SgRNA targeting mstn gene and application thereof in constructing cat myostatin gene knockout model
By designing sgRNA targeting the MSTN gene and integrating the CRISPR/Cas9 gene editing platform, the technical bottleneck of constructing a domestic cat MSTN gene knockout model has been solved, realizing an efficient and safe live MSTN gene knockout model in domestic cats, providing an important tool for muscle biology and disease research.
Patent Information
- Application Number
- CN202610537534.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-22
- Publication Date
- 2026-07-10
AI Technical Summary
Existing technologies lack efficient and highly specific sgRNA design for the MSTN gene in domestic cats. The unique reproductive physiology of domestic cats makes embryo retrieval difficult, and there is a lack of a technical system for efficiently and safely delivering the CRISPR/Cas9 editing system to fertilized eggs and supporting normal embryo development. It is difficult to construct a viable and passivable MSTN gene knockout live model.
We designed and validated sgRNAs (SEQ ID NO: 1 and SEQ ID NO: 2) targeting the MSTN gene, integrated and optimized the procedures for superovulation, RNP preparation, microinjection of fertilized eggs and embryo transfer, formed a complete CRISPR/Cas9 gene editing platform, and successfully constructed an MSTN gene knockout domestic cat model.
This study achieved highly efficient and specific editing of the MSTN gene in domestic cats, constructed the world's first live MSTN gene knockout model in domestic cats, broke through the technical barriers to functional gene research in domestic cats, provided an important tool for muscle biology and disease research, and demonstrated a clear genetic background and preliminary safety verification of the model.
Smart Images

Figure CN122357549A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a target MSTN The study of gene sgRNA and its application in constructing a feline myostatin gene knockout model belongs to the field of gene editing and animal model construction technology. Background Technology
[0002] Myostatin ( Myostatin, MSTN ), also known as growth differentiation factor-8 ( GDF-8 ), is transforming growth factor-β ( TGF-β Members of the superfamily, skeletal muscle is a key negative regulator of skeletal muscle growth. Loss of its function leads to an overdeveloped "double muscle" phenotype, a phenomenon that has been confirmed in various species, including mice, cattle, pigs, and sheep, and has significant value in livestock breed improvement and biomedical research. MSTN pass SMAD2 / 3, AMPK / SIRT1 / PGC-1α, Akt / mTOR Signaling pathways regulate muscle cell development and metabolism, making them important targets for research on diseases such as muscular dystrophy and muscle atrophy, as well as key objects for developing muscle growth-promoting therapies (such as antibodies and inhibitors).
[0003] Domestic cats are not only important companion animals but also excellent spontaneous model animals for studying human diseases, especially neuromuscular diseases (such as spinal muscular atrophy), where they have unique advantages. Their pathological processes are highly similar to those in humans, providing an important platform for drug development and the validation of treatment strategies. Although CRISPR / Cas9 genome editing technology has been widely used in many species, its application in domestic cats is still in its early stages. Currently, most published reports focus on coat color-related genes (such as...). KIT (genes) or allergen genes (such as) Fel d 1 Attempts to edit genes, for MSTN This functional gene, which has significant scientific research value and application potential, has not yet been successfully knocked out and used to cultivate a viable, passivable gene-edited domestic cat model.
[0004] Current technologies face multiple technical bottlenecks in achieving efficient gene editing in domestic cats and obtaining live models: 1) a lack of experience and experimental validation data on the design of efficient and highly specific sgRNAs for specific functional genes in domestic cats; 2) the unique reproductive physiology of domestic cats, with low and unstable superovulation efficiency, difficulty in embryo retrieval, and challenging and low-survival-rate embryo micromanipulation techniques (such as pronuclear visualization and cytoplasmic injection); 3) a lack of a complete technical system for efficiently and safely delivering the CRISPR / Cas9 editing system to fertilized eggs in domestic cats and supporting normal embryonic development to delivery. Therefore, developing a system specifically for domestic cats is crucial. MSTNThe efficient and reliable CRISPR / Cas9 gene editing platform is a milestone for expanding the use of domestic cats as a biomedical model for muscle biology and disease research, and for exploring new ways to genetically improve muscle traits in pets. Summary of the Invention
[0005] Purpose of the invention: This invention provides a targeted MSTN The sgRNA of the gene and its application in constructing a feline myostatin gene knockout model.
[0006] Technical solution: This invention provides a targeted MSTN The sgRNA of the gene, the nucleotide sequence of which is shown in SEQ ID NO.1 and / or SEQ ID NO.2.
[0007] Among them, GATCCTCAGTAAACTTCGCC (SEQ ID NO: 1) targets... MSTN Exon 1 of the gene; GTACACCAAGCAAACCCCAG (SEQ ID NO: 2), which targets MSTN Gene exon 3.
[0008] The present invention also provides an expression cassette or recombinant vector containing the sgRNA.
[0009] The sgRNA was cloned into a PX458 vector containing the Cas9 protein-coding sequence and a green fluorescent protein reporter gene. The recombinant vector was then used to transfect feline kidney F81 cells to verify gene editing activity.
[0010] The present invention also provides the application of the sgRNA in constructing a feline myostatin gene knockout model.
[0011] This invention also provides a method for constructing a feline myostatin gene knockout model, comprising the following steps: (1) The sgRNA is mixed with Cas9 protein to form a ribonucleoprotein complex; (2) Introduce the ribonucleoprotein complex described in step (1) into the cytoplasm of a cat zygote in the pronuclear stage; (3) The embryo is transferred into the fallopian tube of a recipient female cat that is in estrus at the same time, and she will naturally become pregnant and give birth; (4) Genomic DNA analysis of the offspring cats obtained from the birthing process and MSTN Genotyping and screening MSTN Gene knockout cats.
[0012] The target sequence of the sgRNA mentioned in step (1) is SEQ ID NO: 1 or SEQ ID NO: 2.
[0013] Preferably, sgRNA with target sequence SEQ ID NO: 2 is used.
[0014] In step (1), the final concentration of the Cas9 protein is 50-200 ng / µL, and the final concentration of each sgRNA is 20-100 ng / µL.
[0015] The genotype of the feline myostatin gene knockout model is: MSTN Gene heterozygous knockout.
[0016] In step (2), the cat fertilized eggs in the pronuclear stage are obtained through superovulation treatment.
[0017] The superovulation treatment method involves a single administration of pregnant mare serum gonadotropin combined with follicle-stimulating hormone.
[0018] The superovulation treatment method specifically involves a single intramuscular injection of PMSG 40 IU / kg and FSH 2.0 IU / kg based on body weight, followed by an intramuscular injection of hCG 20 IU / kg 96 hours later to induce ovulation.
[0019] In this embodiment, superovulation treatment was performed on multiple breeds of donor cats (Ragdoll, American Shorthair, Silver Shaded, and Tabby).
[0020] The present invention also provides a feline myostatin gene knockout model obtained by the method described above.
[0021] In the model MSTN The gene knockout was caused by a frameshift mutation resulting from the insertion of a guanine atom 2 bp upstream of the PAM sequence in the target sequence of SEQ ID NO: 2.
[0022] The present invention also provides the use of the sgRNA in reducing MSTN protein levels in cats.
[0023] This invention also provides the application of the said feline myostatin gene knockout model in any of the following: (1) Used to study the mechanisms of muscle development, regeneration and metabolic regulation; (2) As a disease model simulating human muscle-related diseases, the diseases include muscular dystrophy and muscular dystrophy; (3) As an in vivo testing model for evaluating the efficacy of therapies or drugs that promote muscle growth or improve muscle metabolism.
[0024] This invention provides and validates targeted methods for domestic cats. MSTNThe highly efficient sgRNA sequences of the gene (SEQ ID NO: 1 and SEQ ID NO: 2) were obtained, and a complete method was established, including optimized superovulation, RNP preparation, intracytoplasmic sperm injection (ICSI), embryo transfer, and genotyping. Using this method, a healthy embryo carrying the c.995_996insG frameshift mutation was successfully obtained. MSTN Heterozygous knockout domestic cats were identified, and their phenotypes of skeletal muscle hypertrophy and decreased MSTN protein expression were preliminarily confirmed. This work completed the study of domestic cats. MSTN The first construction of a gene knockout live model.
[0025] The principle of this invention: This invention aims to construct a myostatin gene knockout model for domestic cats. Its core principle is that by integrating and optimizing a complete chain of technologies covering "target design - in vitro validation - reproductive engineering - live acquisition - safety assessment", it overcomes for the first time the multiple technical bottlenecks of achieving efficient and specific gene knockout and cultivating a live model in domestic cats, a non-model mammal with low reproductive efficiency.
[0026] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: 1. Technological Innovation and Platform Establishment: This invention is the first to systematically establish a CRISPR / Cas9 genome editing platform suitable for domestic cats, and successfully constructs the world's first [unclear - possibly a specific type of platform]. MSTN The gene knockout live model of domestic cats has broken through the technical barriers to the study of functional genes in domestic cats.
[0027] 2. Clear and efficient core components: Through rigorous in vitro, cellular, and in vivo three-level verification, two sgRNAs, SEQ ID NO:1 and SEQ ID NO:2, were identified. In particular, SEQ ID NO:2 is a highly efficient editing tool for the MSTN gene in domestic cats, providing a core sequence that can be directly applied to subsequent research.
[0028] 3. Complete and reliable process flow: This invention integrates a complete set of standardized operating procedures from target design and verification, germ cell acquisition, microinjection editing to embryo transfer and cultivation, forming a reproducible and scalable technology system for constructing gene knockout models for domestic cats.
[0029] 4. The model has outstanding value: the constructed model... MSTN The gene knockout domestic cat model provides an unprecedented tool for in-depth research on muscle biology and muscle diseases in mammalian (cat) systems that are more closely related to humans. It fills the gap in large animal models in this field and has significant value for basic scientific research and translational medicine.
[0030] 5. Preliminary safety verification: Sequencing analysis of potential off-target sites revealed no off-target mutations caused by the sgRNA used, preliminarily demonstrating that the gene editing specificity of this construction method is high and the genetic background of the model is relatively clear. Attached Figure Description
[0031] Figure 1 This is a complete technical flowchart for constructing the MSTN gene knockout model for domestic cats according to the present invention.
[0032] Figure 2 The results show the in vitro cleavage activity verification of four candidate sgRNAs. (A) sgRNA location map; (B) electrophoresis diagram; (C) efficiency quantification bar chart.
[0033] Figure 3 for MSTN Agarose gel electrophoresis image of the knockout plasmid.
[0034] Figure 4 for MSTN Sequence alignment of knockout plasmids.
[0035] Figure 5 This is a fluorescence image of cells after transfection.
[0036] Figure 6 This is a flow cytometry cell sorting diagram.
[0037] Figure 7 for MSTN Gel electrophoresis image of the knockout cell line.
[0038] Figure 8 for MSTN Sequencing chromatogram of gene knockout cell lines.
[0039] Figure 9 Agarose gel electrophoresis of the TA clone product of PX458-MSTN-sgRNA1 knockout cells.
[0040] Figure 10 A representative Sanger sequencing chromatogram of a TA clone from a PX458-MSTN-sgRNA1 knockout cell.
[0041] Figure 11 The mutation frequency distribution in PX458-MSTN-sgRNA1 knockout cells.
[0042] Figure 12 Agarose gel electrophoresis of the TA clone product of PX458-MSTN-sgRNA2 knockout cells.
[0043] Figure 13 A representative Sanger sequencing chromatogram of a TA clone from a PX458-MSTN-sgRNA2 knockout cell.
[0044] Figure 14 Distribution of mutation frequencies in PX458-MSTN-sgRNA2 knockout cells.
[0045] Figure 15 Figure 1 shows the phenotypic observation and genotypic identification results of a live MSTN gene knockout domestic cat model. (A) Heterozygous knockout kittens ( MSTN + / - (A) Comparison with wild-type littermates; (B) Surrogate mother cats with 5-month-old heterozygous knockout cats.
[0046] Figure 16 This is a chromatogram of the target site (sgRNA1) sequenced.
[0047] Figure 17 This is a chromatogram of the target site (sgRNA2) sequenced.
[0048] Figure 18 This is the sequencing result of the TA clone of the PCR amplification product.
[0049] Figure 19 Gel electrophoresis image of PCR products amplified from potential off-target sites.
[0050] Figure 20 For the presumed GPC3 Off-target sites were subjected to sequence alignment and chromatographic analysis.
[0051] Figure 21 For the presumed ZDHHC4 Off-target sites were subjected to sequence alignment and chromatographic analysis.
[0052] Figure 22 For the presumed XYLB Off-target sites were subjected to sequence alignment and chromatographic analysis.
[0053] Figure 23 Wild type and MSTN + / - Histological and protein expression analysis of knockout cat gluteus maximus muscle tissue. (A) Representative H&E stained section of muscle tissue (scale bar: 100 μm); (B) Quantitative map of cross-sectional area of muscle fibers; (C) Western blot images of MSTN and GAPDH (internal control) proteins; (D) Relative quantitative analysis of MSTN protein expression. Detailed Implementation
[0054] The technical solution of the present invention will be further described below with reference to the accompanying drawings.
[0055] The experiments of this invention have been approved by the Animal Ethics Committee.
[0056] Example 1: Targeting domestic cats MSTN Highly efficient sgRNA screening and validation of genes 1. Based on domestic cats MSTN The gene sequence (Gene ID: 101081322) was used to design and screen four sgRNAs targeting different exon regions using the online design tool CHOPCHOP (see Table 1). The corresponding DNA oligonucleotide chains were synthesized by Beijing Qingke Biotechnology Co., Ltd.
[0057] 2. In vitro digestion verification: Using domestic cat genomic DNA as a template, DNA fragments containing each sgRNA target site were amplified by PCR. The primers for amplifying the MSTN-sgRNA1 target site were the upstream primer 5'-AATGAATCAGCTCACCCTTG-3' and the downstream primer 5'-TACACTAAGAGGGCTACTCA-3', with a product size of 674 bp and an annealing temperature of 55℃. The primers for amplifying the MSTN-sgRNA2 target site were the upstream primer 5'-GGAAAGTGTTTCAGGACCTAT-3' and the downstream primer 5'-AGACTTTAAAGCACACTCCT-3', with a product size of 750 bp and an annealing temperature of 58℃. (PCR reaction system: 50 μL total system containing 2 μL genomic DNA, 2 μL each of upstream and downstream primers (10 μM), 25 μL 2× PCR Master Mix, and ddH2O added to make up to 50 μL; amplification program: 94°C pre-denaturation for 3 min; 94°C denaturation for 30 min.) Annealing at TM value for 30 s, extension at 72°C for 30 s, for a total of 35 cycles; final extension at 72°C for 5 min). The purified PCR products were incubated with Cas9 protein (purchased from Genscript) and various sgRNAs at 37°C for 1 hour. Agarose gel electrophoresis results showed ( Figure 2 sgRNA1 and sgRNA2 can effectively cleave target DNA to produce fragments of the expected size. Their cleavage efficiencies were 47.3% and 51.0%, respectively, as calculated by ImageJ software. However, sgRNA3 and sgRNA4 did not show cleavage activity under the experimental conditions.
[0058] 3. Cellular-level validation: The coding sequences of sgRNA1 and sgRNA2 were cloned into the PX458 vector (Addgene#48138), and BbsI was selected as the restriction site for the PX458 vector to construct recombinant plasmids PX458-MSTN-sgRNA1 and PX458-MSTN-sgRNA2. Electrophoresis and sequencing confirmed their correctness. Figure 3 and Figure 4 ).in, Figure 3 PX458-S1 in: PX458- MSTN-sgRNA1 plasmid; PX458-S2: PX458- MSTN S1: sgRNA 1; S2: sgRNA 2. The plasmid was transfected into the cat kidney F81 cell line using Lipofectamine 2000. 24-36 hours after transfection, fluorescence microscopy revealed that approximately 40% of the cells expressed green fluorescent protein (GFP). Figure 5 and Figure 6 GFP-positive cells were collected by flow cytometry sorting. Genomic DNA was extracted from the cells, and the target regions were amplified by PCR and directly sequenced. The primers for amplifying the MSTN-sgRNA1 target were upstream primer 5'-AATGAATCAGCTCACCCTTG-3' and downstream primer 5'-TACACTAAGAGGGCTACTCA-3', with a product size of 674 bp and an annealing temperature of 55℃. The primers for amplifying the MSTN-sgRNA2 target were upstream primer 5'-GGAAAGTGTTTCAGGACCTAT-3' and downstream primer 5'-AGACTTTAAAGCACACTCCT-3', with a product size of 750 bp and an annealing temperature of 58℃. (PCR reaction system: 25 μL total system containing 1 μL genomic DNA, 1 μL each of forward and reverse primers (10 μM), 12.5 μL 2× PCR Master Mix, and ddH2O added to bring the total to 25 μL; amplification program: 94°C pre-denaturation for 3 min; 94°C denaturation for 30 s, TM annealing for 30 s, 72°C extension for 30 s, for a total of 35 cycles; final extension at 72°C for 5 min), the results showed obvious overlapping peaks at both sgRNA1 and sgRNA2 target sites ( Figure 7 and Figure 8 This indicates that mutations were successfully induced in the cell population. Further TA cloning of the PCR products and sequencing of selected clones allowed for analysis of the detailed types and frequencies of insertion / deletion mutations. Figures 9-14 ). Figure 9 and Figure 12 The electrophoresis results showed that both groups of TA clones yielded a single band of the expected size. Figure 10 and Figure 13 The sequencing chromatogram confirmed a typical Indel mutation signal at the target site; mutation frequency statistics ( Figure 11 and Figure 14The results showed that in the sgRNA1 group, base deletions accounted for 60% (12 / 20), large fragment deletions accounted for 15% (3 / 20), and wild-type mutations accounted for 25% (5 / 20), with no base insertions detected. In the sgRNA2 group, base deletions and base insertions each accounted for 40% (8 / 20 each), large fragment deletions accounted for 10% (2 / 20), and wild-type mutations accounted for 20% (4 / 20), with its overall mutation efficiency (80%) slightly higher than that of sgRNA1 (75%). These results confirm that both sgRNAs can effectively mediate MSTN gene editing in cells.
[0059] 4. Conclusion: SEQ ID NO: 1 (sgRNA1) and SEQ ID NO: 2 (sgRNA2) were screened as effective sgRNAs that can be used to efficiently construct a domestic cat MSTN gene knockout model.
[0060] Table 1. Cats MSTN sgRNA sequence listing of genes
[0061] Example 2: Editing of domestic cat zygotes and obtaining a live model based on the CRISPR / Cas9 RNP complex according to Figure 1 The method shown is generated and verified using CRISPR / Cas9. MSTN Knockout cat: 1. Preparation of RNP complexes: sgRNA1 and sgRNA2, which have been validated to be highly efficient in vitro and in cells, were selected and incubated separately with Cas9 protein in vitro to form ribonucleoprotein complexes. The final concentration of the working solution used for microinjection was: 200 ng / µL for Cas9 protein and 100 ng / µL for each sgRNA.
[0062] 2. Superovulation and Fertilized Oocyte Retrieval: A superovulation protocol was used on healthy donor cats: a single intramuscular injection of PMSG (40 IU / kg) and FSH (2.0 IU / kg) was administered based on body weight. Ninety-six hours later, hCG (20 IU / kg) was injected to induce ovulation, followed by mating. Surgical flushing was performed to collect pronuclear-stage fertilized oocytes. This protocol yielded an average of 25 ± 3 fertilized oocytes per donor cat.
[0063] 3. Microinjection and embryo transfer: The RNP complex was microinjected into the cytoplasm of 121 high-quality fertilized eggs. After injection, 97 morphologically normal embryos were transferred into the fallopian tubes of four recipient female cats that were in estrus at the same time.
[0064] 4. Offspring Acquisition and Initial Screening: The recipient cat became pregnant and gave birth, yielding a total of 7 kittens (6 alive and 1 dead). Ear tissue samples were taken from the live kittens.
[0065] Example 3: MSTN Genotyping of gene knockout domestic cat models 1. Sample collection and DNA extraction: Ear tissue samples were collected from offspring kittens at approximately 1 week of age to extract genomic DNA.
[0066] 2. Target Site PCR Amplification and Sequencing: PCR amplification and Sanger sequencing were performed on the target regions of sgRNA1 and sgRNA2. The primers for amplifying the MSTN-sgRNA1 target were upstream primer 5'-AATGAATCAGCTCACCCTTG-3' and downstream primer 5'-TACACTAAGAGGGCTACTCA-3', producing a product size of 674 bp, with an annealing temperature of 55℃. The primers for amplifying the MSTN-sgRNA2 target were upstream primer 5'-GGAAAGTGTTTCAGGACCTAT-3' and downstream primer 5'-AGACTTTAAAGCACACTCCT-3', producing a product size of 750 bp, with an annealing temperature of 58℃. (The standard PCR reaction system consisted of a 25 μL total volume containing 1 μL of genomic DNA, 1 μL each of upstream and downstream primers (10 μM), 12.5 μL of 2× PCR Master Mix, and ddH2O added to bring the volume to 25 μL; the amplification program was 94°C pre-denaturation for 3 seconds.) The process involved 35 cycles: denaturation at 94°C for 30 seconds, TM annealing for 30 seconds, and extension at 72°C for 30 seconds; followed by a final extension at 72°C for 5 minutes. Heterozygous knockout kittens (MSTN) + / - )like Figure 15 and Figure 16 As shown. Sequence analysis revealed that one of the cats showed a clear double-overlapping peak in the sequencing chromatogram of the sgRNA2 target site (as shown). Figure 18 This suggests a heterozygous mutation; while the target site for sgRNA1 is a wild-type sequence ( Figure 17 ).
[0067] 3. TA Cloning Validation of Precise Mutations: The PCR product of the sgRNA2 target region of this cat was subjected to TA cloning and sequencing. The results showed ( Figure 18 ), one of the individual MSTN The allele inserted a guanine (c.995_996insG) at the second base upstream of the PAM sequence (AGG) of the target sequence in SEQ ID NO: 2. This single-base insertion caused a reading frame shift, successfully constructing a heterozygous knockout model of the MSTN gene in domestic cats.
[0068] Example 4: Model-specific off-target effect assessment 1. Potential Off-Target Site Prediction and Validation: Potential off-target sites for sgRNA2 were predicted using the CCTop online tool. The top 3 sites with the highest prediction scores were selected. GPC3 (NCBI Accession: NC_058386.1), ZDHHC4 (NCBIAccession: NC_058383.1) and XYLB (NCBI Accession: NC_058376.1 gene), primers were designed targeting 3 sites, and the primer sequences are as follows: GPC3-F TGCACAACATCTGGGGGTTC, GPC3-R : TAGCATTTCAGCAGATGCCTT (product 638 bp); ZDHHC4-F :CCTTCCCTCCCACTAGCAAC, ZDHHC4-R :CCCTGCGGTAGGTAACACAA (product 617bp); XYLB-F :CTGCTCCTAGGCTGCAGGAAG, XYLB-R :TGCAGCTGGAACAGACGTG (product 505 bp).
[0069] 2. Sequencing and alignment analysis: MSTN Using genomic DNA from heterozygous knockout cats and their littermates (wild-type cats), PCR amplification and Sanger sequencing were performed on the above-mentioned loci (conventional PCR reaction system: 25 μL total system containing 1 μL genomic DNA, 1 μL each of forward and reverse primers (10 μM), 12.5 μL 2× PCR Master Mix, and ddH2O added to bring the total to 25 μL; amplification program: 94°C pre-denaturation for 3 min; 94°C denaturation for 30 s, 60°C annealing for 30 s, 72°C extension for 30 s, for a total of 35 cycles; final extension at 72°C for 5 min). Sequencing results showed ( Figure 19 and Figures 20-22 ),exist MSTN In heterozygous knockout cats, all three potential off-target site sequences were completely identical to those in the wild-type control, and no mutations were detected. Figure 19 Lanes 1-3: PCR products of the GPC3, ZDHHC4, and XYLB genes from wild-type (WT) samples, respectively. Lanes 4-6: MSTN. + / - PCR products of GPC3, ZDHHC4 and XYLB genes in the sample.
[0070] Example 5: MSTN Preliminary phenotypic analysis of gene knockout models 1. Histological analysis: Collection MSTN Gluteus maximus muscle samples from heterozygous knockout cats and wild-type control cats were subjected to H&E staining and morphometric analysis. Results showed ( Figure 23 A and Figure 23 B) MSTN + / - The average cross-sectional area of muscle fibers in knockout cats was significantly increased by approximately 52% compared to wild-type cats. P<0.01 ), exhibiting a hypertrophic phenotype of muscle fibers.
[0071] 2. Protein level verification: Western blot analysis showed ( Figure 23 C and Figure 23 D), MSTN + / - The expression level of MSTN protein in the muscle of knockout cats was approximately 38% of that in wild-type controls, confirming the gene knockout effect at the protein level.
Claims
1. A targeted MSTN The sgRNA of a gene is characterized by, Its nucleotide sequence is shown in SEQ ID NO.1 and / or SEQ ID NO.
2.
2. An expression cassette or recombinant vector, characterized in that, It contains the sgRNA as described in claim 1.
3. The expression cassette or recombinant vector according to claim 2, characterized in that, The sgRNA was cloned into a PX458 vector containing the Cas9 protein coding sequence and a green fluorescent protein reporter gene.
4. A method for constructing a feline myostatin gene knockout model, characterized in that, Includes the following steps: (1) The sgRNA of claim 1 is mixed with Cas9 protein to form a ribonucleoprotein complex; (2) Introduce the ribonucleoprotein complex described in step (1) into the cytoplasm of a cat zygote in the pronuclear stage; (3) The embryo is transferred into the fallopian tube of a recipient female cat that is in estrus at the same time, and she will naturally become pregnant and give birth; (4) Genomic DNA analysis of the offspring cats obtained from the birthing process and MSTN Genotyping and screening MSTN Gene knockout cats.
5. The method according to claim 4, characterized in that, The final concentration of Cas9 protein in step (1) is 50-200 ng / µL, and the final concentration of each sgRNA is 20-100 ng / µL.
6. The method according to claim 4, characterized in that, The genotype of the feline myostatin gene knockout model is: MSTN Gene heterozygous knockout.
7. The method according to claim 4, characterized in that, The fertilized egg in the pronuclear stage mentioned in step (2) is obtained through superovulation treatment.
8. The method according to claim 7, characterized in that, The superovulation treatment method involves a single administration of pregnant mare serum gonadotropin combined with follicle-stimulating hormone.
9. A feline myostatin gene knockout model obtained by the method of any one of claims 4 to 8.
10. The application of the feline myostatin gene knockout model of claim 9 in any of the following: (1) Used to study the mechanisms of muscle development, regeneration and metabolic regulation; (2) As a disease model simulating human muscle-related diseases, the diseases include muscular dystrophy and muscular dystrophy; (3) As an in vivo testing model for evaluating the efficacy of therapies or drugs that promote muscle growth or improve muscle metabolism.