAGCTCGTCGTGAGCGTCTG; Step 6: Introduce the recombinant plasmid pGAPZ A-PDI into competent cells of Pichia pastoris strain BLF-F86; use primers PDI-1 and PDI-2 to perform colony PCR verification, and the correct strain is Pichia pastoris strain BLF-E86F-PDI.

[0007] The application of the recombinant Pichia pastoris genetically engineered strain in the production of bovine lactoferrin.

[0008] A method for preparing bovine lactoferrin, comprising fermentation using the Pichia pastoris strain BLF-E86F-PDI as described in claim 1.

[0009] The method for preparing bovine lactoferrin, and the fermentation method of the Pichia pastoris BLF-E86F-PDI strain, are as follows: Add inorganic salt culture medium (BSM) to the fermenter along with an antifoaming agent. After sterilization, remove the fermenter, connect the air pump and cooling water circulation, and cool to 28-30 °C. Adjust the pH to 4.5-5.5 with ammonia. Inoculate the Pichia pastoris BLF-E86F-PDI strain seed culture into the fermenter and begin fermentation. The fermentation conditions are controlled as follows: (a) During the 0-16 h cell growth phase, the stirring speed and dissolved oxygen were correlated, and the dissolved oxygen was controlled to be greater than 30%. (b) During the 17-21h cell growth phase, after the glycerol in the BSM medium is depleted, 50-55% glycerol is added once the dissolved oxygen level rises to 80%. Glycerol is added at a constant rate of 18-22 mL / L / h for 4.5-5.5 h. (c) During the starvation phase, dissolved oxygen began to rise after glycerol supplementation was stopped. Timing began when dissolved oxygen rose to 60%, and the bacteria were starved for 1 hour. (d) During the methanol adaptation phase, First, add methanol at a flow rate of 0.01-0.02 mL / min / L for 0.5-1.5 h to allow the bacteria to adapt to methanol. Then increase the flow rate to 0.03-0.4 mL / min / L and continue adding methanol for 1.5-2.5 h. Then increase the flow rate to 0.04-0.06 mL / min / L and continue adding methanol for 2.5-3.5 h. Then increase the flow rate to 0.06-0.08 mL / min / L and continue adding methanol for 3.5-4.5 h. Finally, increase the flow rate to 0.08-0.09 mL / min / L and continue adding methanol for 4.5-5.5 h to allow the cells to fully adapt to the methanol. (e) During the methanol-induced fermentation stage, the cell fermentation was carried out at a methanol feeding rate of 0.8-1.2 mL / min / L. After the fermentation was completed, the fermentation broth was collected and separated and purified to obtain bovine lactoferrin.

[0010] The Pichia pastoris BLF-E86F-PDI strain seed culture is a secondary seed culture, prepared as follows: The primary seed culture is transferred at a 2% inoculation rate to 100 mL of YPD liquid medium and cultured at 30 ℃ and 220 rpm until OD600 = 20-30, which serves as the secondary seed culture. The primary seed culture is prepared as follows: A single loopful of Pichia pastoris BLF-E86F-PDI strain from a YPD plate is inoculated into 10 mL of liquid YPD medium and cultured overnight at 30 ℃ and 220 rpm for 12-16 hours, which serves as the primary seed culture.

[0011] Compared with the prior art, the present invention has the following beneficial effects: 1. Significantly improved the secretory expression level of bovine lactoferrin. Based on the characteristics of bovine lactoferrin, this invention optimized and modified the signal peptide of Pichia pastoris. The modified signal peptide can more efficiently guide nascent peptide chains into the endoplasmic reticulum for translocation, overcoming the first rate-limiting step in the protein secretion pathway and improving expression efficiency from the initial stage of translation.

[0012] 2. This invention alleviates endoplasmic reticulum stress in yeast cells and optimizes the protein folding environment. Building upon signal peptide optimization, this invention further overexpresses the key molecular chaperone PDI in yeast chassis cells. The overexpressed chaperone assists the target protein entering the endoplasmic reticulum in proper folding, reducing the unfolded protein response caused by excessive protein expression, thereby lowering the degradation rate of the target protein and avoiding growth inhibition caused by cellular stress.

[0013] 3. Significant synergistic effects were observed. This invention creatively combines signal peptide optimization with molecular chaperone overexpression. This combined strategy simultaneously addresses the two core bottlenecks in protein secretion pathways: transport and processing. Experimental results show that the yield increase achieved through single-method modification is limited, while the combined modification scheme of this invention resulted in a significantly, non-additive, increase in bovine lactoferrin yield, indicating a synergistic effect between the two.

[0014] 4. It possesses good versatility and promising industrial application prospects. This invention is based on the modification of the Pichia pastoris system, does not involve complex changes to culture conditions, is low in cost, and is easy to scale up. This method is not only applicable to the production of bovine lactoferrin, but also provides a new approach for the efficient expression of other heterologous proteins in yeast systems. Attached Figure Description

[0015] Figure 1 This is a schematic diagram of the recombinant plasmid pPIC9K-BLF.

[0016] Figure 2 The image shows the colony PCR results of Pichia pastoris strain KM71-pPIC9K-BLF. M is DNA marker DL5000, and its brightest band is 1000 bp; Clones 1-8 are selected suspected positive clones.

[0017] Figure 3 This is an SDS-PAGE validation image of bovine lactoferrin induced by Pichia pastoris strain KM71-pPIC9K-BLF. In the image, C: Standard bovine lactoferrin; M: Protein Marker; 1-5: Supernatant of fermentation products from Pichia pastoris strain KM71-9K after 48, 72, 96, 120, and 148 hours, respectively; 6-7: Supernatants of fermentation products from Pichia pastoris strain KM71-pPIC9K-BLF after fermentation for 48, 72, 96, 120, and 148 hours, respectively.

[0018] Figure 4ELISA results of bovine lactoferrin expression in Pichia pastoris KM71-pPIC9K-BLF strain at different fermentation times.

[0019] Figure 5 A schematic diagram illustrating the construction of the lactoferrin fusion protein.

[0020] Figure 6 OD of fermentation suspensions after shake-flask fermentation of different strains 600 The graph shows the changes in fluorescence value and intensity over time. A: Pichia pastoris strain KM71-pPIC9K-BLF; B: Fusion protein strains using TPTP as a linker; C: Fusion protein strains using EA3K as a linker; D: Fusion protein strains using GS as a linker; E: Fusion protein strain using GSG as a linker; F: A fusion protein strain using G4S as a linker; G: Fusion protein strain using (GSG)2 as a linker; H: Fusion protein strain using (TPTP)2 as a linker.

[0021] Figure 7 This is a fluorescence microscope image of the Pichia pastoris strain KM71-pPIC9K-BLF-TP2. In the image, A was taken under bright field conditions; B was taken under green fluorescence excitation conditions.

[0022] Figure 8 To remove P AOX1 After shake-flask fermentation of strains with promoters at positions -777 to -712, the OD of the fermentation supernatant was... 600 Changes in fluorescence value and fluorescence intensity with fermentation time; Figure 9 To increase P AOX1 After shake-flask fermentation of strains with cis-acting elements at promoter positions 190-230, the OD of the fermentation supernatant was measured. 600 Changes in fluorescence value and intensity with fermentation time; Figure 10 This figure compares the strongest fluorescence intensity of the promoter-modified strain with that of the unmodified strain. 9K is the Pichia pastoris strain KM71-pPIC9K. AOX is the Pichia pastoris strain KM71-pPIC9K-BLF-TP2. AOX - for removing P AOX1 Strains with promoters at positions -777 to -712, AOX+ increases P AOX1 Strains with cis-acting elements at positions 190-230 of the promoter.

[0023] Figure 11 Changes in fluorescence intensity in strains to remove amino acids from positions 57 to 70 of the α-mating factor signal peptide; Figure 12 The change in fluorescence intensity of strains with 10 artificial amino acid sequences added to the C-terminus of the α-mating factor signal peptide; Figure 13 This is a comparison of the strongest fluorescence intensity of various strains after saturation mutation of the α-mating factor signal peptide at position E86. The code 9K refers to the Pichia pastoris strain KM71-pPIC9K-BLF-TP2, and each of the remaining letters is a single-letter code for 20 standard amino acids, representing the α-mating factor signal peptide E86 mutation to the corresponding amino acid.

[0024] Figure 14 The graph shows the changes in fluorescence intensity of whole cells of each bacterial strain. In the figure, the horizontal axis represents the fluorescence intensity of each strain. The strain designated TP2 is Pichia pastoris KM71-pPIC9K-BLF-TP2 (prepared in Example 2). The strain designated 9K-BLF is Pichia pastoris KM71-pPIC9K-BLF (prepared in Example 1). The code name PDi is Pichia pastoris strain KM71-BLF-TP2-E86F-PDI. The strain HAC is Pichia pastoris KM71-BLF-TP2-E86F-HAC. BiP is the Pichia pastoris strain KM71-BLF-TP2-E86F-Bip. The code name ERO is Pichia pastoris strain KM71-BLF-TP2-E86F-ERO. The five columns corresponding to each strain, from left to right, represent sample data at fermentation times of 24, 48, 72, 96, and 120 h.

[0025] Figure 15 The fluorescence intensity changes of the fermentation product supernatant for each strain are shown. The x-axis represents the fluorescence intensity changes of the supernatant. Figure 14 same.

[0026] Figure 16 This is the standard curve for HIS-TAG ELISA.

[0027] Figure 17 The image shows the HIS-TAG ELISA results of bovine lactoferrin expression in the modified strain with enhanced fluorescence. (Figure 1) The code name KM71-TP2 is Pichia pastoris KM71-pPIC9K-BLF-TP2 (prepared in Example 2, with a sampling time of 72 h); The strain α10 is a modified strain with 10 amino acids added between the α-mating factor signal peptide and the recombinant protein sequence (prepared in Example 4, with a sampling time of 24 h). E86Q is a modified strain with the α-mating factor signal peptide mutated to Q at position E86 (prepared in Example 4, sampling time 24 h). E86F is a modified strain with the α-mating factor signal peptide mutated to F at position E86 (prepared in Example 4, sampling time 24 h). The PDI strain was Pichia pastoris KM71-TP2-E86F-PDI (prepared in Example 5, with a sampling time of 120 h).

[0028] Figure 18 This graph shows the change in bovine lactoferrin expression over time during fermentation of Pichia pastoris strain KM71-TP2-E86F-PDI in a tank. (Detailed implementation method) The technical solution of the present invention will be further illustrated below through embodiments.

[0029] I. Strains, plasmids, culture media and reagents The plasmid pY26-BLF containing the bovine lactoferrin expression gene was synthesized by Sangon Biotech (Shanghai) Co., Ltd. after codon optimization based on yeast codon preferences.

[0030] The plasmid pY26-eGFP was preserved in our laboratory.

[0031] The Pichia pastoris KM71 strain, pPIC9K vector, and pGAPZ A vector were kindly provided by Associate Professor Liu Song of Jiangnan University.

[0032] In the specific embodiments of this invention, the cloning hosts are all Escherichia coli strains. E. coli JM109 is kept in this laboratory.

[0033] LB medium: 5 g yeast extract, 10 g tryptone, and 10 g sodium chloride were dissolved in 800 mL of distilled water and brought to a final volume of 1 L. The mixture was then sterilized at 121 °C for 20 min.

[0034] Ampicillin sodium stock solution: Dissolve 1 g of ampicillin sodium in 10 mL of water, filter to sterilize, and dispense for later use.

[0035] YPD medium: Dissolve 10g yeast extract and 20g peptone in 900mL distilled water and sterilize at 121℃ for 20min to obtain solution A; dissolve 200g glucose in 100mL distilled water and sterilize at 115℃ for 15min to obtain solution B; before use, take 90mL of solution A and add 10mL of solution B to obtain YPD medium.

[0036] MD selective medium: Agar 20 g / L, sterilized at 121℃ for 20 min. After the temperature drops to about 60℃, add 10 mL of 10×YNB (13.4 g / L), 100 mL of 10×glucose (20 g / L), and 500×biotin (4×10⁻⁶) to the clean bench. -4 Mix 2 mL of the solution (g / L) thoroughly.

[0037] G418 gradient medium: G418 was added to YPD solid medium to final concentrations of 1, 2, 3, and 4 mm / mL to serve as a multicopy selection medium.

[0038] BMMY medium: yeast extract 10 g / L, peptone 20 g / L, K2HPO4 3 g / L, KH2PO4 11.8 g / L, add water to 895 mL, sterilize at 121 ℃ for 20 minutes, then after the temperature drops to 60 ℃, add 100×YNB 100 mL (13.4 g / L) and 500×Biotin 1 mL (4×10⁻⁶) on a clean bench. -4 g / L), 5 mL of methanol.

[0039] Bleomycin selection medium: Add bleomycin to YPD solid medium to a final concentration of 50 μg / mL.

[0040] PCR product purification kit, plasmid miniprep kit E. coli The competent cell preparation kit, seamless cloning enzyme, and yeast DNA extraction kit were all purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0041] Quickcut Dpn Ⅰ. Quickcut Sal I. All items were purchased from TAKARA.

[0042] High-fidelity DNA polymerase Mix and regular PCR amplification enzyme Mix were both purchased from Novizan.

[0043] The blunt end ligation kit was purchased from TAKARA.

[0044] Avr II enzyme was purchased from Thermo Fisher.

[0045] Unless otherwise specified, all reagents used in this invention are of analytical grade.

[0046] II. Experimental Methods Preparation and transformation of S1 clone host competent cells S1.1 Method for preparing cloning host competent cells Reference E. coli E. coli The preparation of JM109 competent cells was performed using a kit (Sangon Biotech (Shanghai) Co., Ltd.).

[0047] S1.2 Transformation Methods of Cloning Hosts The recombinant plasmid was introduced into E. coli. E. coli After JM109 competent cells were collected, they were placed on ice for 30 min, then heat-shocked at 42°C for 90 s, and then placed on ice for 5 min. Immediately afterward, 900 mL of antibiotic-free LB liquid medium was added. The cells were then recovered at 37°C and 220 rpm for 40 min. Finally, the cells were plated on ampicillin-resistant LB plates and cultured at 37°C for 12-14 h.

[0048] Preparation and transformation of S2 Pichia pastoris competent cells S2.1 Method for preparing Pichia pastoris competent cells (1) Pick a single colony of Pichia pastoris and inoculate it into 10 mL of YPD medium. Incubate overnight at 30°C and 220 rpm.

[0049] (2) The seed culture after overnight culture was transferred to 100 mL of YPD liquid medium at an inoculation rate of 1%, and cultured at 30℃ and 220 rpm until OD. 600 =1.3-1.5.

[0050] (3) Centrifuge at 5000 rpm for 5 min at 4 ℃ and discard the supernatant.

[0051] (4) Resuspend the bacteria in 100 mL of ice-cooled sterile water.

[0052] (5) Centrifuge at 5000 rpm for 5 min at 4 ℃ and discard the supernatant.

[0053] (6) Resuspend the bacteria in 50 mL of ice-cooled sterile water.

[0054] (7) Centrifuge at 5000 rpm for 5 min at 4 ℃ and discard the supernatant.

[0055] (8) Wash the bacterial cells once with 20 mL of 1 mol / L sorbitol.

[0056] (9) The cells were resuspended in 200 μL of 1 mol / L ice-cold sorbitol and dispensed into sterile pre-cold EP tubes, 80 μL per tube, to obtain competent Pichia pastoris cells for transformation.

[0057] S2.2 Transformation method of Pichia pastoris competent cells Add 1-5 μg of Quickcut to 80 μl of Pichia pastoris competent cells. Sal Ⅰ. After the recombinant plasmid is linearized by enzyme digestion, place it on ice for 15 min, then quickly add it to a 0.2 cm electroporation cuvette (pre-cooled on ice), electroporate, and immediately add 1 mL of 1 mol / L sorbitol after electroporation. Spread the solution onto the corresponding screening plate and incubate at 30 ℃ for 2-4 days until single colonies grow.

[0058] S3 Pichia pastoris induction expression method Streak the strain on YPD agar plates and incubate at 30 °C for 2-4 days until single colonies appear. Pick a single colony and inoculate it into 50 mL of YPD medium. Incubate at 30 °C and 220 rpm for 24 h. Then centrifuge and discard the supernatant. Collect the bacterial cells and resuspend them in an equal volume of BMMY medium. Incubate at 30 °C and 220 rpm, while adding 1% methanol for induction.

[0059] Example 1 1.1 The primers and sequences used in this embodiment are shown in Table 1.

[0060] Table 1 Primers and sequences used in Example 1

[0061] 1.2 Ligation of the target gene fragment and the vector fragment Using 9K-BLF-1 and 9K-BLF-2 as primers and pY26-BLF as a template, high-fidelity polymerase was used to perform PCR to obtain the target gene fragment.

[0062] Using 9K-1 and 9K-2 as primers and pPIC9K as a template, high-fidelity polymerase was used to perform PCR to obtain the vector fragment.

[0063] After the two separate PCR reactions were completed, 1 μL of PCR product was added to 50 μL of PCR product. Dpn I restriction endonuclease was incubated at 37 ºC for 2 h to eliminate the template. Then, it was heated at 85 ºC for 10 min to inactivate the enzyme. Dpn I. Finally, the PCR products are recovered using a PCR product recovery kit. The specific procedure should be performed according to the instructions of the PCR product purification kit.

[0064] The recovered target gene fragment and vector fragment were diluted to a certain concentration according to size, and then ligated using a seamless cloning enzyme to obtain the ligated recombinant plasmid pPIC9K-BLF. The specific ligation method was carried out in accordance with the seamless cloning enzyme instructions of Sangon Biotech (Shanghai) Co., Ltd.

[0065] 1.3 Preparation and transformation of cloning host competent cells The recombinant plasmid pPIC9K-BLF obtained in step 1.2 was introduced into the cloning host competent cells according to the method described in S1.

[0066] 1.4 PCR and sequencing verification of the transformed strain from the cloning host Positive clones from ampicillin-resistant LB agar plates were selected and colony PCR was performed using primers 9K-BLF-JP-1 and 9K-BLF-JP-2 for verification. The positive clones that passed colony PCR verification were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. Sequencing results showed that the coding sequence of the recombinant plasmid contained in this clone was completely identical to the designed bovine lactoferrin gene, confirming that the correct plasmid was pPIC9K-BLF.

[0067] The spectrum of the recombinant plasmid pPIC9K-BLF is as follows: Figure 1 As shown. By Figure 1 It is evident that a 6-terminus molecule was introduced at the N-terminus of bovine lactoferrin. The HIS tag facilitates subsequent quantification and purification. Simultaneously, the signal peptide sequence of bovine lactoferrin itself was removed, and the α-mating factor signal peptide sequence from the pPIC9K vector was used.

[0068] 1.5 Preparation and transformation of Pichia pastoris competent cells Following the method described in S2, the recombinant plasmid pPIC9K-BLF was introduced into Pichia pastoris KM71 competent cells and screened with kanamycin.

[0069] 1.6 PCR Validation of Pichia pastoris KM71 Transformed Strains Positive clones from kanamycin-resistant plates were selected and colony PCR was performed using primers 9K-BLF-JP-1 and 9K-BLF-JP-2. The colony PCR results are shown in [link to results]. Figure 2 ,Depend on Figure 2 It can be seen that, since one primer for the colony PCR is located on the α-mating factor and the other on the bovine lactoferrin gene, and the product length is approximately 900 bp, it can be determined that strains 3-8 were successfully introduced. The correctly verified strain was named Pichia pastoris KM71-pPIC9K-BLF.

[0070] 1.7 Induced Expression Following the method described in S3, Pichia pastoris strains KM71-pPIC9K-BLF and KM71-9K were induced to express the product. The supernatant of the fermentation product was sampled every 24 h, and each sample was verified by SDS-PAGE and quantified by ELISA.

[0071] Following the method in S2, the plasmid pPIC9K was introduced into the Pichia pastoris KM71 strain. The strain that was correctly verified by PCR was the Pichia pastoris KM71-9K strain.

[0072] 1.8 SDS-PAGE Validation Methods and Results SDS-PAGE of the fermentation product supernatant was performed using a 10% precast gel at 120 V for approximately 1.5 h, followed by Coomassie Brilliant Blue R250 staining. The SDS-PAGE verification results are shown below. Figure 3 As shown. By Figure 3 It is evident that after methanol induction, the bands near the target band size of the Pichia pastoris KM71-pPIC9K-BLF strain significantly thickened with prolonged fermentation time.

[0073] 1.9 ELISA Quantitative Methods and Results The supernatant of the fermentation product of Pichia pastoris strain KM71-pPIC9K-BLF was used for ELISA quantification. A standard curve was prepared according to the instructions, and the sample content was determined. The concentration was expressed as his-tag molar concentration and then converted to an equimolar BLF mass concentration. The results are as follows: Figure 4 As shown. By Figure 4 It can be seen that after fermentation for 148 h, the concentration of bovine lactoferrin in the supernatant of the fermentation product of Pichia pastoris KM71-pPIC9K-BLF strain was about 4.5 mg / L. Although the expression level was low, it was higher than the baseline shake flask yield of Sun et al.

[0074] Example 2 2.1 Fusion protein BLF-linker-eGFP Because ELISA kits are expensive and time-consuming for quantitative analysis, lactoferrin is fused with green fluorescent protein (eGFP) via a linker to express it as a fusion protein. This allows for a rapid preliminary assessment of product yield by measuring fluorescence intensity.

[0075] The green fluorescent protein (GFP) gene is linked to the C-terminus of the lactoferrin gene via a linker, fusing bovine lactoferrin and GFP together to form a fusion protein, BLF-linker-eGFP. A schematic diagram of the BLF-linker-eGFP fusion protein combination is shown below. Figure 5The N-terminus of the fusion protein BLF-linker-eGFP is lactoferrin, and the C-terminus is linked to green fluorescent protein via a linker. At the same time, a thrombin restriction site is introduced between the linker and lactoferrin to facilitate the subsequent cleavage and recovery of lactoferrin.

[0076] 2.2 Preparation method of Pichia pastoris engineered strain containing the fusion protein BLF-linker-eGFP gene (1) Recombinant plasmids containing the fusion protein BLF-linker-eGFP gene were constructed according to sections 1.2 to 1.4 of Example 1. Positive clones were screened, and after sequencing verification, the recombinant plasmids were named pPIC9K-BLF-TP, pPIC9K-BLF-EK, pPIC9K-BLF-GS, pPIC9K-BLF-GSG, pPIC9K-BLF-G4S, pPIC9K-BLF-GSG2, and pPIC9K-BLF-TP2, respectively, according to their linker names. The linker sequences are shown in Table 3-2.

[0077] Table 2 Linker sequences available for screening in Example 2

[0078] (2) Referring to the method in section 1.5 of Example 1, the Quickcut... Sal I. The recombinant plasmids pPIC9K-BLF-TP, pPIC9K-BLF-EK, pPIC9K-BLF-GS, pPIC9K-BLF-GSG, pPIC9K-BLF-G4S, pPIC9K-BLF-GSG2 and pPIC9K-BLF-TP2, after being linearized by enzyme digestion, were introduced into Pichia pastoris KM71 competent cells.

[0079] (3) PCR verification was performed according to the method in section 1.6 of Example 1. The correctly verified strains were named Pichia pastoris KM71-pPIC9K-BLF-TP, Pichia pastoris KM71-pPIC9K-BLF-EK, Pichia pastoris KM71-pPIC9K-BLF-GS, Pichia pastoris KM71-pPIC9K-BLF-GSG, Pichia pastoris KM71-pPIC9K-BLF-G4S, Pichia pastoris KM71-pPIC9K-BLF-GSG2 and Pichia pastoris KM71-pPIC9K-BLF-TP2.

[0080] 2.3 Following the method described in S3, the eight Pichia pastoris engineered strains obtained in step (3) of section 2.2 of this embodiment were induced to express their contents.

[0081] 2.4 Measurement of fluorescence intensity After fermentation, 5 μL of the fermentation suspension was added to 295 μL of sterile water for resuspending, and then placed in a 96-well plate for OD analysis using a microplate reader. 600 The fluorescence intensity was measured at an excitation wavelength of 488 nm and an emission wavelength of 520 nm. The results are shown below. Figure 6 .Depend on Figure 6 As can be seen, the Pichia pastoris KM71-pPIC9K-BLF strain constructed in Example 1, which served as the negative control, exhibited a weak background fluorescence signal. Compared to the negative control, the fluorescence intensity of all positive clone strains was enhanced, with the Pichia pastoris KM71-pPIC9K-BLF-TP2 strain showing the strongest fluorescence intensity.

[0082] 2.5 Verification using fluorescence microscopy The fluorescence intensity detected by the ELISA reader may be interfered with by the background fluorescence signal of the strain. Therefore, the Pichia pastoris KM71-pPIC9K-BLF-TP2 strain was prepared by preparing a slide and directly observing its luminescence under a fluorescence microscope. The results of observing the strain expressing the fusion protein under a fluorescence microscope are shown below. Figure 7 .Depend on Figure 7 It can be seen that the Pichia pastoris KM71-pPIC9K-BLF-TP2 strain emitted green fluorescence. Since the eGFP in the fusion protein is fused to the C-terminus of the protein, only after the N-terminal protein is successfully translated can the C-terminal protein complete the translation in sequence and emit fluorescence. Therefore, this confirms the successful expression of the fusion protein BLF-linker-eGFP, and (TPTP)2 was finally selected as the linker of the fusion protein.

[0083] Therefore, in Examples 3-6, the recombinant plasmid pPIC9K-BLF-TP2 was used to modify the promoter, signal peptide, and molecular chaperone, further verifying the expression ability of the engineered bacteria for lactoferrin and using the fusion protein for rapid determination of the strain's regulatory strategy.

[0084] Example 3 Promoters are crucial components of gene expression, and their strength is directly related to the mRNA expression level and protein expression level of a gene. Selecting promoters with strong transcriptional capacity helps to achieve efficient expression of most recombinant proteins. The alcohol oxidase gene from Pichia pastoris... AOX1 promoter P AOX1 It is the most commonly used promoter in Pichia pastoris expression systems. AOX1 Initiation of transcription AOX1 The transcriptional level of the gene ranked among the top five of all detectable genes under methanol as the carbon source, and the expression level of the protein initiated by it could reach 30% of the amount of soluble protein in the cell.

[0085] Table 3 Primers and sequences used in Example 3

[0086] 3.1 P AOX1 promoter modification methods Using AOX-777-712-1 and AOX-777-712-2 from Table 3 as primers and recombinant plasmid pPIC9K-BLF-TP2 as a template, PCR amplification was performed using high-fidelity DNA polymerase. The amplified product was purified and recovered, and blunt-end ligation was performed according to the kit instructions. After ligation, the product was introduced into competent cloning host cells as described in S1 to construct the promoter P with positions removed from -777 to -712. AOX1 .

[0087] Using AOX+190-230-1 and AOX+190-230-2 from Table 3 as primers and recombinant plasmid pPIC9K-BLF-TP2 as a template, PCR amplification was performed using high-fidelity DNA polymerase. After purification and recovery of the PCR product, it was directly introduced into the cloning host according to the method described in S1. Under the action of endogenous enzymes within the cloning host, it formed a circular structure to construct the promoter P, which adds a cis-acting element at positions 190-230. AOX1 .

[0088] 3.2 Remove the promoter P from bits -777 to -712. AOX1 Recombinant plasmids, promoter P with 190-230 cis-acting elements AOX1 The recombinant plasmid was used to prepare the corresponding Pichia pastoris engineered strains according to the methods described in S2-S3, and expression was induced. Kanamycin was used for screening in S2.2. The supernatant of the fermentation product was sampled every 24 h and analyzed for OD using a microplate reader. 600 Measurement of fluorescence intensity and fluorescence value.

[0089] 3.2 P AOX1 Effects of promoter modification on fusion protein expression Some studies have put P AOX1 The promoter sequence was divided into five parts AE starting from the 5' end, and then deleted part by part. It was found that deleting the D region (from -777 to -712) could improve P... AOX1 The promoter activity increased to 128% of that in the wild-type fungus. However, in this invention, P... AOX1 Deletion of the promoter -777 to -712 region did not lead to an increase in the yield of the fusion protein BLF-linker-eGFP. Figure 8 ).

[0090] Other studies have found that P AOX1A cis-acting element exists in the -230 to -190 region of the promoter. Increasing the copy number of this element to two copies can effectively increase the expression level of the recombinant protein. However, in this invention, the increase of the cis-acting element in the -230 to -190 region did not increase the yield of the fusion protein BLF-linker-eGFP. Figure 9 ).

[0091] The results of this embodiment ( Figure 10 The results showed that, compared with the KM71-pPIC9K-BLF-TP2 strain before promoter modification, the fluorescence intensity after promoter modification not only did not increase, but actually decreased. This indicates that P AOX1 Promoter modification did not promote the yield increase of the fusion protein BLF-linker-eGFP, P AOX1 The functional elements of a promoter may not be universally applicable to all proteins.

[0092] Therefore, this invention does not apply to P. AOX1 Promoter modification.

[0093] Example 4 The N-terminal signal peptide of recombinant proteins guides nascent polypeptide chains into the endoplasmic reticulum. After glycosylation and folding, these chains are recognized and transported to the Golgi apparatus and extracellular space. The signal peptide is a key element for the secretory expression of recombinant proteins. Secreting recombinant proteins extracellularly reduces cellular stress, contributing to increased protein yield. Furthermore, secretory expression facilitates subsequent isolation and purification, simplifying extraction steps and reducing production costs. The α-mating factor signal peptide derived from *Saccharomyces cerevisiae* is the signal peptide in the *Pichia pastoris* expression system. Therefore, this embodiment modifies the α-mating factor signal peptide.

[0094] Table 4 Primers and sequences used in Example 4

[0095] 4.1 Methods for modifying signal peptides 4.1.1 Using primers NO57-70-1 and NO57-70-2 from Table 4, and recombinant plasmid pPIC9K-BLF-TP2 as a template, PCR amplification was performed using high-fidelity DNA polymerase. The amplified product was purified and recovered, and blunt-end ligation was performed according to the kit instructions. After ligation, the product was introduced into competent cloning host cells as described in S1 to construct a signal peptide vector with amino acids removed from positions 57 to 70 of the α-mating factor signal peptide.

[0096] 4.1.2 Using a10-1 and a10-2 from Table 4 as primers and recombinant plasmid pPIC9K-BLF-TP2 as a template, PCR amplification was performed using high-fidelity DNA polymerase. After purification and recovery of the amplified product, it was directly introduced into the cloning host according to the method described in S1. Under the action of endogenous enzymes in the cloning host, it formed a circular structure to construct a signal peptide vector with a 10-amino acid sequence (EEAEAEAEPK) added to the C-terminus of the α-mating factor signal peptide.

[0097] 4.1.3 Using primers a86BH-1 and a86BH-2 from Table 4 as degenerate primers, and recombinant plasmid pPIC9K-BLF-TP2 as a template, PCR amplification was performed using high-fidelity DNA polymerase. After purification and recovery of the PCR product, it was directly introduced into the cloning host according to the method in S1, where it formed a circular structure under the action of endogenous enzymes within the cloning host cell. The recombinant plasmid pPIC9K-BLF-TP2-E86 was obtained by using a signal peptide vector with a saturation mutation at position 86E of the α-mating factor signal peptide.

[0098] 4.2 Following the methods described in S2-S3, the recombinant plasmid modified with the signal peptide was used to prepare the corresponding Pichia pastoris engineered strain and induce expression. The supernatant of the fermentation product was sampled every 24 h, and the OD was measured using a microplate reader. 600 Value and fluorescence intensity.

[0099] 4.3 Effects of signal peptide modification on fusion protein expression 4.3.1 Studies have shown that by deleting the amino acid sequence between N57 and I70 of the α-mating factor signal peptide to obtain the αMF (ΔN57-I70) signal peptide, the expression levels of horseradish peroxidase and lipase were increased by 50%.

[0100] Depend on Figure 11 As can be seen, in this embodiment, the deletion of the amino acid sequence between N57 and I70 did not increase the fluorescence intensity of the fusion protein BLF-linker-eGFP, but instead reduced its fluorescence intensity.

[0101] 4.3.2 By Figure 12 As can be seen, in this embodiment, the addition of the 10-amino acid artificial sequence enhanced the fluorescence intensity of the fusion protein BLF-linker-eGFP. The fluorescence intensity reached its maximum value after 24 h of fermentation and then decreased. This indicates that the artificial sequence has a certain promoting effect on the secretory expression of the fusion protein BLF-linker-eGFP.

[0102] 4.3.3 The E86 position of the α-mating factor signal peptide is the cleavage site of the Kex2 signal peptidase. The Kex2 signal peptidase cleaves the K86 position of the α-mating factor signal peptide specifically. 84 R 85This facilitates the secretory expression of recombinant proteins. The properties of the side chain amino acids at the Kex2 cleavage site P1K / P1R affect its cleavage efficiency. Figure 13 As can be seen, in this embodiment, the fluorescence intensity of the two mutants, αMF(E86Q) and αMF(E86F), was significantly increased compared to the original E86. This indicates that the mutation at the E86 position facilitates the secretory expression of the fusion protein BLF-linker-eGFP. The αMF(E86F) mutant was named Pichia pastoris KM71-BLF-TP2-E86F.

[0103] Therefore, based on the Pichia pastoris strain KM71-BLF-TP2-E86F, the molecular chaperone in Example 5 was studied.

[0104] Example 5 The folding of nascent polypeptide chains after entering the endoplasmic reticulum (ER) depends on the binding and assistance of ER-resident molecular chaperones. Immunoglobulin-binding protein Bip initially binds to the nascent polypeptide chain, stabilizing its structure by binding to the hydrophobic regions of the polypeptide chain and preventing its binding to other unfolded or misfolded proteins. Subsequently, under the action of other molecular chaperones (such as PDI), the protein further folds until its native structure is formed. Misfolded proteins initiate the unfolded protein response (UPR) pathway induced by HAC1p in yeast cells. UPR upregulates molecular chaperones (Bip / Kar2, FKB2) and folding enzymes (PDI, ERO1, EUG1) to promote correct protein folding. It also activates ER-related protein degradation processes to clear unfolded or misfolded proteins or induce apoptosis. PDI, short for protein disulfide isomerase, is primarily responsible for disulfide bond formation and isomerization, capable of repairing misfolded disulfide bonds, and is both disulfide-dependent and disulfide-independent molecular chaperones. ERO is an endoplasmic reticulum oxidase. Oxidized PDI is reduced to its reduced state after catalyzing disulfide bond formation, and its regeneration depends on the FAD-dependent endoplasmic reticulum oxidase Ero1p. Therefore, co-expression of molecular chaperones may improve the correct folding flux of proteins, thereby increasing protein yield.

[0105] Table 5 Primers and sequences used in Example 5

[0106] 5.1 Construction method of recombinant plasmids for linking molecular chaperone gene fragments 5.1.1 Using GAPZ-1 and GAPZ-2 from Table 5 as primers and pGAPZ A vector as a template, PCR amplification was performed. The PCR products were then subjected to... Dpn After template removal, the product is purified and recovered, and used as a vector fragment.

[0107] 5.1.2 Construction of Molecular Chaperone Fragments 5.1.2.1 Extract genomic DNA from Pichia pastoris strain KM71 according to the instructions of the yeast genomic DNA extraction kit.

[0108] 5.1.2.2 The concentration and purity were determined using nanodrop (Thermo Fisher Scientific), OD 268 / OD 280 Products with a ratio between 1.8 and 2.0 are considered acceptable and used as templates for the next step.

[0109] 5.1.2.3 Using HAC-1 and HAC-2, ERO-1 and ERO-2, PDI-1 and PDI-2 and Bip-1 and Bip-2 from Table 5 as primers, and using the extracted Pichia pastoris KM71 strain genomic DNA as a template, the gene DNA fragments encoding the molecular chaperone proteins HAC, ERO, PDI and Bip were amplified by PCR technology.

[0110] 5.1.2.4 Using a seamless cloning enzyme, the molecular chaperone fragments were ligated to the vector fragments according to the instructions.

[0111] 5.1.3 After ligation, the cells were transferred into competent host cells. Positive clones were selected for sequencing verification, and the correctly verified recombinant plasmids were collected. The recombinant plasmids ligating the molecular chaperone gene fragments HAC, ERO, PDI, and Bip were named pGAPZA-HAC, pGAPZ A-ERO, pGAPZ A-PDI, and pGAPZ A-Bip, respectively.

[0112] 5.2 Following the methods described in S1-S2, the recombinant plasmids pGAPZ A-HAC, pGAPZ A-ERO, pGAPZ A-PDI, and pGAPZ A-Bip were introduced into Pichia pastoris strain KM71-BLF-TP2-E86F (prepared in Example 4). In step S2.2, bleomycin was used for screening.

[0113] After verification, the strains were named Pichia pastoris strain KM71-BLF-TP2-E86F-HAC, Pichia pastoris strain KM71-BLF-TP2-E86F-ERO, Pichia pastoris strain KM71-BLF-TP2-E86F-PDI, and Pichia pastoris strain KM71-BLF-TP2-E86F-Bip, respectively.

[0114] 5.3 Induced Expression Following the method described in S3, Pichia pastoris strains KM71-BLF-TP2-E86F-HAC, KM71-BLF-TP2-E86F-ERO, KM71-BLF-TP2-E86F-PDI, and KM71-BLF-TP2-E86F-Bip were induced to express their contents. Simultaneously, Pichia pastoris strains KM71-pPIC9K-BLF-TP2 and KM71-pPIC9K-BLF were used as control groups, and their expressions were induced under the same conditions.

[0115] 5.4 Effect of molecular chaperone co-expression on fusion protein expression Every 24 hours, whole cell samples and fermentation product supernatant samples were collected from each strain. Whole cell samples (e.g., microplate reader) were then analyzed using a microplate reader. Figure 14 (as shown) and fermentation product supernatant (e.g.) Figure 15 The fluorescence intensity is shown in the figure. Fermentation supernatant refers to the liquid portion after centrifugation or filtration to remove the bacterial cells. Whole cells refer to the collected intact bacterial cell precipitate.

[0116] Depend on Figure 14 and Figure 15 As can be seen, compared with Pichia pastoris strains (TP2 and 9K-BLF) that did not overexpress molecular chaperones, strains with the α-mating factor signal peptide E86 mutated to F and simultaneously co-expressing PDI (PDi) showed significantly increased fluorescence intensity in both whole-cell and fermentation supernatant. Strains with the α-mating factor signal peptide E86 mutated to F and simultaneously overexpressing ERO (ERO) also showed significantly increased fluorescence intensity in fermentation supernatant. However, strains with the α-mating factor signal peptide E86 mutated to F and simultaneously overexpressing HAC and Bip (HAC and BiP) did not show significant changes in fluorescence intensity. The enhanced fluorescence intensity due to ERO co-expression is attributed to the fact that ERO co-expression promotes the regeneration of intracellular endogenous PDI, thereby facilitating the correct formation of disulfide bonds in the target protein.

[0117] Example 6: HIS-TAG ELISA Quantification The HIS-TAG ELISA kit was used to quantify lactoferrin in fermentation broths that showed a significant increase in fluorescence intensity after the aforementioned modification. Specific procedures were followed according to the kit instructions. The prepared standard curve is shown below. Figure 16 The results are shown Figure 17 .

[0118] Depend on Figure 17It can be seen that the results of HIS-TAG ELISA quantification are basically consistent with the changes in fluorescence intensity. Compared with Pichia pastoris KM71-pPIC9K-BLF-TP2, the recombinant protein yield of Pichia pastoris KM71-TP2-E86F-PDI strain increased from 4.32 mg / L to 10.04 mg / L, which may be due to the significant influence of 16 disulfide bonds on the correct folding of the recombinant protein.

[0119] Example 7 Seed culture and preliminary preparation: (1) Take a loopful of a single colony of Pichia pastoris strain KM71-TP2-E86F-PDI from YPD plate and inoculate it into 10 mL of liquid YPD medium. Incubate overnight at 30 ℃ and 220 rpm for 12-16 hours as the primary seed culture.

[0120] (2) The primary seed culture was transferred to 100 mL of YPD liquid medium at an inoculation rate of 2%, and cultured at 30 °C and 220 rpm until OD600=20-30, which was used as the secondary seed culture.

[0121] (3) Add 2 L of inorganic salt culture medium BSM to a 5 L fermenter (with defoamer) for sterilization at 121 °C for 20 min. After sterilization, remove the fermenter, turn on the air pump and cooling water, and cool it to 30 °C.

[0122] (4) Adjust the pH to 5.0 with ammonia water, inoculate 200 mL of secondary seed liquid into the fermenter, and start fermentation. The stirring speed is 500 rpm.

[0123] Fermentation process control: (1) During the 0-16 h cell growth stage, the stirring speed and dissolved oxygen were linked, and the dissolved oxygen was controlled to be greater than 30%.

[0124] (2) During the 17-21h cell growth stage, after the glycerol in the BSM medium is depleted, 50% glycerol is added when the dissolved oxygen recovers to about 80%. Glycerol is added at a constant rate of 20 mL / L / h for 5 h.

[0125] (3) During the starvation phase, dissolved oxygen began to rise after glycerol supplementation was stopped. Timing was started when dissolved oxygen rose to 60%, and the bacteria were starved for 1 hour.

[0126] (4) During the methanol adaptation phase, methanol was added at a flow rate of 0.015 mL / min / L for 1 h to allow the cells to adapt to methanol. Then the flow rate was increased to 0.035 mL / min / L and methanol was added for 2 h. The flow rate was then increased to 0.05 mL / min / L and methanol was added for 3 h. The flow rate was then increased to 0.07 mL / min / L and methanol was added for 4 h. Finally, the flow rate was increased to 0.085 mL / min / L and methanol was added for 5 h to allow the cells to fully adapt to methanol.

[0127] (5) Methanol-induced fermentation stage: the cell fermentation was carried out for 120 h at a methanol feeding rate of 0.1 mL / min / L.

[0128] Starting with the initial addition of methanol, samples were taken every 24 hours to determine the amount of product synthesized. The amount of product synthesized was quantified using a HIS-TAG ELISA. Results are shown below. Figure 18 .Depend on Figure 18 It can be seen that the yield of exogenous protein was significantly increased in the fermenter, from 10.04 mg / L in shake flask fermentation to 95.78 mg / L, an increase of nearly 10 times. However, the highest yield appeared after 24 h of methanol induction, and the yield decreased after 24 h, possibly because some protein was degraded by the bacterial cells.

[0129] Example 8 A method for constructing a Pichia pastoris genetically engineered strain KM71-pPIC9K-BLF-E86F-PDI includes the following steps: 8.1 Signal peptide modification Using a86F-1 and a86F-2 as primers and the recombinant plasmid pPIC9K-BLF (prepared in 1.2 of Example 1) as a template, PCR amplification was performed using high-fidelity DNA polymerase. The PCR product was purified and recovered, then directly introduced into the cloning host. Under the action of endogenous enzymes within the cloning host, it formed a circular structure, thus constructing a recombinant plasmid with the α-mating factor signal peptide mutated to F at position E86.

[0130] The sequences of a86F-1 and a86F-2 are as follows: a86F-1: GAAGCTATGCATCATCATCATCATCATGAGAATCTATATTTC; a86F-2:GATGATGATGCATAGCTTCAGCTTTTCTTTCTC.

[0131] 8.2 Preparation and transformation of cloning host competent cells The recombinant plasmid with the α-mating factor signal peptide E86 position mutated to F was introduced into the cloning host competent cells according to the method described in S1.

[0132] 8.3 PCR Validation of Transformed Strains from Cloning Hosts PCR verification was performed according to the method in 1.4 of Example 1. The recombinant plasmid was then sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing verification. After verification, it was stored and named recombinant plasmid pPIC9K-BLF-F86.

[0133] 8.4 Preparation and transformation of Pichia pastoris competent cells The recombinant plasmid pPIC9K-BLF-F86 was introduced into Pichia pastoris strain KM71 using the method described in S2.

[0134] 8.5 First PCR verification of Pichia pastoris Colony PCR was performed using primers 9K-BLF-JP-1 and 9K-BLF-JP-2. The correctly verified strain was named Pichia pastoris KM71-pPIC9K-BLF-F86.

[0135] 8.6 Prepare competent cells of Pichia pastoris strain KM71-pPIC9K-BLF-F86 according to the method in S2.1.

[0136] 8.7 Following the method in S2.2, the recombinant plasmid pGAPZ A-PDI constructed in 5.1.2 of Example 5 was introduced into the Pichia pastoris strain KM71-pPIC9K-BLF-F86. In step S2.2, bleomycin was used for screening.

[0137] 8.8 Second PCR Validation of Pichia pastoris Colony PCR was performed using primers PDI-1 and PDI-2. The correctly verified strain was cryopreserved in glycerol preservation tubes at -80 °C and named Pichia pastoris strain KM71-pPIC9K-BLF-E86F-PDI.

[0138] Example 9 A method for constructing the Pichia pastoris genetically engineered strain BLF-E86F-PDI includes the following steps: Step 1: After codon optimization based on yeast codon preference, a plasmid pY26-BLF containing the bovine lactoferrin expression gene was synthesized. Using 9K-BLF-1 and 9K-BLF-2 as primers and pY26-BLF as a template, the target gene fragment was obtained by PCR. Using 9K-1 and 9K-2 as primers and pPIC9K as a template, the vector fragment was obtained by PCR. The recovered target gene fragment and vector fragment were ligated using a seamless cloning enzyme. After ligation, the cells were transformed into competent cloning host cells. Colony PCR and sequencing were performed using primers 9K-BLF-JP-1 and 9K-BLF-JP-2 to verify that the correctly constructed single-clone colonies contained the successfully constructed recombinant plasmid pPIC9K-BLF. The sequences of 9K-BLF-JP-1 and 9K-BLF-JP-2 are as follows: 9K-BLF-JP-1:CAGCACAAATAACGGGTTATTG, 9K-BLF-JP-2: GACAATAGCTTCCAGATTAAATCTTC; Step 2: Using a86F-1 and a86F-2 as primers and recombinant plasmid pPIC9K-BLF as template, PCR amplification was performed. After purification and recovery of the PCR product, it was directly introduced into the cloning host competent cells. Colony PCR and sequencing were performed using primers a86F-1 and a86F-2 to verify the colony. The verified single colony contained the successfully constructed recombinant plasmid pPIC9K-BLF-F86 with the α-mating factor signal peptide E86 position mutated to F. The sequences of a86F-1 and a86F-2 are as follows: a86F-1: GAAGCTATGCATCATCATCATCATCATGAGAATCTATATTTC; a86F-2:GATGATGATGCATAGCTTCAGCTTTTCTTTCTC; Step 3: The recombinant plasmid pPIC9K-BLF-F86 was introduced into Pichia pastoris, and colony PCR was performed using primers 9K-BLF-JP-1 and 9K-BLF-JP-2 to verify the correct strain, which was Pichia pastoris strain BLF-F86. Step 4: Using GAPZ-1 and GAPZ-2 as primers and pGAPZ A vector as a template, PCR amplification was performed, and the recovered product was used as the vector fragment. Using PDI-1 and PDI-2 as primers and Pichia pastoris KM71 strain genomic DNA as a template, the gene DNA fragment encoding the molecular chaperone protein PDI was amplified by PCR. The gene DNA fragment encoding the molecular chaperone protein PDI and the vector fragment were ligated, and the ligated cells were transformed into competent cells of the cloning host. Colony PCR verification was performed using primers PDI-1 and PDI-2, and sequencing verification was performed. The verified single-clone colonies contained the successfully constructed recombinant plasmid pGAPZ A-PDI. The sequences of GAPZ-1 and GAPZ-2, PDI-1 and PDI-2 are as follows: GAPZ-1:GAATTCACGTGGCCCAGCCGGCCGTCT, GAPZ-2:ATAGTTGTTCAATTGATTGAAATAGGGACAAATAAA, PDI-1: AATCAATTGAACAACTATATGCAATTCAACTGGAATATTAAAACTGTGGC, PDI-2:GCTGGGCCACGTGAATTCTTAAAGCTCGTCGTGAGCGTCTG; Step 6: Introduce the recombinant plasmid pGAPZ A-PDI into competent cells of Pichia pastoris strain BLF-F86; use primers PDI-1 and PDI-2 to perform colony PCR verification, and the correct strain is Pichia pastoris strain BLF-E86F-PDI.

Claims

1. A genetically engineered recombinant Pichia pastoris strain with high yield of lactoferrin, characterized in that, The Pichia pastoris genetically engineered strain simultaneously meets the following three modification requirements: Overexpression of the bovine lactoferrin expression gene, wherein the NCBI accession number for the bovine lactoferrin cDNA is L08604.

1. The α-mating factor signal peptide E86 position is mutated to F. Overexpression of the PDI molecular chaperone gene.

2. A method for constructing a recombinant Pichia pastoris genetically engineered strain as described in claim 1, characterized in that, Includes the following steps: Step 1: After codon optimization based on yeast codon preference, a plasmid pY26-BLF containing the bovine lactoferrin expression gene was synthesized. Using 9K-BLF-1 and 9K-BLF-2 as primers and pY26-BLF as a template, the target gene fragment was obtained by PCR. Using 9K-1 and 9K-2 as primers and pPIC9K as a template, the vector fragment was obtained by PCR. The recovered target gene fragment and vector fragment were ligated using a seamless cloning enzyme. After ligation, the cells were transformed into competent cloning host cells. Colony PCR and sequencing were performed using primers 9K-BLF-JP-1 and 9K-BLF-JP-2 to verify that the correctly constructed single-clone colonies contained the successfully constructed recombinant plasmid pPIC9K-BLF. The sequences of 9K-BLF-JP-1 and 9K-BLF-JP-2 are as follows: 9K-BLF-JP-1:CAGCACAAATAACGGGTTATTG, 9K-BLF-JP-2: GACAATAGCTTCCAGATTAAATCTTC; Step 2: Using a86F-1 and a86F-2 as primers and recombinant plasmid pPIC9K-BLF as template, PCR amplification was performed. After purification and recovery of the PCR product, it was directly introduced into the cloning host competent cells. Colony PCR and sequencing were performed using primers a86F-1 and a86F-2 to verify the colony. The verified single colony contained the successfully constructed recombinant plasmid pPIC9K-BLF-F86 with the α-mating factor signal peptide E86 position mutated to F. The sequences of a86F-1 and a86F-2 are as follows: a86F-1: GAAGCTATGCATCATCATCATCATCATGAGAATCTATATTTC; a86F-2:GATGATGATGCATAGCTTCAGCTTTTCTTTCTC; Step 3: The recombinant plasmid pPIC9K-BLF-F86 was introduced into Pichia pastoris, and colony PCR was performed using primers 9K-BLF-JP-1 and 9K-BLF-JP-2 to verify the correct strain, which was Pichia pastoris strain BLF-F86. Step 4: Using GAPZ-1 and GAPZ-2 as primers and pGAPZ A vector as a template, PCR amplification was performed, and the recovered product was used as a vector fragment. Using PDI-1 and PDI-2 as primers and Pichia pastoris KM71 strain genomic DNA as a template, the gene DNA fragment encoding the molecular chaperone protein PDI was amplified by PCR. The gene DNA fragment encoding the molecular chaperone protein PDI and the vector fragment were ligated, and then transformed into competent cells of the cloning host. Colony PCR was performed using primers PDI-1 and PDI-2, and sequencing was performed to verify the colony. The verified single-clone colonies contained the successfully constructed recombinant plasmid pGAPZ A-PDI. The sequences of GAPZ-1 and GAPZ-2, PDI-1 and PDI-2 are as follows: GAPZ-1:GAATTCACGTGGCCCAGCCGGCCGTCT, GAPZ-2:ATAGTTGTTCAATTGATTGAAATAGGGACAAATAAA, PDI-1: AATCAATTGAACAACTATATGCAATTCAACTGGAATATTAAAACTGTGGC, PDI-2:GCTGGGCCACGTGAATTCTTAAAGCTCGTCGTGAGCGTCTG; Step 6: Introduce the recombinant plasmid pGAPZ A-PDI into competent cells of Pichia pastoris strain BLF-F86; use primers PDI-1 and PDI-2 to perform colony PCR verification, and the correct strain is Pichia pastoris strain BLF-E86F-PDI.

3. The application of the recombinant Pichia pastoris genetically engineered strain as described in claim 1 in the production of bovine lactoferrin.

4. A method for the preparation of bovine lactoferritin, characterized in that, Fermentation was carried out using the Pichia pastoris strain BLF-E86F-PDI as described in claim 1.

5. The production method according to claim 4, wherein The fermentation method of the Pichia pastoris strain BLF-E86F-PDI is as follows: Add inorganic salt culture medium (BSM) to the fermenter along with an antifoaming agent. After sterilization, remove the fermenter, connect the air pump and cooling water circulation, and cool to 28-30 °C. Adjust the pH to 4.5-5.5 with ammonia. Inoculate the Pichia pastoris BLF-E86F-PDI strain seed culture into the fermenter and begin fermentation. The fermentation conditions are controlled as follows: (a) During the 0-16 h cell growth phase, the stirring speed and dissolved oxygen were correlated, and the dissolved oxygen was controlled to be greater than 30%. (b) During the 17-21h cell growth phase, after the glycerol in the BSM medium is depleted, 50-55% glycerol is added once the dissolved oxygen level rises to 80%. Glycerol is added at a constant rate of 18-22 mL / L / h for 4.5-5.5 h. (c) During the starvation phase, dissolved oxygen began to rise after glycerol supplementation was stopped. Timing began when dissolved oxygen rose to 60%, and the bacteria were starved for 1 hour. (d) During the methanol adaptation phase, First, add methanol at a flow rate of 0.01-0.02 mL / min / L for 0.5-1.5 h to allow the bacteria to adapt to methanol. Then increase the flow rate to 0.03-0.4 mL / min / L and continue adding methanol for 1.5-2.5 h. Then increase the flow rate to 0.04-0.06 mL / min / L and continue adding methanol for 2.5-3.5 h. Then increase the flow rate to 0.06-0.08 mL / min / L and continue adding methanol for 3.5-4.5 h. Finally, increase the flow rate to 0.08-0.09 mL / min / L and continue adding methanol for 4.5-5.5 h to allow the cells to fully adapt to the methanol. (e) During the methanol-induced fermentation stage, the cell fermentation was carried out at a methanol feeding rate of 0.8-1.2 mL / min / L. After the fermentation was completed, the fermentation broth was collected and separated and purified to obtain bovine lactoferrin.

6. The production method according to claim 5, wherein The Pichia pastoris BLF-E86F-PDI strain seed culture is a secondary seed culture, prepared as follows: The primary seed culture is transferred at a 2% inoculation rate to 100 mL of YPD liquid medium and cultured at 30 ℃ and 220 rpm until OD600 = 20-30, which serves as the secondary seed culture. The primary seed culture is prepared as follows: A single loopful of Pichia pastoris BLF-E86F-PDI strain from a YPD plate is inoculated into 10 mL of liquid YPD medium and cultured overnight at 30 ℃ and 220 rpm for 12-16 hours, which serves as the primary seed culture.

Images