Pseudomonas plecoglossicida and application thereof

Abstract

This invention discloses a strain of *Pseudomonas proteus* and its applications, belonging to the field of microbial technology. The *Pseudomonas proteus* strain is named *Pseudomonas proteus* (…). Pseudomonas plecoglossicida Sg308, deposited on March 1, 2026, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 37822, significantly enhances the insecticidal activity of Bacillus thuringiensis against the Asian corn borer. Its mechanism of action primarily involves entry into the hemocoel through perforations caused by Bacillus thuringiensis, leading to septicemia and thus enhancing the lethal effect of Bt toxin. The combined use of this strain and Bt can significantly improve control efficacy and reduce pesticide usage, showing broad application prospects in the green control of the Asian corn borer.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically relating to a strain of Pseudomonas proteus and its applications. Background Technology

[0002] Bacillus thuringiensis (Bt) Bacillus thuringiensis Bt (Bacillus subtilis) is currently the most widely used microbial insecticide. Its insecticidal activity mainly comes from the crystal protein produced during spore formation. This protein is activated in the alkaline environment of the insect's midgut, specifically binding to receptors on intestinal epithelial cells, causing cell perforation and leading to insect death. However, in practical applications, the control efficacy of Bt products can be affected by environmental factors, the developmental stage of pests, and the potential development of resistance in pest populations, leading to unstable control efficacy or increased dosage.

[0003] Asian corn borer Ostrinia furnacalis The Asian corn borer is one of the most prevalent and damaging pests in corn production worldwide, causing severe economic losses. Currently, control of the Asian corn borer mainly relies on chemical pesticides and Bt genetically modified crops. However, the long-term irrational use of pesticides will inevitably lead to resistance risks and environmental pressures. Therefore, developing synergistic technologies that can enhance the insecticidal effect of Bt, delay the development of resistance, and reduce pesticide usage is of great significance.

[0004] The insect gut microbiome has been shown to influence the physiology, development, and pesticide sensitivity of host insects. Some gut bacteria can reduce pesticide efficacy by degrading pesticides, activating host immunity, or competitively rejecting them; conversely, some bacteria may enhance pesticide activity by suppressing immune responses, producing synergistic substances, or entering the hemocoel through a compromised intestinal barrier, causing sepsis. Therefore, screening for synergistic gut bacteria is crucial for the long-term sustainable utilization of insecticides (Bt). Summary of the Invention

[0005] To overcome the problems existing in the background technology, the present invention provides a strain of Pseudomonas proteus and its application. It is obtained by isolating, culturing and purifying it in the intestine of Asian corn borer and is identified as Pseudomonas proteus. The obtained Pseudomonas proteus can significantly improve the insecticidal activity of Bt against Asian corn borer, providing a new material for the creation of synergistic agents.

[0006] This invention provides a strain of *Pseudomonas proteus* Sg308, which was deposited on March 1, 2026, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 37822. Its classification name is *Pseudomonas proteus* (…). Pseudomonas plecoglossicida ).

[0007] The gene sequence of the *Pseudomonas proteus* strain is the nucleotide sequence shown in SEQ ID No. 1.

[0008] The present invention also provides a Pseudomonas proteus Sg308 bacterial agent prepared from the Pseudomonas proteus Sg308 strain, comprising live Pseudomonas proteus Sg308 cells, cell fragments or metabolites.

[0009] This invention provides the application of Pseudomonas proteus strain Sg308 or Pseudomonas proteus Sg308 inoculum in enhancing the insecticidal activity of Bacillus thuringiensis against Asian corn borer.

[0010] The above applications refer to Bacillus thuringiensis containing live Bacillus thuringiensis bacteria, spores, insecticidal crystal proteins, formulations, or transgenic plants expressing Bacillus thuringiensis insecticidal proteins.

[0011] The beneficial effects of this invention are: This invention is the first to discover and utilize the synergistic effect of *Pseudomonas aeruginosa* strains with *Bt*, which can significantly increase the mortality rate of *Bt* against the Asian corn borer and extend the median lethal time (LT50) of *Bt*, thereby improving control efficacy and delaying the development of *Bt* resistance in field pest populations. This strain can be used in conjunction with existing *Bt* formulations and *Bt* transgenic crops to develop novel synergists or compound biological pesticides, possessing significant industrial value and market potential. Attached Figure Description

[0012] Figure 1 Colony morphology of Pseudomonas proteus Sg308 and cell morphology under an optical microscope; Figure 2 Phylogenetic tree diagram of Pseudomonas proteus Sg308; Figure 3 Survival curves of Asian corn borer after combined use of Pseudomonas proteobacterium Sg308 and Cry1Ab; Figure 4 The mortality rate of Asian corn borers was 7 days after genetically modified corn was sprayed with Pseudomonas proteus Sg308. Detailed Implementation

[0013] The following provides a detailed description of specific embodiments of the present invention. It should be understood that the specific embodiments described herein are for illustrative and explanatory purposes only and are not intended to limit the scope of the invention.

[0014] Example 1: Isolation and Identification of Strains Select healthy fourth-instar larvae of the Asian corn borer, starve them for 6 hours, disinfect their body surface with 75% ethanol for 3 minutes, rinse them 3-5 times with sterile water, dissect them in a laminar flow hood to obtain midgut tissue, put it into a 1.5mL centrifuge tube containing sterile PBS buffer, grind it, and then make up to 1mL with PBS for later use.

[0015] Take 100µL of the above-mentioned stock solution and add it to 900µL of PBS buffer to obtain 10 -2 The diluent was diluted stepwise to obtain a 10-10 solution. -4 10 -5 and 10 -6 Bacterial suspensions were prepared using serial dilutions. 100 µL of the suspension was evenly spread onto LB agar (10 g sodium chloride, 5 g yeast extract, 10 g tryptone, 20 g agar, 1 L deionized water), with three replicates for each dilution. The plates were incubated at 30 °C. The growth of single colonies was observed. Based on colony color, size, and shape, single colonies were picked and streaked onto LB plates until single colonies grew. Purification was repeated three times or more. The colony and cell morphology of the purified strain are shown below. Figure 1 As shown, the colonies are pale yellow with neat, round edges and a moist, smooth surface; the bacterial cells are straight or slightly curved, and this strain is named Sg308.

[0016] The above single colonies were used for species identification: Single colonies were picked and inoculated into LB liquid medium (10 g sodium chloride, 5 g yeast extract, 10 g tryptone, 1 L deionized water), and cultured at 30℃ and 180 r / min for 24 h. Using the bacterial culture as a template, the bacterial 16S rRNA gene sequence was sequenced using universal primer 27F (5'). AGAGTTTGATCCTGGCTCAG 3') and 1492R (5') ACGGCTACCTTGTTACGACT 3') PCR amplification was performed to obtain a 1310 bp 16S rRNA gene sequence (as shown in SEQ ID NO. 1). Comparison on the NCBI website showed that strain Sg308 was similar to *Pseudomonas proteus* (…). Pseudomonas plecoglossicida The gene sequence of NBRC 103162 showed 100% homology. After downloading highly homologous sequences, a phylogenetic tree was constructed using the MEGA11 neighbor-joining method to determine the taxonomic position of the strain. The phylogenetic tree is shown below. Figure 2 As shown. Based on the above results, Sg308 was identified as *Pseudomonas proteus* (…). Pseudomonas plecoglossicida ).

[0017] SEQ ID NO.1: The present invention names strain Sg308 as *Pseudomonas proteus* (…). Pseudomonas plecoglossicida Sg308 was deposited on March 1, 2026, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 37822.

[0018] Example 2: Effect of Pseudomonas proteans Sg308 on the insecticidal activity of Cry1Ab protein The glycerol-preserved strain Sg308 was plated on LB agar plates and incubated overnight at 30°C. Single colonies were picked and fermented in centrifuge tubes containing 50 mL of LB liquid medium under the following conditions: 30°C, 180 rpm, and 24 h. The cultured bacterial solution was centrifuged to enrich the bacterial cells, then resuspended in sterile water and diluted to OD200. 600 =1.0, spare.

[0019] The test insects were third-instar larvae of the Asian corn borer, which had been raised indoors in our laboratory for a long period and had their intestinal bacteria removed. The method for removing intestinal bacteria from the normal population was as follows: fresh eggs were disinfected with 5% sodium hypochlorite for 30 seconds, then rinsed three times with sterile water, and finally the residual moisture was absorbed with absorbent paper before being placed in an insect rearing box for normal incubation. After hatching, the larvae were introduced into artificial feed supplemented with compound antibiotics (rifampin: chlortetracycline hydrochloride: penicillin = 1:1:1) and reared in an incubator with a temperature of (27±1)℃, humidity of 70%-80%, and a photoperiod of 16L:8D. When the larvae reached the third instar, the midgut was dissected, homogenized, and spread on LB agar plates to check for bacterial growth and verify whether intestinal bacteria had been properly removed.

[0020] The feed-medication method was used. Specifically, 700µL of prepared bacterial solution or sterile water and 70µL of Cry1Ab protein solution (1µg / µl) or sterile water were added to 7g of feed. After mixing, the mixture was evenly dispensed into 24-well plates. One third-instar Asian corn borer larva (with gut bacteria removed) was inoculated into each well. Filter paper and foam board were placed on top, and the plates were covered. The plates were then placed in an incubator at (27±1)℃, 70%-80% humidity, and a photoperiod of 16L:8D. Four treatments were set up: Treatment 1: Sterile water added to the feed; Treatment 2: Bacterial solution added to the feed; Treatment 3: Cry1Ab protein solution added to the feed; Treatment 4: Both bacterial solution and Cry1Ab protein solution were added to the feed. Each treatment was replicated three times. The number of Asian corn borer larvae that died was recorded daily for 7 days. The average mortality rate was calculated, and a survival curve was plotted.

[0021] Depend on Figure 3It was found that feeding Sg308 alone did not cause mortality in Asian corn borer larvae; however, after 2 days of treatment with both bacterial solution and Cry1Ab, the survival rate of Asian corn borers was significantly lower than that of the other three treatment groups. As time progressed, the larval survival rate in the Cry1Ab treatment group was significantly lower than that in the groups fed only with bacteria and sterile water, but still significantly higher than that in the group fed simultaneously with both Sg308 bacterial solution and Cry1Ab. Therefore, it can be concluded that Sg308 can enhance the insecticidal effect of Cry1Ab.

[0022] Example 3: Effect of Pseudomonas proteus Sg308 on the control of Asian corn borer in transgenic maize The glycerol-preserved strain Sg308 was plated on LB agar plates and incubated overnight at 30°C. Single colonies were picked and fermented in centrifuge tubes containing 50 mL of LB liquid medium under the following conditions: 30°C, 180 rpm, and 24 h. The cultured bacterial solution was centrifuged to enrich the bacterial cells, then resuspended in sterile water and diluted to OD200. 600 =1.0, spare.

[0023] Transgenic corn of variety Nongda 372R was grown indoors, with 4 plants per pot (11cm in diameter). After the corn reached the 3-leaf, 1-heart stage, 5mL of microbial agent was sprayed. Once no obvious droplets remained on the plants, 3rd instar larvae of the Cry1Ab-resistant Asian corn borer, selected through long-term laboratory testing, were introduced. Five larvae were inoculated per plant, totaling 20 larvae per pot. A control treatment with an equal volume of sterile water was used, and each treatment was replicated 8 times. The number of surviving larvae was assessed 7 days after inoculation, and the mortality rate was calculated as: Mortality Rate (%) = Number of dead larvae / Number of tested larvae × 100%.

[0024] The results are as follows Figure 4 As shown, after 7 days, the mortality rate of Asian corn borer in the group treated with Pseudomonas proteobacterium Sg308 bacterial solution was 42.50%, significantly higher than the 26.25% in the untreated transgenic corn. This indicates that spraying transgenic crops with Pseudomonas proteobacterium Sg308 can significantly improve the control effect of transgenic corn against Asian corn borer.

[0025] Example 4: Effect of Pseudomonas proteans Sg308 on the control efficacy of G033A wettable powder against Asian corn borer. The glycerol-preserved strain Sg308 was plated on LB agar plates and incubated overnight at 30°C. Single colonies were picked and fermented in centrifuge tubes containing 50 mL of LB liquid medium under the following conditions: 30°C, 180 rpm, and 24 h. The cultured bacterial solution was centrifuged to enrich the bacterial cells, then resuspended in sterile water and diluted to OD200. 600 =1.0, for later use. Bacillus thuringiensis G033A wettable powder is a commercially available formulation, marketed under the brand name "Guardian". ®Prepare a solution with a concentration of 2.5 g / L (dosage) for later use.

[0026] Indoor corn was grown using the Zhengdan 958 variety, with 4 corn plants per pot (11cm in diameter). Three treatments were administered: Treatment 1: sprayed with sterile water only; Treatment 2: sprayed with G033A wettable powder solution; Treatment 3: sprayed with a mixture of *Pseudomonas proteus* Sg308 bacterial solution and *Bacillus thuringiensis* G033A wettable powder solution.

[0027] After the corn plants reached the 3-leaf, 1-heart stage, appropriate treatments were applied. Once the plants showed no obvious sap droplets, third-instar larvae of the Asian corn borer were inoculated. Four larvae were inoculated per plant, and 16 larvae per pot, with each treatment replicated five times. The number of surviving larvae was assessed 7 days after inoculation, and the population reduction rate and control efficacy were calculated. Population reduction rate (%) = (Number of surviving larvae before treatment - Number of surviving larvae after treatment) / Number of surviving larvae before treatment × 100; Control efficacy (%) = (Population reduction rate in the treatment group - Population reduction rate in the control group) / (100 - Population reduction rate in the blank group) × 100.

[0028] As shown in Table 1, the simultaneous application of wettable powder solutions of Pseudomonas proteus Sg308 and Bacillus thuringiensis G033A significantly improved the control effect on Asian corn borer compared to the application of wettable powder solution of Bacillus thuringiensis G033A alone, achieving a control effect of 97.10%.

[0029] Table 1. Population reduction rate and control effect of different treatments for Asian corn borer .

Claims

1. A strain of Pseudomonas plecoglossicida, characterized in that: The *Pseudomonas proteus* strain is *Pseudomonas proteus* Sg308, which was deposited on March 1, 2026, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 37822.

2. The P. mutabilis of claim 1, wherein: The 16S rRNA gene sequence of Pseudomonas proteus Sg308 is shown in SEQ ID NO.

1.

3. A Pseudomonas plecoglossicida inoculant, characterized by: It is prepared from the *Pseudomonas proteus* as described in claim 1.

4. The P. mutabilis inoculant of claim 3, wherein: Contains live bacteria, fragments of bacteria, or metabolites of Pseudomonas proteus.

5. The use of *Pseudomonas proteus* as described in any one of claims 1-2 or the *Pseudomonas proteus* agent as described in any one of claims 3-4 in enhancing the insecticidal activity of *Bacillus thuringiensis* against the Asian corn borer.

6. The application according to claim 5, characterized in that: The Bacillus thuringiensis includes live Bacillus thuringiensis bacteria, spores, insecticidal crystal proteins, preparations, or transgenic plants expressing Bacillus thuringiensis insecticidal proteins.

Images