Dendrocalamushookeriana su sy2-sut4-sweet5 gene tandem module and application thereof

Abstract

The application discloses a kind of SuSy2-SUT4-SWEET5 gene tandem modules of Liangshan dendrocalamus, comprising: promoter 35S, DfSuSy2 gene, 3×Flag label, self-cleavage small peptide P2A, DfSWEET5 gene, 3×HA label, DfSUT4 gene and EGFP label;The permutation and combination is 35S::DfSUSy2-3×Flag-P2A-DfSWEET5-3×HA-P2A-DfSUT4-EGFP.The SuSy2-SUT4-SWEET5 gene tandem module of Liangshan dendrocalamus of the application is related to the whole pathway of regulation bamboo plant sucrose transport, distribution, metabolism, and the above three linear processes are jointly studied, i.e., tandem co-expression, can dose-increased cellulose content in plant, and then cultivate high-fiber content, high biomass excellent plant resources, which has far-reaching significance for improving, application, popularization and promotion of fiber bamboo.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology, and more specifically, this invention relates to a SuSy2-SUT4-SWEET5 gene tandem module of *Bambusa textilis* and its application. Background Technology

[0002] Bamboo is an important raw material for pulp and paper making, and its cellulose content directly affects pulp yield and the quality of finished paper. Therefore, the creation and cultivation of bamboo species with high cellulose content is of great strategic significance to the development of my country's paper industry. *Liangshan Cizhu* ( Dendrocalamus farinosus Bamboo is an important economic bamboo species in southwestern my country. Due to its high yield, rich fiber content, and strong resistance, it is regarded as an excellent bamboo material for pulp.

[0003] Previous studies have shown that sucrose breakdown products are key substrates for cellulose synthesis. However, although previous research has focused on the functions of sucrose metabolism genes in sugar metabolism, the molecular regulatory mechanisms by which these key genes directly participate in plant stem cellulose synthesis remain unclear, and there are no reports of a combined study of the entire pathway of sucrose transport, distribution, and metabolism. Summary of the Invention

[0004] One object of the present invention is to solve at least the above-mentioned problems and / or defects, and to provide at least the advantages described below.

[0005] To achieve these objectives and other advantages of the present invention, a gene tandem module of *Bambusa textilis* SuSy2-SUT4-SWEET5 is provided, comprising: a 35S promoter, a DfSuSy2 gene, a 3×Flag tag, a self-cleaving peptide P2A, a DfSWEET5 gene, a 3×HA tag, a DfSUT4 gene, and an EGFP tag; the arrangement is 35S::DfSUSy2-3×Flag-P2A-DfSWEET5-3×HA-P2A-DfSUT4-EGFP; The nucleotide sequences of the DfSuSy2 gene are shown in SEQ ID No:1, the DfSUT4 gene in SEQ ID No:2, the DfSWEET5 gene in SEQ ID No:3, the 35S promoter in SEQ ID No:4, the 3×Flag tag in SEQ ID No:5, the self-cleaving peptide P2A in SEQ ID No:6, the 3×HA tag in SEQ ID No:7, and the EGFP tag in SEQ ID No:8.

[0006] A recombinant plasmid containing the SuSy2-SUT4-SWEET5 gene tandem module of *Bambusa liangshanensis* as described above.

[0007] A recombinant strain is obtained by transforming the recombinant plasmid as described above into Agrobacterium.

[0008] Application of the SuSy2-SUT4-SWEET5 gene tandem module of *Bambusa liangshanensis* as described above in plants.

[0009] Application of a recombinant plasmid as described above in plants.

[0010] Application of a recombinant strain as described above in plants.

[0011] The application described above is characterized in that the plant is *Bambusa textilis*, tobacco, *Arabidopsis thaliana*, potato, or *Phyllostachys pubescens*.

[0012] The application of the Liangshan Cizhu SuSy2-SUT4-SWEET5 gene tandem module in plants, as described above, includes the following steps: Step 1: Construct the SuSy2-SUT4-SWEET5 gene tandem module of *Phyllostachys liangshanensis*. Step 2: Transformation of Agrobacterium; Step 3: Select the positive strains from Step 2 to infect the plants.

[0013] As described above, in the application of the SuSy2-SUT4-SWEET5 gene tandem module of *Phyllostachys liangshanensis* in plants, the infection method in step three is one of the following: leaf disc transformation, injection, inflorescence infection, or stem segment infection.

[0014] The application of the Liangshan Cizhu SuSy2-SUT4-SWEET5 gene tandem module in plants as described above, in step three, the plants are tobacco, Arabidopsis thaliana, potato, or moso bamboo.

[0015] The present invention has at least the following beneficial effects: The Liangshan Cizhu SuSy2-SUT4-SWEET5 gene tandem module of this invention involves the entire pathway of regulating sucrose transport, distribution, and metabolism in bamboo plants. By jointly studying these three linear processes, i.e., tandem co-expression, it can dose-dependently increase the cellulose content in plants, thereby cultivating high-fiber, high-biomass, high-quality plant resources. This has profound significance for the improvement, application, and promotion of fiber-producing bamboo.

[0016] Meanwhile, this invention can also be heterologously expressed in dicotyledonous plants such as Arabidopsis thaliana, tobacco, and potato to increase the biomass of plant materials, which has high value in improving the economic and environmental aspects of forage feed. In terms of increasing the cellulose content of plant materials, these non-wood plants can be used as pulp raw materials, which can alleviate the problem of the long-term shortage of pulp raw materials in my country's papermaking industry to a certain extent. Moreover, since the selected plants are non-wood plants, they can also alleviate the problem of the long growth cycle and shortage of wood to a certain extent, thus having certain application and ecological value.

[0017] Other advantages, objectives and features of the present invention will become apparent in part from the following description, and in part from those skilled in the art through study and practice of the invention. Attached Figure Description

[0018] Figure 1 This is a set of differentially expressed genes in the 1st, 7th, and 14th segments of the stem of *Phyllostachys liangshanensis* under OFBa fertilization conditions and the control group. Figure 2 This is a graph showing the enrichment analysis of the KEGG metabolic pathway at the intersection of differentially expressed genes in this invention. Figure 3 This is a graph showing the expression levels of glucose metabolism-related genes in the differentially expressed genes of this invention. Figure 4 This is a diagram showing the tissue expression analysis of glucose metabolism-related genes in the differentially expressed genes of this invention. Figure 5 This is a tissue expression diagram of the DfSuSy2, DfSUT4, and DfSWEET5 genes of this invention; Figure 6 This is a subcellular localization map of the DfSuSy2, DfSUT4, and DfSWEET5 proteins of this invention; Figure 7 This is a predicted structural diagram of the DfSuSy2, DfSUT4, and DfSWEET5 proteins of this invention; Figure 8 This is a schematic diagram illustrating the construction of the overexpression vectors for the three genes and tandem overexpression in this invention; Figure 9 This is an agarose gel electrophoresis detection image of the present invention; Figure 10 This is a diagram showing the 1% agarose gel electrophoresis results of this invention; Figure 11 This is the pCAMBIA1300 spectrum of the present invention; Figure 12 This is an electrophoresis image of the pCAMBIA1300 double enzyme digestion product of this invention; Figure 13 This is an electrophoresis image used to verify the colony PCR of this invention. Figure 14This is a diagram illustrating the construction of overexpression and tandem overexpression vectors for the DfSuSy2, DfSUT4, and DfSWEET5 genes and their genetic transformation in tobacco. Figure 15 The present invention refers to the T3 generation homozygous Arabidopsis thaliana plants overexpressing the DfSuSy2, DfSUT4, and DfSWEET5 genes; Figure 16 This invention refers to T0 generation potato plants overexpressing the DfSuSy2 and DfSWEET5 genes; Figure 17 This is a genetic transformation diagram of Agrobacterium-mediated induction of DfSuSy2, DfSUT4 and DfSWEET5 gene overexpression in bamboo shoots according to the present invention. Figure 18 This image shows a T0 generation of moso bamboo plants overexpressing and co-expressing the DfSuSy2, DfSUT4, and DfSWEET5 genes, as presented in this invention. Detailed Implementation

[0019] The present invention will now be described in further detail with reference to the accompanying drawings, so that those skilled in the art can implement it based on the description.

[0020] It should be understood that terms such as “having,” “comprising,” and “including” as used herein do not exclude the presence or addition of one or more other elements or combinations thereof.

[0021] Example 1 Transcriptome analysis of stems from *Phyllostachys liangshanensis*: One-year-old Liangshan Cizhu bamboo was used as the experimental material, with a control group and a treatment group. The control group received no fertilizer (50 kg of soil was added per pot), while the treatment group received OFBa treatment (500 g of organic fertilizer and 30 g of Bacillus amyloliquefaciens per pot, totaling 50 kg of soil-fertilizer mixture). Each group was subjected to three biological replicates, and samples were taken 90 days after fertilization to determine the phenotype. After OFBa treatment, the cellulose content of the stems of Liangshan Cizhu bamboo in the treatment group increased significantly. RNA-sequence was performed on the 1st, 7th, and 14th nodes of the stems of the treatment group and the control group.

[0022] Figure 1 This is a set of differentially expressed genes in the 1st, 7th, and 14th segments of the stem of *Phyllostachys liangshanensis* under OFBa fertilization conditions and the control group. Figure 2 This is a diagram showing the enrichment analysis of the KEGG metabolic pathway in the differential gene intersection of this invention. Figure 3 This is a graph showing the expression levels of glucose metabolism-related genes in the differentially expressed genes of this invention. Figure 4 This is a tissue expression analysis diagram of glucose metabolism-related genes in the differentially expressed genes of this invention. Among them, Figure 4The English meanings of the Chinese characters are as follows: Root: root; Rhne: the junction between the shoot and the underground part; Rhbud: shoot bud; Labud: lateral bud; C10: 10cm shoot; C50: 50cm shoot; C100: 100cm shoot; C200: 200cm shoot; C400: 400cm shoot; C800: 800cm shoot; CSH: stem sheath; ShB: shoot sheath; Yleaf: young leaf; MLeaf: mature leaf; Inod: internode; Node: node; Branch: branch. Analysis of differentially expressed genes revealed an intersection containing 3170 differentially expressed genes. Figure 1 Further KEGG enrichment analysis of these 3170 genes revealed significant enrichment in genes involved in starch and sucrose metabolism. Figure 2 Further analysis of the expression changes of glucose metabolism-related genes revealed that DfSuSy2, DfSUT4, and DfSWEET5 were specifically induced to be highly expressed under fertilization conditions. Figure 3 Meanwhile, tissue expression analysis of differentially expressed genes related to glucose metabolism was conducted: it was found that the expression levels of all three genes were relatively high in the stems of *Phyllostachys liangshanensis*. Figure 4 This suggests that these genes may promote stem cellulose synthesis by enhancing sugar metabolism.

[0023] Example 2 Tissue expression identification of DfSuSy2, DfSUT4, and DfSWEET5 genes: Figure 5 This is a tissue expression diagram of the DfSuSy2, DfSUT4, and DfSWEET5 genes of this invention. Figure 5 AC represents the expression analysis of the DfSuSy2, DfSUT4, and DfSWEET5 genes in the 1st, 7th, and 14th segments of the stem before and after treatment with the microbial fertilizer (OFBa). Figure 5 DF represents the expression analysis of the DfSuSy2, DfSUT4, and DfSWEET5 genes in various tissues of cultivated *Phyllostachys liangshanensis*. The English meanings of the terms in DF are: Branch; CSH: stem sheath; Inod: internode; Labud: lateral bud; MLeaf: mature leaf; Node: node; Rhbud: shoot bud; Rhne: junction between shoot and underground part; Root: root; ShB: shoot sheath; Yleaf: young leaf; C10: 10cm shoot; C50: 50cm shoot; C100: 100cm shoot; C200: 200cm shoot; C400: 400cm shoot; C800: 800cm shoot. The expression levels of DfSuSy2, DfSUT4, and DfSWEET5 in the 1st, 7th, and 14th nodes of the stem before and after fertilization were analyzed. It was found that DfSuSy2, DfSUT4, and DfSWEET5 were all significantly highly expressed after treatment with the microbial fertilizer (OFBa). Figure 5AC); To clarify the tissue expression of SuSy2, SUT4, and SWEET5 genes, transcriptome data from 17 different tissues and organs and developmental stages (branching, stem sheath, internode, lateral bud, mature leaf, young leaf, root, and bamboo shoots of different heights, etc.) of Liangshan bamboo were analyzed to determine their expression levels. Figure 5 (DF) The results showed that SuSy2 and SUT4 were expressed in all tissues and organs of Liangshan Cizhu, but the expression levels of the three genes were not high in the internodes.

[0024] Example 3 Subcellular localization and structural prediction of DfSuSy2, DfSUT4, and DfSWEET5: 1. Subcellular localization (1) Preparation of inoculum Glycerol-laden bacteria (GV3101) carrying the exogenous target gene pCAM35S::DfSuSy2 / DfSUT4 / DfSWEET5-EGFP and the empty vector pCAMBIA1300 were activated on double-antibiotic plates. Positive single colonies were inoculated into 5 mL of double-antibiotic liquid LB medium (specific formulation: 1 g tryptone, 1 g NaCl, 0.5 g yeast extract, pH adjusted to 7.0, distilled water to a final volume of 100 mL; sterilized at 121℃ for 20 min, followed by the addition of two antibiotics, Kana). + 50 mg / L, Rif + Incubate overnight (28℃, 200rpm) in 50mg / L solution, then shake vigorously the next day until the bacterial culture reaches OD500. 600 =0.7; Centrifuge at 4000 rpm for 10 min at room temperature, collect the bacterial cells, resuspend in 10 mM MgCl2, and adjust OD. 600 =0.8, then add 2µL (100mM) AS, mix well and let stand for 3 hours; (2) Genetic transformation of tobacco by injection Take tobacco leaves during their vigorous growth period, use a 1mL syringe to draw up the infection solution and inject it into the tobacco leaves. Incubate overnight in the dark, and resume normal culture the next day.

[0025] (3) Microscopic examination Microscopic examination (24-48 hours after genetic transformation): Take leaves without wounds, prepare slides, and take pictures after finding GFP fluorescence signals under a laser confocal microscope.

[0026] Figure 6This is a subcellular localization map of the DfSuSy2, DfSUT4, and DfSWEET5 proteins of this invention. The results showed that all three proteins exhibited fluorescence signals on the plasma membrane, indicating that DfSuSy2, DfSUT4, and DfSWEET5 are all located on the plasma membrane. Furthermore, green fluorescence signals were also observed in the chloroplasts of tobacco leaves transiently transformed with the 35S::DfSWEET5-EGFP vector, suggesting that DfSWEET5 may also function within the chloroplasts.

[0027] 2. Protein structure prediction of DfSuSy2, DfSUT4 and DfSWEET5 Figure 7 This image shows the predicted structures of the DfSuSy2, DfSUT4, and DfSWEET5 proteins from this invention. AlphaFold was used to predict the structures of DfSUSy2, DfSUT4, and DfSWEET5 proteins: DfSUSy2 exhibits a typical homotetrameric conformation; DfSUT4 possesses 12 transmembrane domains typical of a sugar transporter family; and DfSWEET5 contains seven transmembrane domains: a pair of repeating sequences of three transmembrane helices and an additional helix connecting these two repeating sequences. The pTM values ​​for the predicted structures of DfSuSy2, DfSUT4, and DfSWEET5 were 0.86, 0.72, and 0.83, respectively, indicating that the predicted overall structures are close to the native conformations.

[0028] Example 4 Construction of overexpression and tandem overexpression vectors for DfSuSy2, DfSUT4, and DfSWEET5 genes and genetic transformation in tobacco: 1. Construction of overexpression vectors for 3 genes and tandem overexpression Figure 8 This is a schematic diagram illustrating the construction of the overexpression vectors for the three genes and the tandem overexpression vectors of this invention.

[0029] (1) Using Primer5, specific primers without stop codons were designed and then sent to Sangon Biotech for synthesis.

[0030] A. Primers for amplifying the DfSuSy2 fragment F: catttcatttggagaggacagATGGCTGCCAAGCTGACTCG R: GCTCACCATtcgactctagagCTTGGCTACGCTGTCGCCGT B. Primers for amplifying the DfSUT4 fragment F: catttcatttggagaggacagATGGACTCCGCCCGCT R: GCTCACCATtcgactctagagGCCAAATCCATGGAAGCCGG C. Primers for amplifying DfSWEET5 fragment F: catttcatttggagaggacagATGATCTCGCCGGACACCATC R: GCTCACCATtcgactctagagGTAGTGGCCGTTGCCGGC D. Amplifying tandem vector fragment a. DfSUSy2-3×Flag-P2A F: CATTTCATTTGGAGAGGACAGATGG R1: AGTCTCCATCATGGTCTTTGTAGTCCTTGGCTACGCTGTCGCCGT R2:TTGTAATCGATGTCGTGATCCTTATAGTCTCCATCATGGTCTTTGTAGTC R3:GTTAGTAGCCTTATCGTCATCGTCCTTGTAATCGATGTCGTGATCCTTAT R4:CTCCAGCCTGCTTCAGCAGGCTGAAGTTAGTAGCCTTATCGTCATCGTCC R5:AGGTCCAGGGTTCTCCTCCACGTCTCCAGCCTGCTTCAGCAGGCTGAA b. DfSWEET5-3×HA-P2A-(UP-DfSUT4) F: GTGGAGGAGAACCCTGGACCTATGATCTCGCCGGACACCATC R1:ATAGTCAGGAACATCGTATGGGTAGTAGTGGCCGTTGCCGGC R2:CGGGACGTCATAGGGATAGCCCGCATAGTCAGGAACATCGTATGGGTA R3:ATATGGATAGGATCCTGCATAGTCCGGGACGTCATAGGGATAGCCCGC R4:AGACCAAGCGTAATCTGGAACGTCATATGGATAGGATCCTGCATAGTC R5:AGTGGCTTTTTCAAATTGAGGATGAGACCAAGCGTAATCTGGAACGTC R6:GGCCTGTTTCAAGAGAGAAAAATTAGTGGCTTTTTCAAATTGAGGATG R7:TGGACCTGGGTTCTCTTCAACGTCACCGGCCTGTTTCAAGAGAGAAAAATT R8:AGCGGCGGCGGAGTCCATTGGACCTGGGTTTCTCTTCAACGTCACC c, DfSUT4 F: ATGATCTCGCCGGACACCATC R: GCTCACCATtcgactctagagGTAGTGGCCGTTGCCGGC (2) Obtain the target gene fragment A. Obtaining cDNA from Liangshan Cizhu. a. RNA was extracted using the Trizol method. All tools used in the experiment were sterilized (121℃, 30 minutes). Total RNA was extracted from the leaves of *Bambusa liangshanensis* according to the following steps: Figure 9 This is an agarose gel electrophoresis detection image of the present invention. The leaves of *Phyllostachys liangshanensis* were thoroughly ground in liquid nitrogen and then transferred to a 1.5 mL RNase-free centrifuge tube. 1 mL of pre-chilled Trizol reagent was added, and the mixture was gently mixed and incubated at room temperature for 10 min. 200 mL of chloroform was added, and the mixture was centrifuged at 4°C and 12000 rpm for 10 min. The supernatant was transferred to a new RNase-free centrifuge tube, and an equal volume of isopropanol was added. The mixture was incubated for 20 min and centrifuged at 4°C and 12000 rpm for 10 min, discarding the supernatant. Then, 1 mL of 75% ethanol was added to wash the precipitate, and the mixture was centrifuged at 4°C and 12000 rpm for 5 min, discarding the supernatant. This step was repeated once. The mixture was centrifuged again at 12000 rpm for 2 min, the ethanol was aspirated, and the precipitate was dried in a clean bench. The precipitate was dissolved in 40 µL of sterile water and then detected by agarose gel electrophoresis (see [link to product description]). Figure 9 The RNA from *Liangshan Cizhu* showed three bands: 28S, 18S, and 5.8S, indicating that the RNA was relatively intact and could be used for subsequent experiments.

[0031] b. Use the Vazyme reverse transcription kit. Prepare the RNA template denaturation system, genomic DNA removal system, and first-strand cDNA synthesis system according to Tables 1-3 below. Finally, obtain the reverse transcription product cDNA and store it at -20℃.

[0032] Table 1 RNA template denaturation system Table 2 Genomic DNA Removal System Table 3 First-strand cDNA synthesis system B. PCR amplification PCR amplification was performed using 50 µL reaction systems prepared with Vazyme's high-fidelity DNA polymerase (catalog number: P520) according to Tables 4-5 below. Specifically, the amplification of the DfSuSy2 fragment was performed at an annealing temperature of 64 °C for a extension of 2 min 40 s; the amplification of the DfSUT4 fragment was performed at an annealing temperature of 67 °C for a extension of 2 min; and the amplification of the DfSWEET5 fragment was performed at an annealing temperature of 64 °C for a extension of 1 min.

[0033] Table 4 PCR reaction system Table 5 PCR amplification program C. Electrophoretic detection Figure 10 This is a 1% agarose gel electrophoresis result of the present invention. A 1% agarose gel was prepared (100 mL 1xTAE + 1 g agarose + 5 µL nucleic acid dye). Electrophoresis was used to detect whether the amplified product was the target band. Figure 10 ).

[0034] D. Purification and recovery Purification and recovery were performed using a universal DNA purification and recovery kit (Tiangen, catalog number: DP205). The recovery steps are as follows: Cut the gel block containing the target band using a gel cutter, add 300 µL of solution PC to the gel block, and incubate in a 65°C water bath for 10 min (gently inverting the EP tube during this time). Add the solution obtained in the previous step to the adsorption column CB2 (place the adsorption column in the collection tube), let it stand for 2 min to fully bind, and then centrifuge at 12000 rpm for 1 min at room temperature. Discard the waste liquid in the collection tube and put the adsorption column CB2 back into the collection tube. Add 600µL of wash buffer PW to the adsorption column CB2, let stand for 2 min, centrifuge at 12000 rpm for 1 min at room temperature, discard the waste liquid in the collection tube, put the adsorption column CB2 back into the collection tube; and repeat the above operation; then centrifuge at 12000 rpm for 2 min at room temperature (to remove as much wash buffer as possible). Air dry at room temperature for 9 min.

[0035] Then, the adsorption column CB2 was placed in a new EP tube, and 40 µL of ddH2O (preheated to 65 °C) was added dropwise to the center of the adsorption membrane. The tube was then incubated at room temperature for 2 min. After centrifugation at 12,000 rpm for 2 min at room temperature, the adsorption column CB2 was discarded, and the target gene fragment was collected.

[0036] The concentration of the recovered fragment was detected using a microporous spectrophotometer, and the recovered product was stored at -20°C.

[0037] (3) Obtaining a linearized carrier Figure 11 This is the pCAMBIA1300 spectrum of the present invention. It was created using a rapid digestion enzyme from TaKaRa Biotechnology. Q.Cut KpnI and Q.Cut BamHI Prepare a 50 µL enzyme digestion system as shown in Table 6. After the enzyme digestion reaction, pCAMBIA1300 was obtained and detected by agarose gel electrophoresis: the length of the intact circular vector was 10493 bp ( Figure 11 The linearized vector length after the vector is cut should be 10478 bp.

[0038] Table 6 Enzyme digestion vectors Figure 12 This is an electrophoresis image of the pCAMBIA1300 double enzyme digestion product of the present invention. Figure 12 In the diagram, M stands for DNA Maker DL15000; lanes 1, 3, 4, 6, 7, 8, and 9 contain the products of double enzyme digestion of the vector. The gel imaging results are shown in Figure 12: the bands are clearly visible, and the length of the digested products is between 10000bp and 15000bp, indicating that the vector has been successfully linearized.

[0039] The product was purified and recovered using a universal DNA purification and recovery kit (Tiangen, catalog number: DP205) [the steps are the same as in Example (2)-D].

[0040] (4) Obtaining recombination vectors through homologous recombination A. Target fragment ligation vector (homological recombination) The vector and the target gene fragment were ligated using a homologous recombinase (Vazyme, catalog number: C112). The system is shown in Table 7.

[0041] Table 7 Homologous Recombination B. Transformation (DH5a) The recombinant product was transformed into competent Escherichia coli (DH5a) cells, and the specific steps are as follows: 10 µL of recombinant product was mixed with 100 µL of DH5α competent cells, incubated on ice for 20 min, then incubated in a 42°C water bath for 90 s, followed by an ice bath for 3 min. Then, 800 µL of antibiotic-free LB liquid medium (specific formulation: 1 g tryptone, 1 g NaCl, 0.5 g yeast extract, pH adjusted to 7.0, and distilled water brought to a final volume of 100 mL) was added. The mixture was incubated at 180 rpm and 37°C for 1 h using a shaking incubator. After centrifugation at 5500 rpm for 1 min at room temperature, a portion of the supernatant was discarded, leaving approximately 100 µL. This supernatant was then spread onto solid LB monoclonal antibody medium (specific formulation: 1 g tryptone, 1 g NaCl, 0.5 g yeast extract, 1 g agar powder, pH adjusted to 7.0, and brought to a final volume of 100 mL). The medium was then sterilized by steam sterilization at 121°C for 20 min. After sterilization, the antibiotic Kana was added. + 50 mg / L) was incubated overnight in a bacterial incubator at 37°C.

[0042] C. Positive colony PCR test Single colonies were picked and tested for positivity using Taq polymerase (Vazyme, catalog number: P112). The PCR reaction system for bacterial culture is shown in Table 8, and the PCR amplification program for colonies is shown in Table 9. In Table 9, the amplification of the DfSuSy2 fragment was performed at an annealing temperature of 64℃ and an extension time of 2 min 40 s; the amplification of the DfSUT4 fragment was performed at an annealing temperature of 67℃ and an extension time of 2 min; and the amplification of the DfSWEET5 fragment was performed at an annealing temperature of 64℃ and an extension time of 1 min.

[0043] Table 8. Bacterial PCR Reaction System Table 9 Colony PCR Amplification Procedure Figure 13 This is an electrophoresis image used for colony PCR verification of the present invention. Electrophoresis was performed after PCR. Figure 13 In the diagram, M represents DNAMaker DL5000; lanes 1-8 all contain the DfSuSy2 fragment (2427 bp); lanes 9-16 all contain the DfSUT4 fragment (1803 bp); and lanes 17-24 all contain the DfSWEET5 fragment (768 bp).

[0044] D. Extraction of recombinant plasmids Recombinant plasmids were extracted using a plasmid miniprep kit (Tiangen product number: DP103). The specific steps are as follows: Collect the overnight cultured bacterial suspension and centrifuge at 12,000 rpm for 1 min (at room temperature). Add 250 µL of solution P1 to the EP tube and thoroughly resuspend the bacterial cells using a vortex mixer. Add 250 µL of solution P2 to the tube and immediately and gently invert the EP tube 6-8 times to ensure complete lysis of the bacterial cells. Add 350 µL of solution P3 to the tube and immediately and gently invert the tube 6-8 times (a white flocculent precipitate will appear at this point). Centrifuge at 12,000 rpm for 10 min (at room temperature) and transfer the supernatant to the equilibrated adsorption column CP3 (place the adsorption column in the collection tube). Centrifuge at 12,000 rpm for 1 min (at room temperature) and discard the liquid in the collection tube.

[0045] Add 600µL of wash buffer PW to the adsorption column CP3, centrifuge at 12000 rpm for 1 min (at room temperature), and discard the liquid in the collection tube; repeat the previous step; then centrifuge at 12000 rpm for 2 min at room temperature (to remove as much wash buffer as possible); air dry at room temperature for 9 min.

[0046] Then, the adsorption column CP3 was placed in a new EP tube, and 40 µL of ddH2O (preheated to 65 °C) was added dropwise to the middle of the adsorption membrane. The tube was then left to stand at room temperature for 2 min. After centrifugation at 12,000 rpm for 2 min at room temperature, the adsorption column CP3 was discarded, and the plasmid was collected.

[0047] The concentration of the extracted plasmid was detected using a microporous spectrophotometer, and the extracted product was stored at -20℃.

[0048] (5) Transformation of Agrobacterium The recombinant plasmid was transformed into GV3101 competent cells using the heat shock method. The specific steps are as follows: 7 µL of plasmid was mixed with 100 µL of GV3101 competent cells, incubated on ice for 30 min, immediately treated with liquid nitrogen for 5 min, then incubated in a 37°C water bath for 5 min, followed by an ice bath for 3 min. 800 µL of antibiotic-free LB liquid medium (the formula is the same as the antibiotic-free LB liquid medium above) was added, and the cells were incubated at 180 rpm and 28°C for 4 h. After incubation, the cells were centrifuged at 5500 rpm for 1 min at room temperature, and part of the supernatant was discarded, leaving about 100 µL. This supernatant was then spread onto solid LB double-antibiotic medium (the specific formula is: 1 g tryptone, 1 g NaCl, 0.5 g yeast extract, 1 g agar powder, adjusted to pH 7.0, and diluted to 100 mL with distilled water). The medium was then sterilized by steam at 121°C for 20 min, and two antibiotics, Kana, were added after sterilization. + 50 mg / L, Rif + Incubate overnight in 50 mg / L solution for 2-3 days.

[0049] After single colonies with clear and intact edges have grown on the plate, perform colony PCR testing for positive results (refer to the steps for colony PCR testing of E. coli); incubate the positive colonies with shaking until OD...600 =1.2 Glyceryl bacteria, quick-frozen in liquid nitrogen and then stored in an ultra-low temperature freezer at -80℃.

[0050] 2. Genetic transformation of tobacco The specific steps for transforming tobacco using the Agrobacterium-mediated leaf disc method are as follows: (1) Preparation of inoculum Agrobacterium (glycerol bacterium) carrying the exogenous target gene was activated on a double-antibiotic plate. After 1-2 days, single colonies on the plate were collected and placed in 5 mL of double-antibiotic LB liquid medium (specific formula: 1 g tryptone, 1 g NaCl, 0.5 g yeast extract, adjusted to pH 7.0, and diluted to 100 mL with distilled water; sterilized at 121℃ for 20 min, and then two antibiotics Kana were added). + 50 mg / L, Rif + 50 mg / L (this formulation was used for all subsequent double-antibody LB liquid medium) was incubated overnight (28°C, 200 rpm); the next day, it was inoculated at a 1:100 ratio into 30 mL of double-antibody LB liquid medium and cultured with shaking until OD (outcome limit) was reached. 600 When the concentration of the bacterial culture reaches 0.7, transfer the above bacterial culture to a 50 mL sterile centrifuge tube, centrifuge at 24°C and 5000 rpm for 5 min, discard the supernatant, add 50 mL of infiltration buffer (without AS) to the centrifuge tube, mix well by pipetting, and centrifuge again at 24°C and 5000 rpm for 1 min, discard the supernatant; add infiltration buffer (without AS) to the centrifuge tube until the OD reaches 0.7. 600 After 0.2, the infection solution was transferred to a 350mL sterile tissue culture bottle, and AS (100mM) was added at a ratio of 1:1000. The culture was then incubated in the dark at 28℃ and 180rpm for 1h.

[0051] (2) Tobacco contamination In a clean bench, tobacco leaves were cut into 1.5cm × 1.5cm cubes using a sterile scalpel (leaf edges removed, avoiding veins). A certain number of leaf cubes were selected and placed in the infiltration solution, and infiltrated at 28℃ and 180rpm for 10min. After infiltration, the cubes were air-dried on sterile filter paper (or blotted dry with sterile filter paper). The dried leaf cubes were then placed on a co-culture solid culture medium (leaf face down, with filter paper as a separator) and incubated in the dark for 2 days.

[0052] (3) Induction / screening culture After co-culture, the buds were transferred to S1 medium for induction culture (leaf face up, 14h light + 10h dark; 26℃), and the S1 medium was changed every 7 days. After 3 weeks, the buds were transferred to S2 medium, and after 5 weeks, they were transferred to S3 medium. After the buds grew to a certain height, they were transferred to rooting medium for culture.

[0053] (4) Cultivation and screening The positive seedlings that have undergone hardening off are moved outdoors for pot cultivation until T0 tobacco seeds are harvested. The tobacco seeds are sterilized with 10% sodium hypochlorite for 8 minutes, then washed with sterile water until no sodium hypochlorite residue is found. The sterile seeds are then placed in 1 / 2 MS medium containing 50 mg / L hygromycin (the specific formula is: 2.37 g MS powder, 15 g sucrose, pH adjusted to 5.8, and distilled water to a final volume of 1 L; sterilized by high-temperature steam at 121℃ for 20 minutes, and then 50 mg / L hygromycin is added after sterilization) for screening.

[0054] Figure 14 This diagram illustrates the construction of overexpression and tandem overexpression vectors for the DfSuSy2, DfSUT4, and DfSWEET5 genes, as well as the genetic transformation in tobacco. Selected positive seedlings were placed in a laboratory greenhouse for standardized cultivation and management, and continuously observed until obvious traits appeared: for example, after 90 days of pot cultivation, the transgenic lines showed significantly greater plant height and biomass compared to WT plants. Figure 14 (A / C / E).

[0055] Table 10 shows the components of each culture medium in this invention.

[0056] Table 10 Components of Each Culture Medium 3. Expression level identification Total RNA was extracted from T1 generation tobacco leaves using the Trizol method [detailed steps are the same as 1-(2)Aa in Example 4]. The RNA was reverse transcribed into cDNA using the HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) (Vazyme, catalog number: R312-01; specific steps are shown in Table 11-12). All primers were designed using Premier 5.0 (specific primer information is shown in Table 13).

[0057] The expression levels of the target gene were analyzed using the Taq Pro Universal SYBR qPCR Master Mix kit (Vazyme, catalog number: Q712-02) and the qTOWER3 series high-performance real-time PCR instrument (Analytik Jena, Jena, Germany) (the reaction system and amplification program are shown in Tables 14-15).

[0058] Data adopted The relative transcriptional level of genes was calculated using a method (the experiment included three technical replicates, and one-way ANOVA was used, with mean ± standard deviation). ).

[0059] Figure 15The present invention refers to the T3 generation homozygous Arabidopsis thaliana plants overexpressing the DfSuSy2, DfSUT4, and DfSWEET5 genes. Figure 15 A represents the 2-Week phenotype of T3 generation Arabidopsis thaliana overexpressing DfSuSy2, DfSUT4, and DfSWEET5 genes; Figure 15 B / D / F represents the 10-Week phenotype of T3 generation Arabidopsis thaliana with overexpression of DfSuSy2, DfSUT4, and DfSWEET5 genes; Figure 15 C / E / G represents the expression levels of the DfSuSy2, DfSUT4, and DfSWEET5 genes in EV and transgenic plants using RT-qPCR; EV:pCAM35S::EGFP transformed plants; L1-L3:pCAM35S::DfSuSy2 / DfSUT4 / DfSWEET5-EGFP transformed plants. Analysis showed that the expression of the target genes DfSuSy2, DfSUT4, and DfSWEET5 in all transgenic lines was higher than that in WT plants (see...). Figure 15 B / D / F).

[0060] Table 11 Genomic DNA Removal System Table 12 First-strand cDNA Synthesis System Table 13 qRT-PCR primers Table 14 qRT-PCR reaction system Table 15 qRT-PCR amplification program.

[0061] Example 5 Homozygous T3 generation Arabidopsis plants overexpressing DfSuSy2, DfSUT4, and DfSWEET5 genes: 1. Arabidopsis genetic transformation (1) Preparation of inoculum Agrobacterium (glycerol bacterium) carrying the exogenous target gene was activated on a double-antibiotic plate. After 1-2 days, single colonies from the plate were collected and cultured overnight (28℃, 200rpm) in 5mL of double-antibiotic LB liquid medium. The next day, the colonies were inoculated at a ratio of 1:100 into at least 200mL of double-antibiotic LB liquid medium (containing Rif). + and Kana + The culture was carried out with shaking (all working concentrations were 50 mg / L) until OD... 600When the concentration of the bacterial culture reaches 0.7, the bacterial culture is transferred to a 50 mL sterile centrifuge tube and centrifuged at 24 °C and 4500 rpm for 5 min. The supernatant is discarded, and an equal volume of infiltration solution (the composition of the infiltration solution is shown in Table 16) is added to the centrifuge tube to resuspend the bacterial cells. The prepared infiltration solution is then transferred to a sterile dish for infiltration.

[0062] Table 16 Composition of Infection Solution (2) Infection of Arabidopsis thaliana After treatment, the unopened inflorescences were completely immersed in the infection solution for 45 seconds, then cultured in complete darkness for 24 hours before being exposed to normal light. After one week, the plants were observed and subjected to a second infection to improve the transformation efficiency. After that, they were cultured under normal light until the seeds were harvested.

[0063] 2. Positive screening and culture Harvest infected Arabidopsis seeds (T0 generation seeds), treat with 75% ethanol for 1 min; treat with 10% hypochlorous acid for 8 min; wash with sterile water until no sodium hypochlorite residue is found, then spot the sterile seeds onto 1 / 2 MS medium containing 40 mg / L hygromycin (specific formula: 2.37 g MS powder, 15 g sucrose, adjust pH to 5.8, distilled water to 1 L; sterilize at 121℃ for 20 min, then add 40 mg / L hygromycin) for positive screening.

[0064] After hydration at low temperature for 2-4 days, the seeds were cultured under 22℃ light for 2-4 days until all seeds germinated. They were then cultured in darkness until positive seedlings with significantly longer hypocotyls were selected. These positive seedlings were then transplanted into nutrient soil for soil cultivation. Once the seeds (at this stage, the T1 generation) matured, they were harvested and subjected to further sterilization, screening, and cultivation to obtain more mature seeds (at this stage, the T2 generation). The T2 generation seeds were then subjected to further sterilization, screening, and cultivation to produce seedlings (at this stage, the T3 generation seedlings), which were then subjected to subsequent index measurements and analysis.

[0065] 3. Expression level identification T3 generation Arabidopsis leaves were collected, and total RNA was extracted and reverse transcribed into cDNA. All primers were designed using Premier 5.0 (see Table 17 for primer details). Gene expression analysis was performed using qRT-PCR to quantitatively detect the expression level of target genes.

[0066] Table 17 qRT-PCR primers Analysis showed that the expression of the target genes DfSuSy2, DfSUT4, and DfSWEET5 in all transgenic lines was higher than that in EV plants (see...). Figure 15(C / E / G) indicates that the target gene is overexpressed in the corresponding transgenic plants.

[0067] Example 6 T0 generation potato plants overexpressing DfSuSy2 and DfSWEET5 genes: 1. Potato genetic transformation (1) Preparation of inoculum Agrobacterium (glycerol bacterium) carrying the exogenous target gene was activated on a double-antibiotic plate. After 1-2 days, single colonies from the plate were collected and cultured overnight in 5 mL of double-antibiotic LB liquid medium (28℃, 200 rpm). The next day, the bacteria were inoculated at a 1:100 ratio into 15 mL of double-antibiotic LB liquid medium (generally 10 mL-20 mL) and cultured with shaking until the bacterial culture OD... 600 Infection can be performed when the pH is 0.6-0.8 (at which point the bacterial activity is optimal). Transfer the bacterial culture to a 50mL sterile centrifuge tube and centrifuge at 23℃ and 5000rpm for 6min. Discard the supernatant and resuspend the cells in MS liquid medium (specific formula: 4.74g MS powder, 30g sucrose, adjust pH to 5.8, and bring the volume to 1L with distilled water; sterilize at 121℃ for 20min). Adjust the OD... 600 =0.2, which is the infiltration solution.

[0068] (2) Infection of potatoes Sterile tube potatoes grown for 84–140 days and with a diameter of approximately 0.5 cm were cut into 1 mm–2 mm slices and inoculated in the infection solution for 8 min. The inoculated material was then removed, placed on sterile filter paper to air dry, and transferred to shoot differentiation medium (MS powder 4.74 g + 3% sucrose (m / v) + 1 mg / L IAA + 0.2 mg / L GA3 + 0.5 mg / L 6-BA + 2 mg / L ZT, diluted to 1 L with distilled water) and incubated in the dark at 26°C for 2 days.

[0069] (3) Induction / screening culture After dark culture, the culture medium was transferred to a bud differentiation medium containing 10 mg / L hygromycin and 400 mg / L cephalosporins, and cultured under the conditions of 2000 lx light intensity, 16 h light / 8 h dark photoperiod, and 23 ± 1 ℃ temperature. Fresh medium (bud differentiation medium containing 10 mg / L hygromycin and 400 mg / L cephalosporins) was replaced every 7-10 days.

[0070] During this period, the young shoots at the edges of the test tube potato slices were removed and discarded. After 21–28 days, resistant shoots grew from the center of the test tube potato slices. When the resistant shoots reached 0.5 cm–1 cm in length, they were cut off and transferred to MS medium containing 10 mg / L hygromycin and 200 mg / L cephalosporin (8 g of agar powder was added to each 1 L of MS liquid medium) to induce rooting, thereby obtaining complete plants.

[0071] 2. Expression level identification Total RNA was extracted from the transgenic lines and reverse transcribed into cDNA. All primers were designed using Premier 5.0, and primer details are shown in Table 18. qRT-PCR was used to analyze gene expression at the RNA level to detect the expression of the target gene.

[0072] Table 18 qRT-PCR Primers Figure 16 The present invention refers to the T0 generation potato plants overexpressing the DfSuSy2 and DfSWEET5 genes. Figure 16 A / C represents the aboveground phenotype of T0 generation potatoes overexpressing DfSUSy2 and DfSWEET5 genes at 70 days d. Figure 16 B / D represents the expression levels of the DfSuSy2 and DfSWEET5 genes in WT and transgenic plants using RT-qPCR; WT: wild-type plants; L1-L3: pCAM35S::DfSuSy2 / DfSWEET5-EGFP transformed plants; one-way ANOVA was used, with mean ± standard deviation. Analysis showed that the expression of the target genes DfSuSy2 and DfSWEET5 in transgenic plants was higher than that in WT plants. Figure 16 (B / D) indicates that the target gene was overexpressed in the corresponding transgenic plants.

[0073] Example 7 Agrobacterium-mediated genetic transformation of bamboo shoots to induce overexpression of DfSuSy2, DfSUT4, and DfSWEET5 genes: 1. Genetic transformation of moso bamboo (1) Preparation of inoculum A. Shake to OD 600 =1.2 bacterial suspension (the bacterial suspension preparation method is the same as 1-(1) of Example 5) was dispensed into 50 mL sterile centrifuge tubes, centrifuged at 5000 rpm for 5 min at room temperature, the supernatant was discarded and the bacterial cells were collected.

[0074] B. Take a small amount of the infusion solution, resuspend the bacterial cells, pour it into an Erlenmeyer flask, and add the infusion solution (components are shown in Table 19) to 400 mL. Incubate at 28 °C and 200 rpm for 30 min.

[0075] C. Mix the culture medium and remaining infection solution from the previous step in a large beaker, and adjust the OD. 600 =0.7, let stand for 3 hours.

[0076] Table 19 Components of the Infection Solution (2) Genetic transformation A. Use a 1mL syringe to infect the adventitious buds at the base of the bamboo by pricking them with a needle (Note: The roots of the bamboo need to be soaked in water to avoid dehydration).

[0077] B. Soak the bamboo roots that have been completed in the previous step in the infusion solution for 15 minutes, shaking them frequently during this time to ensure that the Agrobacterium and the base of the roots are in full contact; repeat once.

[0078] C. Transplanting: Use Hogland nutrient solution and perlite for hydroponic co-culture, and culture in the dark for 24 h, then restore light and culture for 48 h.

[0079] D. After removing and cleaning the roots of the bamboo, soak the roots in carbendazim rooting powder for 10 minutes, and then transplant them into pots for soil cultivation, avoiding midday.

[0080] E. Culture normally during the period and observe phenotypic changes.

[0081] 2. Positive test Figure 17 This is a genetic transformation diagram of Agrobacterium-mediated induction of DfSuSy2, DfSUT4 and DfSWEET5 gene overexpression in bamboo shoots according to the present invention. Figure 17 A represents the positive shoots at the roots of transgenic bamboo seedlings identified under a fluorescent light source; Figure 17 B was used as a template to extract DNA from new bamboo shoots with green fluorescence. PCR verification was performed using primers specific to the EGFP gene. The products at the corresponding bands were purified and sequenced, indicating that DfSuSy2, DfSUT4, and DfSWEET5 were successfully introduced into moso bamboo seedlings in this experiment. Figure 17 C represents a longitudinal section of new shoot tissue with green fluorescence from a transgenic plant, used to detect the location of fluorescence signal expression under a confocal microscope.

[0082] (1) DNA level identification DNA from newly discovered bamboo shoots exhibiting green fluorescence was extracted and used as a template. PCR verification was performed using primers specific to the EGFP gene, followed by electrophoresis on a 1% agarose gel. The electrophoresis results were as follows: Figure 17B) The results showed that the product at the corresponding band was purified and sequenced. The results showed that DfSuSy2, DfSUT4, and DfSWEET5 were successfully introduced into moso bamboo seedlings in this experiment.

[0083] (2) Protein level identification New bamboo shoot slides containing green fluorescence were examined under a laser confocal microscope and found to contain EGFP green fluorescence signals in all samples. Figure 7 C) indicates that DfSuSy2, DfSUT4, and DfSWEET5 were successfully expressed in moso bamboo seedlings.

[0084] Example 8 Overexpression and tandem co-expression of DfSuSy2, DfSUT4, and DfSWEET5 genes in T0 generation moso bamboo plants: 1. Expression level identification Total RNA was extracted from bamboo leaves. The quality of the total RNA was then assessed using a NanoDrop One ultra-micro UV-Vis spectrophotometer (Thermo Scientific, Shanghai, China) and agarose gel electrophoresis. RNA was reverse transcribed into cDNA using the HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) (Vazyme, catalog number: R312-01). All primers were designed using Premier 5.0 (primers are shown in Table 20). Finally, the expression levels of the target genes were analyzed using the Taq Pro Universal SYBR qPCR Master Mix kit (Vazyme, catalog number: Q712-02) and a qTOWER3 series high-performance real-time PCR instrument (Analytik Jena, Jena, Germany). The qRT-PCR program consisted of 40 cycles (95℃, 5 min, 95℃, 10 s, 60℃, 30 s) followed by a Melt (55-90℃) for 15 s. The method calculates the relative transcriptional level of genes, and the experiment includes three technical replicates.

[0085] Figure 18 This image shows a T0 generation of moso bamboo plants overexpressing and co-expressing the DfSuSy2, DfSUT4, and DfSWEET5 genes, as presented in this invention. Figure 18 A / F / K / P represents overexpression of DfSUSy2, DfSUT4, and DfSWEET5 genes and tandem co-expression of pCAM35S::DfSUSy2-3XFlag-P2A-DfSWEET5-3XHA-P2A-DfSUT4-EGFP in T0 generation moso bamboo; Figure 18B / G / L / Q represents the expression levels of DfSuSy2, DfSUT4, and DfSWEET5 genes in EV and transgenic plants using RT-qPCR technology. Figure 18 C / H / M / R represents the chlorophyll content (SPAD) in the leaves of EV and transgenic plants. Figure 18 D / I / N / S represents the Fv / Fm ratio of leaves in EV and transgenic plants of various lines; Figure 18 E / J / O / T represent the nitrogen content (mg / g) in the leaves of EV and transgenic plants of various lines. Specifically, EV:pCAM35S::EGFP transgenic plants; L1-L3:pCAM35S::DfSuSy2 / DfSUT4 / DfSWEET5-EGFP transgenic plants. One-way ANOVA was used, with mean ± standard deviation. .

[0086] The results showed that, compared with the positive control EV plants, the corresponding target genes in T0 generation moso bamboo were all highly expressed in overexpression of DfSUSy2, DfSUT4, and DfSWEET5 genes and in tandem co-expression of pCAM35S::DfSUSy2-3×Flag-P2A-DfSWEET5-3×HA-P2A-DfSUT4-EGFP, and some lines showed extremely significant high expression (see...). Figure 18 B / G / L / Q).

[0087] Table 20 qRT-PCR primers 2. Plant phenotypic analysis (1) Macromorphological phenotypic analysis Plant height and number of internodes were observed visually.

[0088] (2) Determination and analysis of contents A. Chlorophyll content (SPAD) The chlorophyll meter (Zhongke Weihe, model: TYS-4N) was used for measurement, and the operation was performed in accordance with the company's published operation manual.

[0089] Analysis revealed that the chlorophyll content in the leaves of all DfSWEET5 lines was significantly higher than that in the control group EV plants. Figure 18 M); B. Nitrogen content (mg / g) The chlorophyll meter (Zhongke Weihe, model: TYS-4N) was used for measurement, and the operation was performed in accordance with the company's published operation manual.

[0090] Analysis revealed that the nitrogen content in the leaves of all DfSWEET5 lines was significantly higher than that in the control group EV plants. Figure 18O); C、Fv / Fm The measurements were performed using a portable modulated chlorophyll fluorometer – MINI-PAM (WALZ GmbH, Germany), and the operation was performed according to the company's October 2006 operating manual. Analysis revealed that the Fv / Fm values ​​in the leaves of DfSWEET5 and all tandem lines were significantly higher than those in the control group EV plants. Figure 18 N / S); D. Determination of carbohydrate metabolites a. Soluble sugar content: The soluble sugar content was determined and analyzed using a plant soluble sugar content detection kit (Beijing Solarbio Science & Technology Co., Ltd.; Product No.: BC0035, Specification: 100T / 96S). b. Sucrose content: The sucrose content was determined and analyzed using a plant sucrose content detection kit (Beijing Solarbio Technology Co., Ltd.; Product No.: BC2465, Specification: 100T / 96S). c. Fructose content: The fructose content was determined and analyzed using a fructose content detection kit (HK enzymatic method) (according to Beijing Box Biotechnology Co., Ltd.; product number: AKSU083-1M; specification: 220T / 100S kit).

[0091] E. Determination and analysis of structural substance content a. Determination of cellulose content The cellulose CLL content was determined and analyzed according to the cellulose CLL content detection kit (catalog number: AKSU007M, specification: 120T / 100S) from Beijing Box Biotechnology Co., Ltd. b. Determination of lignin content The lignin content was determined and analyzed using the lignin content detection kit (item number: AKSU010M; specification: 110T / 100S) from Beijing Box Biotechnology Co., Ltd.

[0092] (3) Fiber morphology determination and analysis After removing the outer layer of the plant stems, cut them into small strips about the thickness of matchsticks and 3-5 cm in length. Soak them completely in a separatory solution for 48-72 hours until the fibers are filamentous. After washing, break down the fibers. Finally, dilute the fibers and put them into a machine for analysis using a HiRes Fiber Quality Analyzer (OpTest Equipment Inc.) (follow the operating instructions published on the company's official website for specific procedures).

[0093] 4. Data Analysis All data were analyzed using GraphPad Prism 10 software and one-way ANOVA.

[0094] Although embodiments of the present invention have been disclosed above, they are not limited to the applications listed in the specification and embodiments. They can be applied to various fields suitable for the present invention. For those skilled in the art, other modifications can be easily made. Therefore, without departing from the general concept defined by the claims and their equivalents, the present invention is not limited to the specific details and illustrations shown and described herein.

Claims

1. A SuSy2-SUT4-SWEET5 gene tandem module from Liangshan Cizhu bamboo, characterized in that, include: The promoter 35S, DfSuSy2 gene, 3×Flag tag, self-cleaving peptide P2A, DfSWEET5 gene, 3×HA tag, DfSUT4 gene and EGFP tag; the arrangement is 35S::DfSUSy2-3×Flag-P2A-DfSWEET5-3×HA-P2A-DfSUT4-EGFP; The nucleotide sequences of the DfSuSy2 gene are shown in SEQ ID No:1, the DfSUT4 gene in SEQ ID No:2, the DfSWEET5 gene in SEQ ID No:3, the 35S promoter in SEQ ID No:4, the 3×Flag tag in SEQ ID No:5, the self-cleaving peptide P2A in SEQ ID No:6, the 3×HA tag in SEQ ID No:7, and the EGFP tag in SEQ ID No:

8.

2. A recombinant plasmid, characterized in that, It includes the Liangshan Cizhu SuSy2-SUT4-SWEET5 gene tandem module as described in claim 1.

3. A recombinant bacterial strain, characterized in that, The recombinant plasmid described in claim 2 was transformed into Agrobacterium to obtain a recombinant strain.

4. The application of the Liangshan Cizhu SuSy2-SUT4-SWEET5 gene tandem module as described in claim 1 in plants.

5. The application of the recombinant plasmid as described in claim 2 in plants.

6. The application of the recombinant strain as described in claim 3 in plants.

7. The application as described in claim 4, 5, or 6, characterized in that, The plants mentioned are Liangshan bamboo, tobacco, Arabidopsis thaliana, potato, or moso bamboo.

8. The application of the Liangshan Cizhu SuSy2-SUT4-SWEET5 gene tandem module as described in claim 4 in plants, characterized in that, Includes the following steps: Step 1: Construct the SuSy2-SUT4-SWEET5 gene tandem module of *Phyllostachys liangshanensis*. Step 2: Transformation with Agrobacterium; Step 3: Select the positive strains from Step 2 to infect the plants.

9. The application of the Liangshan Cizhu SuSy2-SUT4-SWEET5 gene tandem module as described in claim 8 in plants, characterized in that, In step three, the infection method is one of the following: leaf disc transformation, injection, inflorescence infection, or stem segment infection.

10. The application of the Liangshan Cizhu SuSy2-SUT4-SWEET5 gene tandem module as described in claim 8 in plants, characterized in that, In step three, the plants are tobacco, Arabidopsis thaliana, potato, or bamboo.

Images