Goose astrovirus attenuated vaccine candidate strain and application thereof

Abstract

The application discloses a goose astrovirus weakly virulent vaccine candidate strain (referred to as GAstV-GXNNP120), which has a preservation number of CCTCC No:V202564 and a preservation date of September 17, 2025. Research shows that GAstV-GXNNP120 has the advantages of high virus titer, good immunoprotective effect and long antibody duration. In addition, GAstV-GXNNP120 can also be well adapted to LMH cells, and compared with culturing viruses in goose embryos, the cost of culturing viruses in the passage cells is lower, and the quality between batches is more stable. Therefore, the goose astrovirus weakly virulent vaccine candidate strain of the application can be used for further development of a goose astrovirus attenuated live vaccine, and has important significance for clinical prevention and control of goose astrovirus.

Description

Technical Field

[0001] This invention belongs to the field of goose astrovirus technology, and particularly relates to a candidate strain of attenuated goose astrovirus vaccine and its application. Background Technology

[0002] Goose astrovirus (GAstV) is a non-enveloped, single-stranded, positive-sense RNA virus, approximately 35 nm in diameter. The viral genome is approximately 7.1–7.3 kb in size and contains three open reading frames (ORFs): ORF1a, ORF1b, and ORF2. ORF1a and ORF1b encode the polyproteins nsP1a and nsP1ab, which, upon cleavage, produce a viral 3C-like serine protease, RNA-dependent RNA polymerase (RdRp), a viral genome-linked protein (VPg), and other non-structural proteins with unknown functions. ORF2 encodes the viral capsid protein (Capsid), which contains a potential cell receptor-binding domain and is the main immunogenic protein for GAstV-induced neutralizing antibodies.

[0003] Goose astrovirus primarily affects goslings under 15 days old, clinically causing gout, characterized by the accumulation of large amounts of urate deposits in the heart, liver, kidneys, leg muscles, and joints. The mortality rate is approximately 30%–40%, reaching as high as 50% in poorly managed conditions. Even surviving goslings exhibit stunted growth. In recent years, with the rapid development of my country's goose farming industry, reports of gout in goslings have increased annually, with some cases occurring as early as 20–30 days or even 50 days of age. Particularly since 2017, gout caused by a novel goose astrovirus has rapidly spread throughout the country, causing significant economic losses to my country's goose farming industry. Therefore, a safe and effective novel goose astrovirus vaccine is urgently needed clinically.

[0004] Currently, there are no attenuated vaccines against goose astrovirus on the market, mainly because the virus is difficult to culture and multiply in vitro, resulting in generally low viral titers. Some studies have attempted to amplify the virus in vitro using goose embryos and collect virus-containing embryos or allantoic fluid to prepare vaccines. However, the high price of goose embryos and the uncontrollable quality between batches increase the cost and difficulty of vaccine production, hindering clinical application. Other researchers have used primary goose embryo kidney cells to culture goose astrovirus and found that the virus adapts well to these cells. However, this method still relies on goose embryos to isolate primary cells, and because primary cells cannot be continuously passaged, new cells must be prepared for each culture, which is time-consuming, labor-intensive, costly, and complex, making it unsuitable for large-scale vaccine production. Currently, the most commonly used passaged cells for goose astrovirus culture both domestically and internationally are chicken liver cancer (LMH) cells. However, due to differences in culture processes or strain characteristics between different laboratories, the viral titers on these passaged cells vary considerably.

[0005] In summary, goose astrovirus is one of the important pathogens currently threatening my country's goose farming industry. Finding a strain that can be stably passaged in cells, has a high titer, and has significantly reduced virulence, and using this strain to prepare a live vaccine, is of vital importance for the clinical prevention and control of this disease. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to provide a candidate strain of attenuated goose astrovirus vaccine and its application.

[0007] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:

[0008] The candidate strain of goose astrovirus attenuated vaccine has the accession number CCTCC No:V202564 and the accession date is September 17, 2025.

[0009] The complete genome sequence of the virus is the base sequence of SEQ ID NO.1.

[0010] The viral titer of the virus reached 10. 7.35 TCID 50 / mL.

[0011] The application of the above-mentioned attenuated live vaccine candidate strain of goose astrovirus in the preparation of goose astrovirus vaccine.

[0012] The vaccine is a live attenuated vaccine.

[0013] The vaccine is an oral vaccine.

[0014] The live attenuated goose astrovirus vaccine was prepared using the aforementioned candidate strain of attenuated goose astrovirus vaccine as raw material.

[0015] Each dose of vaccine is 103 -10 5 TCID 50 .

[0016] To address the current problems in goose astrovirus vaccines and their production, the inventors have obtained a candidate strain of attenuated goose astrovirus vaccine (GAstV-GXNNP120), with accession number CCTCC No: V202564 and accession date of September 17, 2025. Studies have shown that GAstV-GXNNP120 has the advantages of high viral titer, good immunoprotective effect, and long antibody duration. Furthermore, GAstV-GXNNP120 adapts well to LMH cells, and compared to culturing the virus in goose embryos, culture in passaged cells is less costly and results in more stable batch-to-batch quality. Therefore, the attenuated goose astrovirus vaccine candidate strain of this invention can be used for further development of a live attenuated goose astrovirus vaccine, which is of great significance for the clinical prevention and control of goose astrovirus. Attached Figure Description

[0017] Figure 1 This is an electrophoresis image of the GAstV-GXNNP120 whole genome amplification. In the image, M represents the DNA marker, and lanes 1-5 represent amplified fragments 1-5.

[0018] Figure 2 The image shows the clinical symptoms of GAstV-GXNN and its subcultures after infection.

[0019] Figure 3 This image shows the changes in various organs and tissues 7 days after infection with GAstV-GXNN and its subcultures.

[0020] Figure 4 Figure showing the weight changes of GAstV-GXNN and its subcultures after infection.

[0021] Figure 5 Figure showing viral shedding after infection of GAstV-GXNN and its subcultures.

[0022] Figure 6 Survival curves of GAstV-GXNN and its subcultures after infection.

[0023] Figure 7 The mental state of goslings from different generations in the GAstV-GXNNP120 virulence reversion experiment is shown in the figure. In the figure, AE represents the 1st to 5th generation of inoculated goslings.

[0024] Figure 8 This is a graph showing the antibody fluctuations at different doses in the immunization groups of GAstV-GXNNP120 strain.

[0025] Figure 9Survival curves of GAstV-GXNNP120 immunization groups at different doses within 14 days after challenge.

[0026] Figure 10 The image shows the results of tissue viral load detection on day 7 after challenge with different doses of GAstV-GXNNP120.

[0027] Preservation Information

[0028] Avastrovirus GAstV-GXNNP120 (Goose astrovirus), accession number CCTCC No:V202564, accession date: September 17, 2025, accession address: Wuhan University, Wuhan, China, 430072, China, depositary institution: China Center for Type Culture Collection. Detailed Implementation

[0029] 1. Passage attenuation of goose astrovirus GXNN strain

[0030] The GAstV-GXNN strain, isolated and preserved by the applicant, was diluted 100-fold in DMEM / F12 medium and inoculated into LMH cells that had formed a monolayer. The cells were incubated at 37°C and 5% CO2 for 1 hour. After incubation, the supernatant was discarded, and DMEM / F12 medium containing 0.5 ng / μL TPCK trypsin was added to the cells. The cells were then cultured at 37°C and 5% CO2 for another 72 hours. When the cytopathic effect reached approximately 80%, the cells were subjected to three freeze-thaw cycles at -80°C to harvest the viral fluid. The harvested viral fluid was then inoculated into LMH cells using the same method. This process was repeated continuously, and the virus was detected by RT-PCR every 10 passages. The detection primers were:

[0031] GAstV-F:GAAGAAAAGAGTAGCTGGAC;GAstV-R:CAAGTGAGTCAGTGGGTGAA.

[0032] After the virus was passaged 120 times in LMH cells, the viral fluid was collected, and the obtained strain was named GAstV-GXNNP120.

[0033] 2. Genome amplification and sequence analysis of GAstV-GXNNP120 strain

[0034] Total RNA was extracted from GAstV-GXNNP120 strain using the trizol method. After reverse transcription, the entire genome of the strain was amplified by PCR. The amplification process was divided into five overlapping fragments, and the primer sequences used are as follows:

[0035] 1F: 5'ACGTGGGGAAACAGCGATAT 3'; 1R: 5'TCACTGGAGTTGCTGGTAT 3';

[0036] 2F: 5'CGTGTTCCACTATTACAGTCAC 3';2R: 5'TGTGAGAATCATCAGGTGGT 3';

[0037] 3F: 5'TTCAAGAGTGTAGAGGAGCT 5';3R: 5'TGTAACCTTCTTGGTCACCT 3';

[0038] 4F: 5'CACCCAATAGTGTTAGAGAGTT 3';4R: 5'GCTGGACAAGCTTAACTGTAT 3';

[0039] 5F: 5'CTGGTTCCACTTATCTGATCT 3';5R: 5'TTTTTTTTTTTTTTAAAGATTTTAAATGC 3'

[0040] The amplified sizes of each fragment were 1663 bp, 1811 bp, 1601 bp, 1320 bp, and 1275 bp, respectively. Figure 1 The amplified products were sent to Beijing Qinke Biotechnology Co., Ltd. for sequencing. The sequences were then assembled using SnapGene software to obtain the complete genome sequence of strain GAstV-GXNNP120. Finally, the sequence was compared with the parental strain GAstV-GXNN using MEGA software. The results showed that the whole genome nucleotide homology between strain GAstV-GXNNP120 and the parental strain GAstV-GXNN was 99.6%, with 28 nucleotide mutation sites. Among these, there were 14, 5, and 9 nucleotide mutation sites in the ORF1a, ORF1b, and ORF2 regions, respectively, including 13 missense mutations and 15 synonymous mutations (Table 1).

[0041]

[0042] 3. Titer determination of different generations of goose astrovirus GXNN strain

[0043] Using TCID 50 The titers of goose astrovirus at generations 5, 30, 60, 90, and 120 were determined using a specific method, with the following steps: Each generation of virus was serially diluted 10-fold (10⁻¹ ~ 10⁻¹) using DMEM / F12 culture medium. 9100 μL of each dilution was seeded into a well-grown LMH monolayer (96-well plate), with a negative control included. After seeding, the cells were incubated at 37°C with 5% CO2 for 72 hours. After incubation, the supernatant was discarded, and 4% paraformaldehyde was added to each well for fixation on ice for 1 hour. After discarding the fixative, 5% skim milk powder was added, and the cells were blocked at 37°C for 1 hour. After discarding the blocking solution, a 1:1000 dilution of anti-goose astrovirus capsid protein polyclonal antibody was added, and the cells were incubated at 37°C for 1 hour. After incubation, the cells were washed five times with PBST; then, a 1:200 dilution of FITC-labeled goat anti-mouse IgG secondary antibody was added, and the cells were incubated at 37°C in the dark for 1 hour. The secondary antibody was discarded, and the cells were washed five times with PBST. The cell nuclei were stained with DAPI under the dark. Finally, the cells were observed under a fluorescence microscope; wells showing obvious green fluorescence were considered positive for viral infection. Based on the number of positive wells at each dilution, the TCID of each generation of virus was calculated using the Reed-Muench method. 50 The viral titer was expressed as a metric. Results showed that the viral titer gradually increased with increasing passage number, stabilizing from the 60th passage onwards. The titers of the strains from the 5th, 30th, 60th, 90th, and 120th passages were 10, ... 5.45 10 6.25 10 7.10 10 7.40 10 7.35 .

[0044] 4. Pathogenicity evaluation of different generations of the goose astrovirus GXNN strain

[0045] One-day-old goslings that tested negative for both GAstV antigen and antibody were randomly divided into 6 groups of 20 each. Five of these groups were orally inoculated with GAstV-GXNN strains at passages 5, 30, 60, 90, and 120, respectively, at a dose of 10 mg / L. 6 TCID 50 / each; a blank control group was set up, and the same volume of DMEM / F12 culture medium was administered orally. Clinical symptoms were observed daily after challenge for 14 consecutive days. Three goslings from each group were necropsed on days 5 and 7 after challenge to observe organ lesions. On days 1, 3, 5, 7, 9, 11 and 14 after challenge, goslings in each group were weighed and anal swabs were collected for virus shedding using RT-qPCR. The results showed that the 5th and 30th generation strains infected groups began to show symptoms such as depression, huddling and diarrhea on day 5 after challenge; the 60th generation strain infected group showed a relatively later onset of symptoms, starting on day 8 after challenge; in the 90th generation strain infected group, only one gosling showed mild diarrhea on day 9 after infection, and the other goslings showed no abnormalities; while the 120th generation strain infected group remained normal throughout the observation period and did not show any clinical symptoms. Figure 2 The necropsy results showed that goslings infected with low-generation strains (P5, P30, P60) exhibited lesions such as liver hemorrhage, kidney enlargement, and urate deposition, while those infected with high-generation strains (P90 and P120) showed no obvious organ lesions. Figure 3 Weight monitoring results showed that, compared with the blank control group, the weight of the low-generation strains (P5, P30, P60) infection group decreased significantly from day 7 after challenge (p < 0.01), while the weight gain of the high-generation strains (P90, P120) infection group was not significantly different from that of the blank control group (p > 0.05). Figure 4 Virus shedding results showed that the viral shedding in the low-generation strains (P5, P30, P60) infection group increased sharply from day 3 after challenge, peaking on day 9. In contrast, the viral shedding time in the high-generation strains (P90, P120) infection group was delayed, and the peak viral shedding was significantly lower than that in the low-generation strains infection group (p < 0.0001). Figure 5 During the observation period, the survival rates of the infection groups infected with the 5th, 30th, 60th, 90th, and 120th generation strains were 20%, 30%, 60%, 100%, and 100%, respectively. Figure 6 The above results indicate that the pathogenicity of the GAstV-GXNN strain to goslings gradually weakens with increasing passage number, and the GXNN-P120 strain is completely attenuated and essentially non-pathogenic.

[0046] 5. Virulence reversion test of GAstV-GXNNP120 strain

[0047] Five 1-day-old goslings were inoculated with the GAstV-GXNNP120 strain each time, and each gosling was orally infected with 1 mL of virus solution (titer 10). 6 TCID 50 / mL). Clinical symptoms were observed daily. On day 5 post-inoculation, three goslings were randomly dissected to observe organ lesions. Partial liver and kidney tissues were fixed with 4% paraformaldehyde to prepare histopathological sections and observe histopathological changes. Separate portions of liver, spleen, and kidney tissues were ground and mixed with 5 times their volume of sterile saline to prepare a tissue suspension. After appropriate concentration, this suspension was used as the next generation inoculation virus solution (referred to as the first generation virus solution). The remaining two goslings were observed until day 14. The obtained first-generation virus solution was inoculated into new 1-day-old healthy goslings in the same manner for the second generation, and the above sampling and observation procedures were repeated. Using this method, the attenuated GXNN-GXNNP120 strain was continuously passaged in goslings up to the 5th generation. The results showed that no clinical symptoms appeared in the inoculated goslings during five consecutive generations of in vivo passage, and no organ abnormalities were found upon necropsy. Pathological examination of the liver and kidneys also revealed no pathological changes, indicating that the GAstV-GXNNP120 strain did not exhibit virulence reversion after continuous passage in goslings and possesses good in vivo genetic stability. Figure 7 )

[0048] 6. Detection of neutralizing antibody levels after immunization with GAstV-GXNNP120 strain

[0049] Forty healthy 1-day-old goslings that tested negative for both GAstV antigen and antibody were randomly divided into four groups of 10 each. Each group was injected orally with 10 gram of vaccine. 2 10 3 10 4 and 10 5 TCID 50 GAstV-GXNNP120 strain was administered at the specified dose. Serum samples were collected from each group on days 3, 7, 14, 21, 28, 35, and 42 post-immunization and serially diluted 2-fold using PBS. -1 -2 -12 Take serum of each dilution and mix with an equal volume of 10 2 TCID 50 Mix 0.1 mL of GAstV-GXNN strain and incubate at 37°C for 1 h. Add 200 μL / well to LMH cells cultured in 96-well plates and incubate at 37°C in a 5% CO2 incubator for 4 days. Then follow the TCID protocol as described above. 50 The assay method used polyclonal antibodies against goose astrovirus capsid protein and goat anti-mouse IgG antibody as primary and secondary antibodies, respectively, for indirect immunofluorescence assay. If no specific fluorescence was observed in cells incubated with the mixed solution, it indicated that the serum at that dilution could effectively neutralize the virus. The number of cell wells that completely neutralized the virus at each dilution was counted, and the neutralizing titer at each time point was calculated using the Reed-Muench method. Results showed that specific neutralizing antibodies were detectable in goslings from day 3 post-immunization, with 10...2 10 3 10 4 and 10 5 TCID 50 The neutralizing antibody titers in the immunized groups were 3.12 log2, 4.25 log2, 4.48 log2, and 4.33 log2, respectively. The neutralizing antibody titers in all groups reached their peak on day 21 post-immunization, at 8.08 log2, 10.57 log2, 10.46 log2, and 11.12 log2, respectively, and this peak value remained until approximately day 35. On day 42 post-immunization, the neutralizing antibody titers in all groups decreased slightly but remained at a high level. These results indicate that the GAstV-GXNNP120 strain has good immunogenicity and can produce high levels of neutralizing antibodies after immunizing goslings, making it an excellent candidate strain for goose astrovirus vaccine. Figure 8 )

[0050] 7. Evaluation of the immunoprotective effect of GAstV-GXNNP120 strain

[0051] One hundred and twenty one-day-old healthy goslings that tested negative for both GAstV antigen and antibody were randomly divided into six groups. Four of these groups were immunization groups, which were orally inoculated with different doses of GAstV-GXNNP120 strain (10², 10³, 10⁻⁶ ... 4 10 5 TCID 50 / each); A challenge control group and a blank control group were also set up, each receiving an equal volume of DMEM / F12 culture medium orally. On day 14 post-immunization, goslings in both the immunized and challenge control groups were challenged with 0.1 mL of GAstV-GXNN strain (titer 10) orally per gosling. 6 TCID 50 / 0.1 mL), and the blank control group was inoculated with the same volume of DMEM / F12 medium. Clinical symptoms were observed and recorded daily after challenge for 14 consecutive days. On the 7th day after challenge, 5 goslings from each group were randomly selected for necropsy to observe organ pathological changes, and brain, heart, liver, spleen, and kidney tissues were collected. The viral load in each tissue was detected by real-time PCR.

[0052] The results showed that during the observation period, the survival rate of the challenged control group was 20%, and 10 2.0 TCID 50 The survival rate of the immunized group was 70%, while that of the 10 3.0 10 4.0 and 10 5.0 TCID 50 No goslings died in either the immunized group or the blank control group; the survival rate was 100%. Figure 9Clinical autopsy and histopathological examination results showed that 10 3.0 10 4.0 and 10 5.0 TCID 50 In the immunized group, all tissues and organs of the goslings were normal, with no obvious organ lesions, while the challenge control group and the 10 2.0 TCID 50 Clinical necropsy of goslings in the immunized group revealed significant organ lesions, including liver hemorrhage, kidney enlargement, and urate deposition. Tissue viral load testing showed that, compared to the challenged control group, 10 2 TCID 50 On day 7 post-infection, the viral load in the heart and spleen of the immunized group was significantly lower (p < 0.05), while there were no significant differences in other organs compared with the challenged control group (p > 0.05). Meanwhile, 10 3 10 4 and 10 5 TCID 50 The viral load in the tissues of all organs (heart, liver, spleen, kidney, and brain) of the immunized group was significantly lower than that of the challenged control group (p < 0.01). Figure 10 The above results indicate that 10 2 TCID 50 Immunization doses only provide partial protection against infection with virulent GAstV strains, while 10 3 10 4 and 10 5 TCID 50 An immunization dose can provide almost complete protection, and the higher the immunization dose, the better the protection.

Claims

1. A candidate strain of goose astrovirus attenuated vaccine, with accession number CCTCC No:V202564 and accession date of September 17, 2025.

2. The attenuated vaccine candidate of goose astrovirus according to claim 1, characterized in that: The complete genome sequence of the virus is the base sequence of SEQ ID NO.

1.

3. The attenuated vaccine candidate of goose astrovirus according to claim 1, characterized in that: The viral titer of the virus reached 10. 7.35 TCID 50 / mL.

4. The use of the attenuated live vaccine candidate strain of goose astrovirus according to claim 1 in the preparation of goose astrovirus vaccine.

5. Use according to claim 4, characterized in that: The vaccine in question is a live attenuated vaccine.

6. Use according to claim 4, characterized in that: The vaccine in question is an oral vaccine.

7. A live attenuated vaccine of goose astrovirus, characterized in that Prepared using the attenuated live vaccine candidate strain of goose astrovirus as described in claim 1.

8. The attenuated live vaccine of goose astrovirus according to claim 7, characterized in that Each dose of vaccine is 10 3 -10 5 TCID 50 .

Images