Application of Rosa davurica RlETC2 gene in inhibiting epidermal hair formation of plants

By cloning and expressing the RlETC2 gene of Rosa laevigata, the formation of epidermal hairs was inhibited and stress resistance was enhanced, solving the molecular regulation problem of thorns on the stems, leaves, and fruits of Rosa laevigata. This enabled the breeding of less-thorn/thornless Rosa laevigata plants and the improvement of stress resistance, promoting the large-scale and standardized development of the industry.

CN122326656APending Publication Date: 2026-07-03GUANGXI BOTANICAL GARDEN OF MEDICINAL PLANTS
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610712927.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-05-22
Publication Date
2026-07-03

AI Technical Summary

Technical Problem

The stems, leaves, and fruits of Rosa laevigata are covered with sharp thorns and bristles, which can cause injuries to workers during cultivation and harvesting, increase labor costs and operational difficulties. Furthermore, current technologies have not revealed its molecular regulatory mechanisms and lack functional genes that can be used for breeding, thus hindering the development of the industry.

Method used

The RlETC2 gene of Rosa laevigata was cloned, and transgenic plants were cultivated by upregulating the expression of negative regulators of endogenous epidermal hairs in plant aboveground organs and downregulating the expression of positive regulators. This synergistically inhibited epidermal hair formation and enhanced the ability to scavenge reactive oxygen species under drought and salt stress.

Benefits of technology

This study achieved stable inhibition of epidermal hairs in Rosa laevigata, reduced cultivation and processing costs, improved the drought and salt tolerance of the plants, and promoted the breeding of new Rosa laevigata varieties and the standardized development of the industry.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122326656A_ABST
    Figure CN122326656A_ABST
Patent Text Reader

Abstract

This invention discloses the application of the RlETC2 gene of Rosa laevigata in inhibiting the formation of epidermal hairs in plants. Addressing the technical challenge of harvesting and processing Rosa laevigata due to the presence of thorns and bristles on the stems, leaves, and fruits, this invention constructs the coding sequence of the RlETC2 gene into the vector pBI121, transforming it into Arabidopsis thaliana to obtain overexpressing plants. Phenotypic verification shows that the transgenic plants have significantly fewer above-ground epidermal hairs on leaves and stems than the wild type, and significantly reduced root hair length. Furthermore, the expression of endogenous epidermal hair negative regulators AtCPC, AtTRY, and AtETC1 is upregulated, while the expression of positive regulators AtGL1, AtGL3, and AtTTG1 is downregulated. In addition, this gene can enhance the scavenging capacity of reactive oxygen species in plant cells under drought and / or salt stress conditions while inhibiting epidermal hair formation, significantly improving the seed germination rate, taproot length, and plant survival rate of transgenic plants under adverse conditions.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant gene technology, specifically to the application of the RlETC2 gene of Rosa laevigata in inhibiting the formation of epidermal hairs in plants. Background Technology

[0002] Golden cherry ( Rosa laevigata Michx. is a genus of Rosa in the family Rosaceae. Rosa Rosa laevigata, an evergreen climbing shrub, is a traditional and widely used medicinal herb in my country, with both its roots and fruits used in medicine. Market demand for it is steadily increasing. Currently, Rosa laevigata resources mainly rely on wild harvesting. To meet medicinal needs and protect wild resources, artificial cultivation has become an essential path for the sustainable development of the industry.

[0003] However, in the artificial cultivation of Rosa laevigata, a prominent technical challenge severely restricts its industrial development: the stems, leaves, and fruits of Rosa laevigata are covered with numerous sharp thorns and bristles. The presence of these thorns easily causes injury to workers during cultivation and harvesting, significantly increasing labor costs and operational difficulty, and reducing harvesting efficiency. Furthermore, the thorns must be removed from the Rosa laevigata fruit before it can be used medicinally, further increasing processing costs. Therefore, how to effectively reduce or eliminate the thorns of Rosa laevigata has become a key technical bottleneck that urgently needs to be addressed to achieve its large-scale, intensive cultivation.

[0004] Epidermal trichomes are structures differentiated from plant epidermal cells. Spurs and hairs are spiny structures formed by the specialization of plant epidermal cells or a few cortical cells, and are a special type of epidermal trichome. The formation of plant epidermal trichomes is controlled by multiple regulatory factors. In model plants such as Arabidopsis thaliana, studies have found... TRIPTYCHON ( TRY ) CAPRICE ( CPC )as well as ENHANCER OF TRY AND CPC 2 ( ETC2 Genes such as [list of genes] have been identified as negative regulators of trichome development, and their loss of function leads to increased trichome growth. This indicates that negative regulators play a crucial role in inhibiting trichome formation in plants. However, functional studies of these known genes have mainly focused on model plants. In medicinal plants with significant economic value, such as Rosa laevigata, the key genes regulating thorn or trichome development have not yet been revealed, and their specific molecular regulatory mechanisms remain unknown.

[0005] On the other hand, cultivation practices of Rosa laevigata have revealed that abiotic stresses such as drought and high salinity increase the number and hardness of its thorns, suggesting a potential cross-linking relationship between thorn development regulation and plant stress response pathways. However, current technologies have not yet identified functional genes simultaneously involved in both thorn development regulation and stress response in Rosa laevigata, and the synergistic regulatory mechanism between the two remains completely unclear.

[0006] In summary, the core technical deficiencies in this field are as follows: although negative regulators of epidermal hair development have been identified in model plants, the molecular regulatory mechanism of prickly / hairy development in Rosa laevigata, a unique medicinal and edible plant, remains a research gap; functional genes in Rosa laevigata that can stably inhibit epidermal hair / thorn formation have not yet been cloned, nor have their functions in stress response been revealed. There is an extreme lack of core gene resources that can be directly used for molecular breeding of less-thorned / thornless Rosa laevigata, which seriously hinders the cultivation of superior new varieties of Rosa laevigata and the standardized development of the industry. Summary of the Invention

[0007] One object of the present invention is to address at least the aforementioned deficiencies and to provide at least the advantages that will be described later.

[0008] The present invention is based on the rosehip. RlETC2 Application of genes in inhibiting the formation of epidermal hairs in Rosa laevigata RlETC2 The gene coding sequence is shown in SEQ ID NO.1, and the plant is Arabidopsis thaliana or a plant of the Rosaceae family.

[0009] Preferably, the rosehip is... RlETC2 The gene synergistically inhibits the formation of epidermal hairs in plant aboveground organs by upregulating the expression of negative regulators of endogenous epidermal hairs and downregulating the expression of positive regulators of endogenous epidermal hairs.

[0010] Preferably, plants of the Rosaceae family include Rosa laevigata, Rosa chinensis, Rosa rugosa, and Rosa rugosa.

[0011] Preferably, the present invention, while inhibiting the formation of epidermal hairs on the aboveground organs of plants, enhances the ability of plant cells to scavenge reactive oxygen species under drought and / or salt stress conditions, thereby improving the drought resistance and / or salt resistance of plants.

[0012] Preferably, the endogenous epidermal hair negative regulatory factor includes Arabidopsis thaliana. AtCPC, AtTRY and / or AtETC1 The endogenous epidermal hair positive regulator includes Arabidopsis thaliana. AtGL1, AtGL3 and / or AtTTG1 .

[0013] Cultivation of overexpressed Rosa laevigata RlETC2 Methods for producing transgenic plants with suppressed genes and terrestrial organ epidermal hair formation include: S1. Take the Rosa laevigata shown in SEQ ID NO.1. RlETC2 The gene coding sequence and the plant expression vector pBI121 were respectively used Xba I and Xma I was subjected to double enzyme digestion, and the digested target gene fragment was recovered and ligated with the linearized vector fragment for transformation to obtain the pBI121-RlETC2 recombinant plasmid.

[0014] S2. pBI121-RlETC2 was transformed into Agrobacterium strain EHA105 by freeze-thaw method to obtain a positive Agrobacterium engineered strain containing the pBI121-RlETC2 recombinant plasmid.

[0015] S3. Wild-type Arabidopsis thaliana Col-0 ecotype was transformed using a positive Agrobacterium tumefaciens engineered strain via inflorescence immersion method to obtain T0 generation transgenic Arabidopsis thaliana seeds.

[0016] S4. After sterilizing the T0 generation transgenic Arabidopsis seeds, they were evenly sown on 1 / 2 MS solid medium containing 50 mg / L kanamycin for resistance screening to obtain T1 generation transgenic Arabidopsis plants.

[0017] S5. Genomic DNA was extracted from the T1 generation transgenic Arabidopsis plants, using the upstream primer of the vector 35S promoter as shown in SEQ ID NO.2 and the primer shown in SEQ ID NO.3. RlETC2 Gene-specific downstream primers were used for polymerase chain reaction identification, and T1 generation positive transgenic Arabidopsis plants were obtained through screening.

[0018] S6. T1 generation positive transgenic Arabidopsis plants were cultivated and continuously propagated to the T3 generation. Each generation underwent selection for resistance to 50 mg / L kanamycin and identification by polymerase chain reaction to obtain stably inherited overexpression. RlETC2 Homozygous transgenic Arabidopsis thaliana plants.

[0019] Preferably, before the culture step of resistance screening, the method further includes: vernalizing the culture medium after sowing at 4°C in the dark for 2 days.

[0020] The present invention has at least the following beneficial effects: 1. This invention is the first to clone from Rosa laevigata. RlETC2 The gene was identified and its core function of inhibiting the formation of epidermal hairs on aboveground plant organs was verified. This provides a direct molecular breeding target for solving the problem of thorn damage in the cultivation and harvesting of Rosa laevigata. It achieves targeted regulation of the number of epidermal hairs / thorns from the genetic source, laying the foundation for core gene resources for breeding new varieties of Rosa laevigata with fewer or no thorns. It has significant application value for reducing the cultivation and processing costs of Rosa laevigata and promoting the large-scale and standardized development of the industry.

[0021] 2. This invention clarifies the characteristics of Rosa laevigata. RlETC2 The gene's regulatory mechanism was confirmed to synergistically inhibit epidermal hair development by upregulating the expression of negative regulators of endogenous epidermal hair and downregulating the expression of positive regulators. This conforms to the classic regulatory model of plant epidermal hair development. The gene function is clear and the mechanism of action is well understood, providing a solid theoretical basis for the application of this gene in other plants of the Rosaceae family.

[0022] 3. This invention is the first to disclose the secret of Rosa laevigata. RlETC2 While inhibiting the formation of epidermal hairs in plants, the gene can significantly enhance the ability of plant cells to scavenge reactive oxygen species under drought and / or salt stress conditions, and improve the seed germination rate, taproot length and survival rate of plants under adverse conditions. It has achieved the simultaneous improvement of plant morphology and stress resistance through single gene manipulation, significantly improved the comprehensive agronomic traits and environmental adaptability of transgenic plants, and expanded the application scenarios and breeding value of genes.

[0023] 4. This invention provides a complete, reproducible, and standardized overexpression protocol. RlETC2 The method for cultivating transgenic plants covers the entire process of vector construction, Agrobacterium-mediated transformation, genetic transformation, resistance screening, positive identification, and homozygous line cultivation. Those skilled in the art can reliably obtain transgenic lines with clear genetic background, high expression of target genes, and stable phenotypes by following this method, providing reliable technical support and experimental material basis for in-depth research on gene function and subsequent molecular breeding applications.

[0024] 5. This invention, through complete phenotypic verification, molecular mechanism verification, and stress resistance function verification, forms a complete chain of experimental evidence, fully demonstrating the efficacy of Rosa laevigata. RlETC2 The gene function experiment was rigorously designed, the data is reproducible, the results are reliable, and the technical solution has strong practicality and industrial feasibility. Attached Figure Description

[0025] Picture 1 for RlETC2 Electrophoresis diagram of gene overexpression vector construction and restriction enzyme digestion identification, where M is DL2000 DNA Marker; 1 is... Xba I and Xma 1 is the product of enzyme digestion of recombinant plasmid pBI121-RlETC2; 2 is the undigested recombinant plasmid pBI121-RlETC2. Picture 2 This is a phenotypic and statistical analysis chart of epidermal and root hairs in the RlETC2-OE transgenic Arabidopsis thaliana of this invention. A is a phenotypic chart of epidermal hairs in the transgenic Arabidopsis thaliana; B is a statistical chart of epidermal hairs on the leaves and stems of 30-day-old transgenic Arabidopsis thaliana seedlings, with the vertical axis representing the number of epidermal hairs (number / cm²). 2 C represents the root hair density statistics of wild-type WT and RlETC2-OE transgenic lines at 5 days of age, with the vertical axis representing root hair density (number of root hairs / mm). 2 D is a statistical graph of root hair length of wild-type WT and RlETC2-OE transgenic lines at 5 days of age, with the vertical axis representing root hair length (mm). Picture 3This diagram shows the expression of endogenous genes related to epidermal trichome development in Arabidopsis wild-type WT and RlETC2-OE transgenic lines. The upper diagram shows genes negatively regulating epidermal trichome development. AtCPC, AtTRY, AtETC1 The relative expression levels of genes positively regulating epidermal hair are shown in the figure below. AtGL1, AtGL3, AtTTG1 The relative expression levels are shown on the ordinate, with the internal reference gene being [missing information]. AtActin2 ; Picture 4 The figure shows the seed germination rate analysis of Arabidopsis wild-type WT and RlETC2-OE transgenic lines under drought and salt treatment. The left side is the NaCl salt stress treatment group, and the right side is the mannitol simulated drought stress treatment group. The vertical axis is the seed germination rate (%), and the horizontal axis is the treatment time (h). Picture 5 This is a statistical analysis of the taproot length of Arabidopsis wild-type WT and RlETC2-OE transgenic lines under drought and salt treatment. The vertical axis represents taproot length (cm). Picture 6 Figure 1 shows the analysis of Arabidopsis wild-type WT and RlETC2-OE transgenic lines under drought and salt treatment. Figure 2 shows the seedling phenotypes of wild-type WT and RlETC2-OE transgenic lines after drought and salt treatment; Figure 3 shows the survival rate of WT and RlETC2-OE plants after drought and salt treatment, with the vertical axis representing survival rate (%); Figure 4 shows the expression levels of stress response genes in WT and RlETC2-OE transgenic lines after drought and salt treatment. AtKIN1, AtCOR15A, AtRD29A Genes related to drought stress; AtNHX1, AtDREB2A, AtSOS1 The vertical axis represents genes related to salt stress, and the vertical axis represents relative expression levels. Picture 7 Figures show the physiological and biochemical assays of wild-type Arabidopsis thaliana WT and RlETC2-OE transgenic lines under drought and salt treatment. Figure A shows the histochemical staining of the WT and RlETC2-OE transgenic lines using Evans Blue staining, NBT reduction, and DAB colorimetric methods. Figure B shows the analysis of physiological parameters of the WT and RlETC2-OE transgenic lines after stress treatment. The measured parameters include malondialdehyde (MDA) content (nmol / g FW), proline (Pro) content (µg / g FW), superoxide dismutase (SOD) activity (U / g FW), and hydrogen peroxide (H2O2) content (µmol / g FW). The data in the above figures are the mean ± standard error of three biological replicates. * indicates a significant difference at the P<0.05 level, and ** indicates a highly significant difference at the P<0.01 level. ANOVA one-way ANOVA was used, and Duncan's test was employed. Detailed Implementation

[0026] The present invention will be further described in detail below with reference to embodiments, so that those skilled in the art can implement it based on the description.

[0027] Golden Cherry RlETC2 Application of genes in inhibiting the formation of epidermal hairs in Rosa laevigata RlETC2 The gene coding sequence is shown in SEQ ID NO.1, and the plant is Arabidopsis thaliana or a plant of the Rosaceae family.

[0028] Furthermore, Rosa laevigata RlETC2 The gene synergistically inhibits the formation of epidermal hairs in plant aboveground organs by upregulating the expression of negative regulators of endogenous epidermal hairs and downregulating the expression of positive regulators of endogenous epidermal hairs.

[0029] Furthermore, plants in the Rosaceae family include Rosa laevigata, Rosa chinensis, Rosa rugosa, and Rosa peruviana.

[0030] Example 1 Cultivate overexpression RlETC2 The method for producing transgenic plants includes the following steps: Step 1: Based on the genome and transcriptome data of Rosa laevigata previously sequenced by our research group, we cloned Rosa laevigata. RlETC2 The gene, whose coding sequence is shown in SEQ ID NO.1: ATGCAAAAAATGGACCGATGTCGTCGGAAGCGACCCAAAATCACTACTTCTGATCAATCTGAAGAGGTTGTTAGCAGTGAATGGGAGTTCATTCATATGAGTGAGCAAGAAGAAGATCTCATCTATAGAATGTATAGACTTGTCGGAGAAAGGTGG GATTTAATAGCTGGTCGGGTTCCGGGTCGAACAGCAGTAGAATTGGAGAGGTTTTGGATAATGAGACATTGTGAGGTTTGCTGAGAAACGAAGGAAGCATAAGAAAGAAAACTCAAAAATTGTTCCGCGTCAAACTTTCAGTGGATTTGGATAG.

[0031] The detection primers are as follows: SEQ ID NO. 2: GACGCACAATCCCACTATCCTT.

[0032] SEQ ID NO. 3: CCTCAGCAAACACCTCACAA.

[0033] Construct the pBI121-RlETC2 overexpression vector and use Xba I and Xma I. Two restriction endonucleases RlETC2 The gene and pBI121 vector were double-digested, ligated, and transformed into *E. coli* Trans 5α. The vector was then used with the upstream primer of the 35S promoter (as shown in SEQ ID NO.2) and... RlETC2 Gene-specific downstream primers (as shown in SEQ ID NO.3) were used to perform PCR detection on single-clone colonies, which were then sequenced. Positive colonies with correct sequencing results were used to extract plasmids using the SanPrep column-based plasmid DNA miniature extraction kit (Shanghai Sangon Biotech Co., Ltd.), following the manufacturer's instructions. The extracted plasmids were stored at -40°C for later use.

[0034] Step 2: Transform the pBI121-RlETC2 plasmid into Agrobacterium strain EHA105 using the freeze-thaw method to obtain an engineered Agrobacterium strain containing the pBI121-RlETC2 recombinant plasmid. Method: Take competent Agrobacterium cells EHA105 stored at -80℃, partially thaw them on ice, add 1 µg of pBI121-RlETC2 plasmid (volume ≤10 µL), gently tap the bottom of the tube to mix, and incubate on ice for 5 minutes. Heat shock the mixture in a 42℃ water bath for 45 seconds, then quickly return it to the ice bath for 2 minutes. Add 700 µL of antibiotic-free LB liquid medium and incubate at 28℃ with shaking at 150-200 rpm for 2-3 hours to restore bacterial activity. After centrifugation to collect the bacterial cells, spread them on LB agar plates containing 50 mg / L kanamycin (plasmid resistance) and 25 mg / L rifampin (strain resistance), and incubate upside down at 28℃ for 48-60 hours. Single colonies were picked and used with the upstream primer of the vector 35S promoter and RlETC2 Gene-specific downstream primers (same as the detection primers in step one) were used for PCR detection to obtain positive Agrobacterium engineered strains containing the pBI121-RlETC2 recombinant plasmid.

[0035] Step 3: Transform wild-type Arabidopsis thaliana plants (WT, Col-0 ecotype) using Agrobacterium-mediated transformation via inflorescence contamination to obtain T0 generation transgenic Arabidopsis seeds. Method: Transformed Agrobacterium was isolated by streaking onto YEP solid medium containing kanamycin (50 mg / L) and rifampin (25 mg / L). After incubation at 28°C for 48-72 hours, single colonies were picked and amplified sequentially by shaking in 1 mL and 150 mL of YEP liquid medium containing the same concentration of antibiotics to OD. 600 The bacterial cell concentration reached 1.5-2.0. The cells were collected by centrifugation (8000 g, 5 min) and resuspended in 150 mL of infiltration buffer (1 / 2 MS liquid medium + 5% sucrose, pH 5.7, with 0.05% Silwet L-77 conversion aid) to OD.600 The value reached 0.8-1.0. The Arabidopsis inflorescences were completely immersed in the inoculum for 1 minute and cultured in the dark for 24 hours; the infection was repeated once after 5-7 days. Once the seeds matured, the T0 generation seeds were collected, dried at 37℃, and then stored at 4℃ for later use.

[0036] Step 4: On a clean bench, soak the T0 generation transgenic Arabidopsis seeds in 75% alcohol for 30 seconds, rinse once with sterile water, then sterilize by soaking in 20% sodium hypochlorite solution for 10 minutes, and rinse 4-6 times with sterile water. Spread the sterilized seeds evenly on 1 / 2 MS solid medium containing 50 mg / L kanamycin and treat them at 4°C for 2 days. Transfer them to a constant temperature and light incubator and culture them at 23°C for 16 hours of light and 8 hours of darkness for 10-12 days. Select green seedlings that can grow normally on the resistant medium (i.e., T1 generation transgenic plants). Transplant the seedlings into a nutrient substrate with a peat moss:vermiculite volume ratio of 4:1 and continue to culture them under the same conditions.

[0037] Step 5: Extract DNA from the T1 generation transgenic Arabidopsis plants. Place 3 to 4 fresh Arabidopsis leaves in a 2 mL centrifuge tube, add a grinding steel ball, and grind at 70 Hz for 120 seconds until powdery. Add 1200 μL of preheated CTAB lysis buffer (65℃), vortex to mix, and incubate at 65℃ for 60-90 minutes, inverting to mix every 15 minutes. After cooling, add 600 μL of chloroform, manually invert to mix, and centrifuge at 12000 r / min for 8 minutes. Take 700 μL of supernatant and repeat the chloroform extraction once. Add 0.7 times the volume of pre-chilled isopropanol to the supernatant, mix, and incubate at -20℃ for 30 minutes. Centrifuge at 12000 r / min for 8 minutes and discard the supernatant. Wash the precipitate twice with 75% ethanol (centrifuge at 12000 r / min for 2 minutes), air dry, add 30-50 μL of TE buffer to dissolve the DNA, and store at -20℃ for later use.

[0038] The extracted DNA was identified by PCR using the detection primers from step one, and T1 generation positive transgenic Arabidopsis plants were obtained through screening.

[0039] Step 6: Cultivate T1 generation positive transgenic Arabidopsis plants and continuously propagate them to the T3 generation to obtain stably inherited overexpression. RlETC2 Homozygous transgenic Arabidopsis thaliana plants. Propagation method is the same as in step four.

[0040] Example 2 Based on Example 1, the method also includes: phenotypic verification of homozygous transgenic Arabidopsis plants.

[0041] Phenotypic validation included: selecting T3 generation RlETC2-OE transgenic homozygous Arabidopsis lines OE2, OE12, and OE17, with wild-type (WT) Arabidopsis as a control. At the seedling stage (30 days after transplanting), the number of epidermal hairs on the 3rd to 6th rosette leaves was counted; simultaneously, the number of epidermal hairs on axillary buds and stem segments at the time of the first flower opening was counted; at the seedling stage (5 days after transplanting), the density and length of root hairs on the taproot were counted. All materials were grown under uniform culture conditions, and at least three independent biological replicates were set for each line's phenotypic observation to ensure the reliability and reproducibility of the results. Statistical analysis was performed on a unit area (1 cm²). 2 The number of epidermal hairs on leaves and stems, and the area per unit area (1 mm²). 2 The density and length of root hairs.

[0042] Observation and statistical analysis revealed that all three independent homozygous RlETC2-OE lines (OE2, OE12, and OE17) exhibited a significant phenotypic inhibition of aerial epidermal hairs, with their leaves and stems being almost completely smooth and lacking obvious epidermal hair distribution. The average statistical results for the three lines showed that the number of aerial epidermal hairs on wild-type WT leaves was 19.8 times that of the RlETC2-OE transgenic lines, and the number of epidermal hairs on the aerial stems of wild-type WT was 38.7 times that of the RlETC2-OE transgenic lines. The root hair density of the RlETC2-OE lines was slightly increased compared to wild-type WT, but the root hair length was significantly reduced; the average root hair length of wild-type WT was 1.2 times that of the RlETC2-OE lines (results shown in Figure 2).

[0043] The above results indicate that Rosa laevigata RlETC2 Heterologous overexpression of the gene in Arabidopsis thaliana significantly inhibited the initiation and development of epidermal hairs in the aboveground organs of the plant, while also having a negative regulatory effect on the elongation of root hairs, confirming that the gene is a negative regulatory gene for the development of plant epidermal hairs.

[0044] Example 3 Based on Example 1, the method also includes: detection of endogenous gene expression levels in transgenic Arabidopsis thaliana.

[0045] Total RNA was extracted from leaves of T3 generation RlETC2-OE transgenic homozygous Arabidopsis thaliana lines OE2, OE12, OE17 and wild-type (WT) control Arabidopsis thaliana using the RNA perp Pure Polysaccharide-Polyphenol Plant Total RNA Extraction Kit DP441 (Tiangen, Beijing). RNA was reverse transcribed into cDNA using the Reverse Transcriptase M-MLV kit (TaKaRa, Dalian) as a template. AtActin2 As internal reference genes, real-time quantitative PCR (qRT-PCR) was used to detect key regulatory genes (including negative regulators) in the development of endogenous epidermal trichomes in Arabidopsis thaliana. AtCPC, AtTRY and AtETC1 and positive regulatory factors AtGL1, AtGL3, AtTTG1 The expression level of ). Primer design is as follows: AtActin2-F:GCAGAGCGGGAAATTGTAAG; AtActin2-R:GTACAGATCCTTCCTGATATCC; AtCPC-F: CTTCTTGTTCCGAAGAGGTG; AtCPC-R: CAACGAGTTTATACATCCGA; AtTRY-F: AGACTTGTCGGTGATAGGTG; AtTRY-R:TTGGTATGTTTTGGGAAGAT; AtETC1-F:GTGAGCAGTCTTGAGTGGGAA; AtETC1-R:TCCTGGAATCCTCCCAGCTA; AtGL1-F: CTCGGCAATAGATGGTCTTT; AtGL1-R:AGTAATCTCCGACGAGTTTTTT; AtGL3-F:CAATGTTGGTGAAGCCGAGC; AtGL3-R: CGGTCGAGGATTGAACCGAA; AtTTG1-F: AGAGGTTCATGACATTGCTT; AtTTG1-R: GCTGAGGACTCTCGTAAAATG.

[0046] qRT-PCR analysis showed that in RlETC2-OE transgenic plants, endogenous negative regulatory genes... AtCPC, AtTRY and AtETC1 The expression levels of these genes were significantly higher than those of WT. Conversely, the expression levels of endogenous positively regulated genes were significantly higher. AtGL1 , AtGL3 and AtTTG1 The expression levels of these components were all lower than those of WT (results are shown below). Picture 3 The above results indicate that... RlETC2 Overexpression of the gene in Arabidopsis thaliana synergistically inhibits the development of epidermal hairs by upregulating the transcription of endogenous negative regulators and inhibiting the transcription of endogenous positive regulators.

[0047] Example 4 Based on Example 1, the method also includes: verifying the stress resistance of homozygous transgenic Arabidopsis thaliana plants.

[0048] Stress resistance verification included: drought stress verification: using mannitol containing 300 mM and 400 mM. Seedlings were sown and treated with 1 / 2 MS medium, and the seedlings were subjected to natural drought treatment or sprayed with 7% PEG 6000 solution. Salt stress verification: seedlings were sown and treated with 1 / 2 MS medium containing 100 mM and 150 mM NaCl, and the seedlings were sprayed with 300 mM NaCl solution.

[0049] Among them, the root length, survival rate, or seed germination rate of homozygous transgenic Arabidopsis plants were significantly higher than those of wild-type Arabidopsis plants.

[0050] Evaluation of abiotic stress tolerance of transgenic plants I. Experimental Materials 1. Transgenic plants: T3 generation RlETC2-OE transgenic homozygous lines Arabidopsis thaliana OE2, OE12, and OE17 obtained according to the method in Example 1.

[0051] 2. Control plants: Wild-type Arabidopsis thaliana (WT) with the same genetic background as the transgenic plants.

[0052] 3. Culture conditions: All materials were grown in a standard light culture chamber with a light cycle of 16 hours of light and 8 hours of darkness, and the temperature was kept constant at 23℃.

[0053] 4. Experimental grouping and control setup: All experiments included independent control and treatment groups, with each group having three biological replicates, as detailed below: 1. Blank control group: wild-type WT Arabidopsis thaliana cultured under normal conditions and RlETC2-OE transgenic Arabidopsis thaliana; 2. Negative control group: Arabidopsis thaliana transfected with the empty pBI121 vector cultured under normal conditions (empty vector control). 3. Stress control group: Wild-type WT Arabidopsis thaliana treated with drought / salt stress; 4. Stress treatment group: RlETC2-OE transgenic Arabidopsis thaliana lines OE2, OE12, and OE17 subjected to drought / salt stress.

[0054] All control and treatment groups were set up with 3 independent biological replicates.

[0055] II. Experiment: Tolerance of RlETC2-OE plants under drought and salt stress conditions 1. Seed germination experiment: WT and T3 generation Arabidopsis thaliana RlETC2-OE seeds were sown separately on 1 / 2 MS solid medium simulating drought stress (supplemented with 300 mM and 400 mM mannitol, respectively) and 1 / 2 MS solid medium simulating salt stress (supplemented with 100 mM and 150 mM NaCl, respectively), with 1 / 2 MS medium without stress reagents serving as a control. After vernalization at 4℃ for 2 days, the seeds were transferred to a light incubator. Germination was defined as the radicle breaking through the seed coat by more than 1 mm. Germination rate was recorded every 12 hours for 72 hours, and photographs were taken after 3 days.

[0056] 2. Root length phenotypic analysis: WT and T3 generation Arabidopsis thaliana RlETC2-OE seeds were sown on 1 / 2 MS medium without kanamycin. After vernalization at 4℃ for 2 days, they were transferred to a long-day incubator (23℃) for 3 days. Seedlings with uniform growth were selected and transferred to 1 / 2 MS solid medium simulating drought stress (supplemented with 300 mM and 400 mM mannitol, respectively) and 1 / 2 MS solid medium simulating salt stress (supplemented with 100 mM and 150 mM NaCl, respectively). 1 / 2 MS medium without stress reagents served as a control. After 5 days of vertical growth, the taproot length was measured and photographed. Five individual plants were tested for each line, and three biological replicates were performed for each treatment.

[0057] 3. Seedling phenotypic analysis: Transgenic T3 generation RlETC2-OE Arabidopsis thaliana seeds were sown on 1 / 2 MS solid medium without kanamycin. After 2 days of vernalization and 7-10 days of long-day cultivation, the seedlings were transplanted into vermiculite substrate and cultured under long-day conditions for another 7-10 days. Subsequently, the Arabidopsis seedlings underwent the following different treatments: (1) Tolerance test under drought stress: stop watering and allow natural drought treatment for 17 days, followed by re-watering for 2 days. Observe and record the plant survival rate and phenotype, and use plants that are continuously watered normally as controls.

[0058] (2) Tolerance test under salt stress: Spray 300 mM NaCl solution every 2-3 days for 7 days, observe and record the plant phenotype, and use the plant sprayed with an equal amount of water as the control.

[0059] 4. Histochemical staining and determination of physiological and biochemical indicators: Transgenic T3 generation RlETC2-OE Arabidopsis thaliana seeds were sown on 1 / 2 MS solid medium without kanamycin. After 2 days of vernalization and 7-10 days of long-day culture, the seedlings were transplanted into vermiculite substrate and cultured under long-day conditions for another 7 days. The seedlings were then divided into the following groups: the drought group was sprayed with 7% PEG 6000 solution; the salt treatment group was sprayed with 300 mM NaCl solution; and the control group was sprayed with an equal volume of water.

[0060] Histochemical staining: Leaves were taken for staining 48 hours after stress treatment.

[0061] Evans Blue staining: Live cells with intact membranes repel dye, while dead / damaged cells absorb the dye and turn blue, used to detect plant cell viability. Prepare a 2.5% (w / v) Evans Blue solution, completely immerse leaf samples in the staining solution, and stain at room temperature with gentle shaking for 2 hours. Remove chlorophyll with 95% ethanol, changing the ethanol every 30 minutes until the green color disappears. Rinse and photograph for record-keeping.

[0062] NBT staining: Nitroblue tetrazolium (NBT) and superoxide anion ( The reaction produces a blue, insoluble formazan precipitate, primarily used for the qualitative detection of superoxide anions in plant tissues. Prepare a 0.5 mg / mL NBT solution and store it in the dark at 2-8°C. Collect leaf samples and immerse them in the NBT staining solution, allowing them to stain at room temperature in the dark for 3 hours, until the stained area turns deep blue. Remove the chlorophyll with 95% ethanol, changing the ethanol every 30 minutes until the green color disappears completely. Rinse and photograph the sample.

[0063] DAB staining: Diaminobenzidine (DAB) reacts with hydrogen peroxide (H2O2) under the catalysis of peroxidase to form a brown polymer, which is used to detect the accumulation of H2O2 in plant tissues. Prepare a 1.0 mg / mL DAB solution (dissolved in water or buffer), freshly prepared and stored in the dark. Immerse leaf samples in the DAB solution in the dark for 8 hours, then transfer them to a light incubator (25℃) for color development, observing the formation of brown spots. Remove chlorophyll with 95% ethanol, changing the ethanol every 30 minutes until the green color disappears. Rinse and photograph for recording.

[0064] Physiological and biochemical index analysis: Forty-eight hours after stress treatment, the aboveground parts of the plants were collected, and the activities of malondialdehyde (MDA), proline (Pro), superoxide dismutase (SOD), and hydrogen peroxide (H2O2) were measured. All measurements were performed using the physiological index kit provided by Suzhou Mengxi Biomedical Technology Co., Ltd. Specific methodological procedures were described in the kit's instruction manual.

[0065] 5. Analysis of Endogenous Gene Expression Related to Drought and Salt: To further elucidate the molecular mechanisms of transgenic lines in response to drought and salt stress, following the method described in point 4, seedlings were treated with 7% PEG 6000 solution (simulating drought stress) or 300 mM NaCl solution (simulating salt stress) for 48 hours. Leaf samples were then collected, RNA was extracted, and reverse transcribed into cDNA, with water treatment serving as a control. Leaves of the treated lines were collected, RNA was extracted, and reverse transcribed into cDNA. Three drought-stress-related endogenous genes were selected. AtKIN , AtCOR15A and AtRD29A and 3 salt stress-related endogenous genes AtNHX1 , AtDREB2A and AtSOS1 The expression levels of these stress-related marker endogenous genes were detected by qRT-PCR, based on 2 −△△Ct The method normalizes the data, and each sample is technically replicated three times.

[0066] The primer design is as follows: AtKIN1-F: TGCCTTCCAAGCCGGTCAGA; AtKIN1-R: CTGCCGCATCCGATACACTCTT; AtCOR15A-F:TTCCACAGCGGAGCCAAGCA; AtCOR15A-R: AGCGGCGTAGATCAACGACTTC; AtRD29A-F: ATCACTTGGCTCCACTGTTGTTC; AtRD29A-R: ACAAAACACACATAAACATCCAAAGT; AtNHX1-F: AGCCTTCAGGGAACCACAAT; AtNHX1-R: CTCCAAAGACGGGTCGCATG; AtDREB2A-F: GACCTAAATGGCGACGATGT; AtDREB2A-R:TCGAGCTGAAACGGAGGTAT; AtSOS1-F: AGTGTAAGTTTCGGTGGGATC; AtSOS1-R:CACGCATGTTTACGGGTTTC.

[0067] III. Data Analysis: All experiments were independently repeated three times. Error bars represent the standard deviation (SD) of the data in the graph. All statistical analyses were performed using SPSS 25.0 software. The significance criteria were p<0.05 (marked with * or lowercase letter in the graph) and p<0.01 (**), based on the Duncan test. Bar charts were created using GraphPad Prism 9 software.

[0068] As shown in Figure 4, under normal, stress-free culture conditions, there was no significant difference in the final germination rate of RlETC2-OE transgenic plants and wild-type WT Arabidopsis seeds within 72 hours. However, the germination rate of RlETC2-OE seeds was significantly faster than that of wild-type WT seeds, indicating that... RlETC2 The gene can promote seed germination. After 6 days of cultivation in a light incubator, WT and RlETC2-OE plants grew uniformly and were green and healthy. Treatment with 300 mM and 400 mM mannitol, and 100 mM and 150 mM NaCl, inhibited the germination of WT and RlETC2 transgenic plants, but transgenic seeds germinated faster and earlier than WT seeds. Under 150 mM NaCl conditions, the germination rate of RlETC2-OE was approximately 2.7 times higher than that of WT after 48 hours. Under 400 mM mannitol conditions, WT seed germination was strongly inhibited, with the germination rate remaining below 15% for 72 hours, while the germination rate of the RlETC2-OE line remained at approximately 37%, with some lines showing a continuous increase in germination rate between 48 and 72 hours, demonstrating significant stress adaptation and recovery capabilities. RlETC2 Genes may play a positive regulatory role in plant responses to drought and salt stress, which may help improve seed germination ability under stress conditions.

[0069] according to Picture 5 It was found that, under normal culture conditions, there was no significant difference in taproot length between the transgenic lines and WT Arabidopsis thaliana after drought and salt stress treatments, indicating that gene overexpression did not significantly affect the basal root development of plants in a stress-free environment. Treatment with 300 mM and 400 mM mannitol, and 100 mM and 150 mM NaCl, significantly inhibited the growth of WT, manifested as leaf yellowing, narrowing of petioles, and inhibited taproot growth, while the inhibition on the RlETC2-OE line was less severe. The root system of RlETC2-OE plants grew better and longer than that of WT plants, with the average taproot length of RlETC2-OE plants being longer than that of WT. RlETC2 The gene can significantly alleviate the inhibition of taproot growth by drought and salt stress, enhance the root development ability of plants under adverse conditions, and thus systematically improve their tolerance to abiotic stress.

[0070] according to Picture 6 As shown in A and 6B, under normal culture conditions, both WT and RlETC2-OE Arabidopsis thaliana plants exhibit a green and healthy state. After drought and rehydration treatments, most RlETC2-OE transgenic plants remained green, while a few plants lost their green color and withered, whereas most WT plants withered or even died. RlETC2 The survival rate of the RlETC2-OE Arabidopsis thaliana was significantly higher than that of the WT (WT-treated) plants. The survival rates of WT and RlETC2-OE plants were approximately 12.0% and 63.0%, respectively. The RlETC2-OE plants sprayed with NaCl solution did not grow as well as those treated with drought, but were still better than the WT plants. The survival rates of the WT and RlETC2 transgenic Arabidopsis thaliana were approximately 17.0% and 50.0%, respectively. RlETC2 Overexpression of the gene significantly enhances the drought and salt stress tolerance of Arabidopsis thaliana.

[0071] according to Picture 6 C indicates that there was no significant difference in the expression levels of three drought stress-related genes and three salt stress-related genes between RlETC2-OE transgenic plants and WT plants. After treatment with 7% PEG 6000 and 300 mM NaCl, both drought and salt stress-related genes were upregulated to some extent in WT and RlETC2-OE plants, with higher expression levels in RlETC2-OE plants than in WT plants. These genes can systematically activate key genes in multiple stress signaling pathways (such as...). AtNHX1, AtDREB2A, AtSOS1, AtRD29A, AtKIN1, AtCOR15A The expression of (etc.) enhances the plant's adaptation and defense response to adversity at the transcriptional level.

[0072] according to Picture 7 It was found that under normal growth conditions, there was no significant difference in color between WT and RlETC2-OE plants. Under drought and salt stress, the Evans blue color of all lines of both WT and RlETC2-OE transgenic plants became significantly darker, especially in WT, indicating that the living cells of WT plants suffered more severe damage after drought stress. The staining of NBT on the leaves was significantly deepened, and blue spots appeared on all plants. The staining of WT plants was more severe, indicating that the transgenic Arabidopsis thaliana... The content was lower than that of the control plants, thus improving the plants' stress resistance. DAB stained the leaves of WT plants dark yellowish-brown with many dark brown spots, while the leaves of RlETC2 transgenic plants stained light yellowish-brown.

[0073] Under non-stress conditions, there were no significant differences in MDA, Pro, SOD enzyme activities, and H2O2 content among different strains. After drought and salt treatment, the MDA and superoxide anion content of RlETC2-OE plants were significantly different. The content of Pro and H2O2 in RlETC2-OE plants was significantly lower than that in WT plants; the content of Pro and SOD enzyme activity in RlETC2-OE plants were both higher than those in WT plants, indicating that... RlETC2 The gene has a stronger ability to mitigate oxidative damage and maintain cell membrane stability.

[0074] In conclusion, Cherry Blossom RlETC2 Gene overexpression can simultaneously achieve significant inhibition of Arabidopsis epidermal hairs and enhance drought and salt stress tolerance, realizing a gene function with multiple effects from a single factor, and providing core gene resources and technical support for molecular breeding of Rosaceae plants (especially Rosa laevigata).

[0075] Although embodiments of the present invention have been disclosed above, they are not limited to the applications listed in the specification and embodiments. It can be applied to various fields suitable for the present invention. Further modifications can be readily implemented by those skilled in the art.

Claims

1. Rosa laevigata RlETC2 The application of genes in suppressing the formation of plant epidermal hairs is characterized by, Rosa davurica RlETC2 The coding sequence of the gene is shown in SEQ ID NO. 1, the plant is Arabidopsis thaliana or Rosaceae.

2. The application as described in claim 1, characterized in that, The golden cherry RlETC2 The gene synergistically inhibits the formation of epidermal hairs in plant aboveground organs by upregulating the expression of negative regulators of endogenous epidermal hairs and downregulating the expression of positive regulators of endogenous epidermal hairs.

3. The application as described in claim 1, characterized in that, Rosaceae plants include Rosa laevigata, Rosa chinensis, Rosa rugosa, and Rosa rugosa.

4. The application as described in claim 1, characterized in that, While inhibiting the formation of epidermal hairs on aboveground plant organs, it enhances the ability of plant cells to scavenge reactive oxygen species under drought and / or salt stress conditions, thereby improving the drought and / or salt tolerance of plants.

5. The application as described in claim 2, characterized in that, The endogenous epidermal hair negative regulatory factors include Arabidopsis thaliana. AtCPC, AtTRY and / or AtETC1 The endogenous epidermal hair positive regulator includes Arabidopsis thaliana. AtGL1, AtGL3 and / or AtTTG1 .

6. Cultivation of overexpressing Rosa laevigata RlETC2 A method for producing transgenic plants with suppressed genes and inhibited formation of epidermal hairs on above-ground organs, characterized in that... include: The Rosa laevigata shown in SEQ ID NO.1 RlETC2 The gene coding sequence and the plant expression vector pBI121 were respectively used Xba I and Xma I was subjected to double enzyme digestion, and the digested target gene fragment was recovered and ligated with the linearized vector fragment for transformation to obtain the pBI121-RlETC2 recombinant plasmid. pBI121-RlETC2 was transformed into Agrobacterium strain EHA105 by freeze-thaw method to obtain a positive Agrobacterium engineered strain containing the pBI121-RlETC2 recombinant plasmid. The positive Agrobacterium engineered strain was used to transform wild-type Arabidopsis thaliana Col-0 ecotype by inflorescence immersion method to obtain T0 generation transgenic Arabidopsis thaliana seeds. After sterilization, T0 generation transgenic Arabidopsis seeds were evenly sown on 1 / 2 MS solid medium containing 50 mg / L kanamycin for resistance screening to obtain T1 generation transgenic Arabidopsis plants. Genomic DNA was extracted from the T1 generation transgenic Arabidopsis plants, and the upstream primer of the vector 35S promoter as shown in SEQ ID NO.2 and the primer shown in SEQ ID NO.3 were used. RlETC2 Gene-specific downstream primers were used for polymerase chain reaction identification, and T1 generation positive transgenic Arabidopsis plants were obtained through screening. T1 generation positive transgenic Arabidopsis plants were cultivated and continuously propagated to the T3 generation. Each generation was screened for resistance to 50 mg / L kanamycin and identified by polymerase chain reaction, thus obtaining stably inherited overexpression. RlETC2 Homozygous transgenic Arabidopsis thaliana plants.

7. The method as described in claim 6, characterized in that, Before the culture step for resistance screening, the following steps are also included: the culture medium after sowing is vernalized at 4°C in the dark for 2 days.