A method for improving resistance to goss' wilt in corn
By overexpressing the ZmLOX12 protein in maize, constructing a recombinant expression vector, and transforming maize plants, the problems of drug resistance and narrow disease resistance spectrum in existing technologies were solved, achieving broad-spectrum disease resistance and high-efficiency breeding.
Patent Information
- Application Number
- CN202610794989.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-06-04
- Publication Date
- 2026-07-07
AI Technical Summary
Existing technologies for controlling corn sheath blight suffer from problems such as drug resistance, insufficient stability of biological control, scarcity of disease-resistant gene resources, lack of a comprehensive control system covering the entire chain, and lagging molecular monitoring of pathogen variation, making it difficult to cope with the disease's concealment and rapid spread.
By overexpressing the ZmLOX12 protein in maize using genetic engineering techniques, and utilizing its regulation of the jasmonic acid signaling pathway to enhance resistance, a recombinant expression vector was constructed and transformed into maize plants to achieve broad-spectrum disease resistance of the ZmLOX12 protein.
It significantly improved the resistance of transgenic maize to sheath blight, expanded the disease resistance spectrum, improved breeding efficiency, reduced breeding costs, and provided a broad spectrum of disease-resistant gene resources in monocotyledonous plants.
Smart Images

Figure CN122344591A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering plant disease resistance technology, and specifically relates to a method for improving the resistance of maize to sheath blight. Background Technology
[0002] Sheath blight in maize (Zea mays) is caused by Rhizoctonia solani and is a significant soil-borne fungal disease threatening global maize production. Current control technologies include: chemical control, primarily using fungicides such as thifluzamide and tebuconazole, which can inhibit the pathogen, but long-term use has led to resistance in some strains reaching 6.46-20.08 times, and poses environmental and health risks; biological control relies on antagonistic bacteria such as Bacillus amyloliquefaciens and mycorrhizal fungi, achieving a inhibition rate of up to 92.4%, but its effectiveness is limited by environmental conditions such as temperature and humidity; disease-resistant breeding has cloned resistance-related genes such as ZmFBL41 and ZmLecRK1, but because resistance is often controlled by multiple genes, genetic improvement is difficult; agricultural measures such as crop rotation and crop residue removal can reduce primary sources of infection, but long-term implementation is costly and the effects are unstable. Existing technologies have significant drawbacks: drug resistance is a prominent issue, biological control is not stable enough, disease-resistant gene resources are scarce, there is a lack of a comprehensive prevention and control system covering the entire chain of "prevention-monitoring-treatment", and molecular monitoring of pathogen mutations is lagging behind, making it difficult to cope with the concealment and rapid spread of diseases.
[0003] corn ZmLOX12 The gene, a member of the 9-LOX family, plays a crucial role in plant disease resistance. Studies have shown that this gene enhances maize's resistance to various pathogens by regulating the jasmonic acid (JA) signaling pathway. For example, *Trichoderma virens* infection induces the expression of the ZmLOX12 protein, whose promoter region's cis-acting element responds to pathogen signals, activating the expression of downstream defense genes. In the mutant lox12-1, transcription of JA biosynthesis genes was significantly suppressed after *Trichoderma* treatment, leading to decreased resistance to *Colletotrichum graminicola*, indicating that the ZmLOX12 protein is a core regulator of systemically induced resistance (ISR). Furthermore, the ZmLOX12 protein is also essential in resistance to *Fusarium verticillioides* infection; the mutant exhibits higher pathogen colonization rates and fungal toxin accumulation. At the molecular level, the ZmLOX12 protein catalyzes lipidooxygenation to generate 12-oxophytic dienoic acid (OPDA), which is further converted into JA and activates the expression of defense-related genes.
[0004] Large-scale varietal resistance identification data show that a variety's resistance to different diseases is not always consistent—the same variety may show high resistance to one disease but be susceptible to another. For example, experimental results show that the resistance of the same variety to ear rot may be different from its resistance to sheath blight or stem rot, which further proves that there are significant differences in the resistance mechanisms and regulatory genes of different fungal diseases. Therefore, the disease resistance gene screened or identified for one pathogen cannot be directly expected to be equally effective against another pathogen. Functional verification must be carried out in a specific disease system (Zhang Huimin, Song Xudong, Zhou Guangfei, et al. Research progress on sheath blight of maize[J]. Jiangsu Agricultural Sciences, 2022, 50(02):8-14.; Li Hui, Gou Xiaosong, Zhang Xiaowei, et al. Screening and comprehensive evaluation of maize ear rot resistant varieties in Southwest China[J]. Hubei Agricultural Sciences, 2023, 62(07):7-11+18.).
[0005] In recent years, gene editing technologies (such as CRISPR-Cas9) have been used to verify the function of the ZmLOX12 protein, and the stress-inducible properties of its promoter provide a target for designing disease-resistant molecular modules. However, the natural variation of this gene in different maize germplasms and its contribution to broad-spectrum resistance still need to be studied in depth, and its disease resistance stability under field conditions and its synergistic effect with other defense pathways also urgently need to be explored. Summary of the Invention
[0006] In view of the deficiencies in the prior art, the present invention proposes a method to improve the resistance of maize to sheath blight.
[0007] This invention discloses a method for improving maize resistance to sheath blight, which involves overexpressing the ZmLOX12 protein in maize using genetic engineering techniques. The amino acid sequence of the ZmLOX12 protein is shown in SEQ ID NO.1.
[0008] The nucleotide sequence of the gene encoding the ZmLOX12 protein is shown in SEQ ID NO.2.
[0009] This invention discloses the application of a recombinant expression vector in improving maize resistance to stripe disease, wherein the recombinant expression vector contains the aforementioned encoding gene.
[0010] This invention discloses the application of recombinant cells in improving maize resistance to stripe disease, wherein the recombinant cells contain the recombinant expression vector described above.
[0011] This invention discloses the application of an expression cassette in improving maize resistance to stripe disease, wherein the expression cassette contains the aforementioned coding gene.
[0012] Furthermore, this invention discloses the application of the ZmLOX12 protein in improving maize resistance to sheath blight.
[0013] The application is selected from one or more of the following: 1) Prepare agents with anti-sheath blight effects; 2) Develop transgenic maize with or improved resistance to sheath blight.
[0014] The method for cultivating transgenic maize with or improved resistance to sheath blight includes overexpressing the ZmLOX12 protein in maize and cultivating transgenic maize plants.
[0015] Compared with the prior art, the present invention has the following beneficial effects: In the method of this invention, after the ZmLOX12 protein is overexpressed in maize plants, the resistance of transgenic crops containing it to sheath blight is significantly improved. This not only greatly enhances the disease resistance of transgenic crops but also expands the disease resistance spectrum of the protein, solving the problems of limited disease resistance mechanisms and narrow disease resistance spectrum in existing technologies. Through the modification and optimization of genetic engineering technology, the ZmLOX12 protein has been successfully made to have broad-spectrum disease resistance, and the breeding efficiency of disease-resistant plants has been improved to a certain extent, while reducing breeding costs. Attached Figure Description
[0016] Figure 1 This invention accesses ZmLOX12 Map of the recombinant gene expression vector LP-PTLOX12; Figure 2 These are 15 samples of the present invention. ZmLOX12 PCR detection diagram of the gene; where WT is the wild-type plant, PC is the plasmid control, NC is the water control, and 1-15 are 15 transgenic positive plants (transformed with the nucleotide sequence shown in SEQ ID NO.2, expressing the ZmLOX12 protein shown in SEQ ID NO.1); Figure 3 This is a schematic diagram of gene expression level analysis according to the present invention; Figure 4 This is a schematic diagram of the field phenotypes of sheath blight in each of the transformants of this invention; Figure 5 This is a schematic diagram showing the overall disease incidence of the offspring of multiple transformants of the present invention. Detailed Implementation
[0017] The technical solutions of the embodiments of this application will be further described clearly and completely below with reference to the accompanying drawings. It should be noted that the described embodiments are only some embodiments of this application, and not all embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of this application without creative effort are within the scope of protection of this application.
[0018] This invention proposes a method to improve maize resistance to sheath blight. Overexpression of the ZmLOX12 protein in maize plants significantly enhances the resistance of transgenic crops containing this protein to sheath blight. This not only greatly improves the disease resistance of transgenic crops but also expands the disease resistance spectrum of this protein, solving the problems of limited disease resistance mechanisms and narrow disease resistance spectrum in existing technologies. Through genetic engineering modification and optimization, the ZmLOX12 protein has been successfully endowed with broad-spectrum disease resistance, improving the breeding efficiency of disease-resistant plants and reducing breeding costs to a certain extent. Furthermore, ZmLOX12 is a conserved 9-lipoxygenase gene in monocotyledonous plants. Phylogenetic analysis and Southern blot hybridization results show that homologous genes of ZmLOX12 are widely present in major monocotyledonous plants such as sorghum, rice, and wheat, and their amino acid sequence identity is usually above 70%, with highly conserved LOX catalytic domains and PLAT domains. Based on the principle of functional conservation of orthologous genes, it can be expected that overexpression of ZmLOX12 or its orthologous genes in other monocotyledonous plants may also enhance resistance to the corresponding sheath blight (or other diseases caused by Rhizoctonia solani). The technical solution of this invention provides a new gene resource and strategy for broadly enhancing resistance to sheath blight in monocotyledonous plants.
[0019] Example 1: Construction, preservation, and detection of recombinant expression vectors The ZmLOX12 protein is derived from maize. Its amino acid sequence is shown in SEQ ID NO.1. Nanjing Genscript Biotech Co., Ltd. synthesized the gene encoding the ZmLOX12 protein by attaching an Nco I restriction site to its 5' end and an EcoRI restriction site to its 3' end. ZmLOX12 The nucleotide sequence of the gene is shown in SEQ ID NO.2.
[0020] The synthesized SEQ ID NO.2 shown ZmLOX12The nucleotide sequence of the gene was ligated into the cloning vector pEASY-T5 (TransGen Biotech, Beijing, Cat. No.: CT501-01), following the instructions for use of the pEASY-T5 vector. This yielded the LP-T recombinant cloning vector, which was then transformed into *E. coli* T1 competent cells (TransGen Biotech, Beijing, Cat. No.: CD501) using a heat shock method. The heat shock conditions were as follows: (1) 50 μL of Escherichia coli T1 competent cells and 10 μL of plasmid DNA (recombinant cloning vector LP-T) were incubated in a water bath at 42℃ for 30s; then incubated in a water bath at 37℃ for 45 min (shaking at 200 rpm) and spread on LB agar plates containing ampicillin (100 mg / L) (tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, agar 15 g / L, pH adjusted to 7.5 with NaOH) overnight.
[0021] (2) Pick white colonies and incubate them overnight at 37°C in LB liquid medium (tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, ampicillin 100 mg / L, pH adjusted to 7.5 with NaOH).
[0022] (3) Alkaline extraction of plasmids: Centrifuge the bacterial culture at 12,000 rpm for 1 min, discard the supernatant, and precipitate the bacterial cells with 100 μL of ice-cold solution I (25 mM Tris-HCl, 10 mM EDTA (ethylenediaminetetraacetic acid), 50 mM glucose, pH 8.0); add 150 μL of freshly prepared solution II (0.2 M NaOH, 1% SDS (sodium dodecyl sulfate)), invert the tube 4 times to mix, and place on ice for 3-5 min; add 150 μL of ice-cold solution III (4 M potassium acetate, 2 M acetic acid), mix thoroughly immediately, and place on ice for 5-10 min; centrifuge at 4℃ and 12,000 rpm for 5 min, add 2 volumes of anhydrous ethanol to the supernatant, mix well, and place at room temperature for 5 min; centrifuge at 4℃ and 12,000 rpm for 5 min. After 30 min, discard the supernatant, wash the precipitate with 70% ethanol and air dry; add 30 μL of TE (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) containing RNase (20 μg / mL) to dissolve the precipitate; digest the RNA in a water bath at 37℃ for 30 min; store at -20℃ for later use.
[0023] After the extracted plasmid was identified by Nco I and EcoRI digestion, positive clones were sequenced for verification. The results showed that the nucleotide sequence inserted into the recombinant cloning vector LP-T was the one shown in SEQ ID NO:2 of the sequence listing. ZmLOX12 The nucleotide sequence of a gene, i.e. ZmLOX12 The nucleotide sequence of the gene was inserted correctly.
[0024] The recombinant cloning vector LP-T and expression vector LP-BB1 (vector backbone: pCAMBIA3301 (available from CAMBIA)) were digested with restriction endonucleases Nco I and EcoRI, respectively. The excised nucleotide sequence fragment of the disease resistance gene LOX12 was then inserted between the Nco I and EcoRI sites of the expression vector LP-BB1, constructing the recombinant expression vector LP-PTLOX12. ZmLOX12 The recombinant expression vector LP-PTLOX12 is shown in the image below. Figure 1 As shown.
[0025] Wherein, KanR: kanamycin gene; Ori: pUCorigin represents the replication region sequence of plasmid pUC, which can guide the double-stranded DNA replication process; RB: right boundary; pZmUbi1: from the maize ubiquitin gene promoter (SEQ ID NO.3); LOX12: ZmLOX12 Nucleotide sequence of the gene (SEQ ID NO.2); Nos: terminator of carmine synthase (SEQ ID NO.4); PAT: phosphinic acid acetyltransferase, used for transformation screening and conferring glufosinate resistance in transgenic plants (SEQ ID NO.5); 35S: terminator from cauliflower mosaic virus (CaMV) (SEQ ID NO.6); LB: left border.
[0026] Example 2 2.1 Plant Transformation and Detection The recombinant expression vector LP-PTLOX12 obtained in Example 1 was transformed into Agrobacterium to obtain recombinant Agrobacterium.
[0027] Transformation was performed using the conventional Agrobacterium infection method. Aseptically cultured transgenic maize embryos were co-cultured with recombinant Agrobacterium to transfer T-DNA from the constructed recombinant expression vector LP-PTLOX12 into the maize chromosome, thereby generating transgenic maize events.
[0028] (1) Infection For Agrobacterium-mediated maize transformation, briefly, immature embryos are isolated from maize and contacted with a suspension of Agrobacterium, wherein the recombinant Agrobacterium is capable of transforming maize embryos into maize embryos. ZmLOX12 The nucleic acid sequence of the gene and PATThe nucleic acid sequence of the gene is delivered to at least one cell of one of the immature embryos. In this step, the immature embryo is specifically immersed in a recombinant Agrobacterium suspension (OD660 = 0.4-0.6, infection medium (MS salt 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 68.5 g / L, glucose 36 g / L, acetylsuccinone (AS) 40 mg / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, pH 5.3) to initiate inoculation.
[0029] (2) Co-cultivation The embryos were co-cultured with Agrobacterium for a period of time (3 days). Specifically, after the infection step, the embryos were cultured on solid medium (MS salt (Murashige & Skoog Basal Salt Mixture) 4.3 g / L, casein 300 mg / L, sucrose 20 g / L, glucose 10 g / L, acetylsylgenone (AS) 100 mg / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, agar 8 g / L, pH 5.8).
[0030] (3) Recovery Following this co-culture phase, there is a selective “recovery” step. In the “recovery” step, the recovery medium (MS salt 4.3 g / L, casein 300 mg / L, sucrose 30 g / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, plant gel 3 g / L, pH 5.8) contains at least cephalosporins, but no selectants for plant transformants are added.
[0031] (4) Choose Specifically, the embryos were cultured on a solid recovery medium containing antibiotics but without a selector to eliminate Agrobacterium and provide a recovery period for infected cells. Next, the inoculated embryos were cultured on a medium containing a selector (N-(phosphonocarboxymethyl)glycine) and the growing transformed callus was selected. Specifically, the embryos were cultured on a selection solid medium containing a selector (MS salt 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, N-(phosphonocarboxymethyl)glycine 0.25 mol / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, plant gel 3 g / L, pH 5.8), resulting in selective growth of transformed cells.
[0032] (5) Regeneration Then, the callus tissue regenerates into a plant. Specifically, callus tissue grown on a medium containing a selector is cultured on solid media (MS differentiation medium and MS rooting medium) to regenerate a plant.
[0033] The selected resistant callus tissues were transferred to MS differentiation medium (MS salt 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, 6-benzyladenine 2 mg / L, N-(phosphonocarboxymethyl)glycine 0.125 mol / L, plant gel 3 g / L, pH=5.8) and cultured at 25℃ for differentiation. The differentiated seedlings were transferred to MS rooting medium (MS salt 2.15 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, indole-3-acetic acid 1 mg / L, agar 8 g / L, pH=5.8) and cultured at 25℃ until approximately 10 cm tall, then transferred to a greenhouse for further cultivation until fruit set. In the greenhouse, the seedlings were cultured at 28℃ for 16 h daily, followed by 8 h at 20℃.
[0034] 2.2 Detection of transgenic maize plants (1) The maize plants transformed with the disease resistance gene LOX12 were verified by ordinary PCR using 2×EasyTaq PCRSuperMix (Cat.No: AS111-11) from Beijing TransGen Biotech Co., Ltd.
[0035] The PCR primers were: pZmUbi1-01-F:GATGCTCACCCTGTTGTTTGGT (SEQ ID NO.7) and ZmLOX12-R:CGGCGTTGGTCTTCTTGTAG (SEQ ID NO.8).
[0036] PCR detection fragment size: 483 bp.
[0037] The PCR reaction conditions were: 30 cycles, each cycle being 95℃ for 30 min; 58℃ for 30 min; 72℃ for 40 min.
[0038] (2) Verify the transformation using qRT-PCR ZmLOX12 Genetic corn plants Take the transfer in separately ZmLOX12 Approximately 100 mg of maize plant leaves containing the nucleotide sequence of the gene (SEQ ID NO.2) were used as a sample. Genomic DNA was extracted using the EasyPure Plant Genomic DNA Kit (containing RNase A) (Cat. No: EE111-01) from Beijing TransGen Biotech Co., Ltd., and detected by TransStart Green real-time PCR. ZmLOX12 Gene copy number. Wild-type maize plants were used as a control, and the same analysis was performed using the same method. The experiment was repeated in triplicate, and the average value was taken.
[0039] (3) Detection ZmLOX12 The specific method for determining gene copy number is as follows: (a) Take the transfer ZmLOX12 100 mg of maize plant nucleotide sequence and 100 mg of leaves from wild-type maize plants were ground into homogenates in a mortar with liquid nitrogen, and three replicates were taken for each sample. (b) Use the EasyPure Plant Genomic DNA Kit (containing RNase A) from Beijing TransGen Biotech Co., Ltd. to extract genomic DNA from the above samples. Refer to the product instructions for specific methods. (c) The concentration of genomic DNA in the above samples was determined using a NanoDrop 2000 (Thermo Scientific); (d) Adjust the genomic DNA concentration of the above samples to the same concentration value, wherein the concentration value ranges from 80 to 100 ng / μL; (e) The copy number of the samples was identified using TransStart Green quantitative PCR. Samples with known copy numbers were used as standards, and wild-type maize plant samples were used as controls. Each sample was tested in triplicate, and the average value was taken. The primer and probe sequences for quantitative PCR were as follows: The following primers are used to detect ZmLOX12 Gene nucleotide sequence: Primer 1: ZmLOX12-qRT-F:ACCCGGTGGTGATCAGTAGA (SEQ ID NO.9); Primer 2: ZmLOX12-qRT-R:CCCCTTGTTGCGTGTTGATG (SEQ ID NO.10).
[0040] The PCR reaction system is as follows: 2×TransStartR Green qPCR SuperMix (Transgen) 10μL; 10μM forward primer, 1μL; 10μM Reverse primer, 1μL; Passive Reference Dye I (50X) 0.4μL; 2 μL of genomic DNA; Water (ddH2O) 5.6 μL; The PCR reaction conditions are as follows: Step temperature time 1. 95℃ for 5 minutes; 2. 95℃ for 30 seconds; 3. 60℃ for 1 minute; Go back to step 2 and repeat 40 times.
[0041] The data was analyzed using SDS2.3 software (Applied Biosystems).
[0042] 15 samples ZmLOX12 The results of the PCR detection test for the gene are as follows: Figure 2 As shown, the results indicate that... ZmLOX12 The nucleotide sequence of the gene has been integrated into the chromosome set of the maize plants tested, and the transfer... ZmLOX12 The nucleotide sequence of the gene in maize plants is always a single copy. ZmLOX12 Genetically modified corn plants.
[0043] Example 3 Bioassay of the transgenic maize event ZmLOX12 Multiple replicates of the transgenic maize event ZmLOX12 were set up, and transgenic maize events ZmLOX12-1, ZmLOX12-2, and ZmLOX12-3 were obtained. The maize plants from these events (see diagram for gene expression levels) are shown below. Figure 3 Resistance identification of wild-type maize plants (non-GMO, transformation recipient control (CK)) under natural disease conditions in the field was verified. ZmLOX12 The function of genes in enhancing resistance to maize sheath blight.
[0044] Select fields with a high incidence of natural sheath blight in maize, with uniform soil fertility and convenient irrigation and drainage. Follow conventional maize cultivation practices in field management, and do not carry out artificial inoculation or chemical control of sheath blight to ensure sufficient conditions for natural disease development.
[0045] During the maize planting season, a randomized block design was used, with the control A178 and each LP503 transformant planted separately. Each material was replicated three times, with each replicate planted in rows 5 m long, 0.6 m apart, and 0.3 m apart to ensure consistent ventilation and light penetration in the field. Resistance to maize sheath blight was investigated during the large trumpet stage (a critical period for the natural onset of maize sheath blight, when symptoms are most pronounced at the base of the stem).
[0046] The total number of plants in each replicate internal control (CK) and each ZmLOX12 transformant was investigated row by row, and the total number of plants was recorded. Observe the symptoms of corn stem base blight (water-soaked lesions, brown necrotic spots, and mycelial entanglement at the stem base are all considered as diseased plants), and count the number of diseased plants; calculate the incidence rate using the formula: Incidence rate (%) = (Number of diseased plants / Total number of plants) × 100%. Calculate the average incidence rate of each material in three replicates, and compare the differences in incidence rates between the control (CK) and each transformant in the transgenic plants.
[0047] The control group consisted of 41 plants, with 31 plants showing disease incidence, indicating a high incidence rate of sheath blight of 75.61%. This demonstrated high susceptibility to sheath blight, with obvious brown necrotic lesions and mycelial infection visible at the base of the stem.
[0048] The incidence of sheath blight in all transformants was significantly lower than that in the control, and the field phenotype was as follows: Figure 4 As shown, the overall disease incidence in the offspring of multiple transformants is as follows: Figure 5 This demonstrates that ZmLOX2 exhibits stable resistance to sheath blight. Figure 5 The results showed that more than 10 transgenic maize plants, including ZmLOX12-1, ZmLOX12-2, and ZmLOX12-3, exhibited high resistance to sheath blight, indicating that the resistance of ZmLOX12 to sheath blight was not accidental. At the T1 level, the resistance levels to sheath blight were significantly higher than those of wild-type maize plants, and all showed high resistance.
[0049] In summary, this invention utilizes disease-resistant genes. ZmLOX12 The expressed disease-resistant protein ZmLOX12 exhibits better resistance to sheath blight, which not only expands the spectrum of this disease-resistant protein but also provides better protection for the plant.
[0050] Obviously, those skilled in the art can make various modifications and variations to this application without departing from the spirit and scope of this application. Therefore, if such modifications and variations fall within the scope of the claims of this application and their equivalents, this application also intends to include such modifications and variations.
Claims
1. A method for improving maize resistance to sheath blight, characterized in that, The ZmLOX12 protein was overexpressed in maize using genetic engineering techniques. The amino acid sequence of the ZmLOX12 protein is shown in SEQ ID NO.
1.
2. The method as described in claim 1, characterized in that, The nucleotide sequence of the gene encoding the ZmLOX12 protein is shown in SEQ ID NO.
2.
3. The application of a recombinant expression vector in improving maize resistance to wilt disease, characterized in that, The recombinant expression vector contains the encoding gene as described in claim 2.
4. The application of a recombinant cell in improving maize resistance to wilt disease, characterized in that, The recombinant cells contain the recombinant expression vector as described in claim 3.
5. An expression cassette for improving maize resistance to wilt disease, characterized in that, The expression cassette contains the encoding gene as described in claim 2.
6. The application of the ZmLOX12 protein according to claim 1 in improving maize resistance to sheath blight.
7. The application according to claim 6, characterized in that, The application is selected from one or more of the following: 1) Prepare agents with anti-sheath blight effects; 2) Develop transgenic maize with or improved resistance to sheath blight.
8. The application according to claim 7, characterized in that, The method for cultivating transgenic maize with or improved resistance to sheath blight includes overexpressing the ZmLOX12 protein of claim 1 in maize and cultivating transgenic maize plants.