Cotton photoperiod and temperature sensitive male sterile gene ghnac14 and application thereof

By creating a photoperiod- and temperature-sensitive male-sterile line for cotton and using CRISPR/Cas9 technology to silence or knock out the GhNAC14 gene, the problems of high cost and low efficiency in cotton seed production have been solved, achieving high-efficiency seed production and breeding results.

CN122357569APending Publication Date: 2026-07-10INST OF COTTON RES CHINESE ACAD OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
INST OF COTTON RES CHINESE ACAD OF AGRI SCI
Filing Date
2026-04-20
Publication Date
2026-07-10

AI Technical Summary

Technical Problem

The lack of gene resources that can respond to environmental signals and precisely regulate fertility conversion in cotton hybrid seed production leads to high production costs and low efficiency. The scarcity of existing photoperiod- and temperature-sensitive male sterile lines also limits the application of gene editing technology.

Method used

The photoperiod-temperature-sensitive male sterile line of cotton was created by silencing or knocking out the GhNAC14 gene. The male sterility was achieved under long-day, high-temperature conditions and male fertility under short-day, low-temperature conditions using the CRISPR/Cas9 method. The ghnac14 photoperiod-temperature-sensitive male sterile line was obtained through hybridization and backcrossing.

Benefits of technology

This has enabled self-pollination and hybridization breeding of photoperiod- and temperature-sensitive male-sterile cotton lines, reducing seed production costs, improving seed production efficiency, breaking through seed production bottlenecks, and providing efficient genetic resource support.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122357569A_ABST
    Figure CN122357569A_ABST
Patent Text Reader

Abstract

This invention discloses a photothermosensitive male sterility gene for cotton. GhNAC14 Its application belongs to the field of plant genetic engineering technology. GhNAC14 The regulation of fertility by homologous genes from two upland cotton subgenomes, A and D, has not yet been reported. This invention utilizes CRISPR / Cas9 gene editing technology to simultaneously mutate homologous genes. GhNAC14_A and GhNAC14_D , created ghnac14 Mutants; ghnac14 Under long-day, high-temperature conditions, the organism exhibits male sterility, while fertility is restored under short-day, low-temperature conditions, allowing for self-pollination and reproduction. This was achieved using CRISPR / Cas9 gene editing methods and the resulting... ghnac14 Mutants can be used to create photoperiod-sensitive male-sterile lines in cotton, which is of great significance for the regulation of photoperiod-sensitive male sterility in cotton and for hybrid seed production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and in particular to a photoperiod-sensitive male sterility gene for cotton. GhNAC14 And its applications. Background Technology

[0002] Cotton exhibits significant hybrid vigor, and utilizing this vigor, particularly in the F1 generation, is a crucial strategy for ensuring stable yields and enhancing resistance. However, hybrid seed production often relies on artificial emasculation, which is inefficient and costly. While the F2 generation seed production model, used in recent years, has reduced costs, the bottleneck of trait differentiation and targeted improvement due to population genetic segregation severely restricts the development of downstream industries. Currently, the main challenge in cotton hybrid seed production is the lack of low-cost, high-efficiency, and convenient seed production technologies. Cytoplasmic male sterility systems suffer from the limitation of restorer lines, while nuclear male sterility lines require the removal of 50% of fertile plants, reducing seed production efficiency. Photoperiod / thermo-sensitive genic male sterility (P / TGMS) can be used as a sterile line for hybrid seed production under long-day or high-temperature conditions, while restoring fertility under short-day or low-temperature conditions allows for self-pollination; it offers advantages such as low seed production costs and freedom in pairing. Therefore, photoperiod / thermo-sensitive male sterility lines are one of the core strategies for overcoming the bottlenecks in cotton hybrid seed production and improving seed production efficiency.

[0003] The cotton germplasm resources for photoperiod- and temperature-sensitive male-sterile lines are scarce, and the exploration of genetic resources lags behind. One of the problems in this research area is the lack of genetic resources that can respond to environmental signals and precisely regulate fertility conversion, thus limiting the development of gene editing technology for the targeted design of male-sterile lines. Summary of the Invention

[0004] The purpose of this invention is to provide a photothermosensitive male sterility gene for cotton. GhNAC14 The invention relates to and applies this technology to address the problems existing in the prior art. The photoperiod- and temperature-sensitive male-sterile cotton line created in this invention can self-pollinate, thus enabling its application in cotton hybridization breeding and seed production.

[0005] To achieve the above objectives, the present invention provides the following solution: One of the technical solutions of this invention is to silence or knock out. GhNAC14 The application of genes in regulating male fertility conversion in plants, the aforementioned GhNAC14The nucleotide sequences of the genes are shown in SEQ ID NO.1 or SEQ ID NO.2, and the encoded amino acid sequences are shown in SEQ ID NO.3 or SEQ ID NO.4. It is generally expected that these homologous genes from different plants or different cotton materials have the same or similar functions, and therefore these genes can also be used to improve the agronomic traits of plants. Furthermore, even if the function of these genes cannot be predicted, those skilled in the art can determine whether they have the function of controlling male fertility in plants using the methods provided by this invention and existing technology.

[0006] The second technical solution of this invention is a method for creating photoperiod-sensitive male sterile lines in plants, comprising inhibiting the growth of photoperiod-sensitive male sterile lines in plants. GhNAC14 Gene expression was used to obtain male-sterile plants under long-day, high-temperature conditions and male-fertile plants under short-day, low-temperature conditions.

[0007] The third technical solution of the present invention is a method for obtaining... gnac14 A method for obtaining photothermosensitive male sterile lines, using the method described above. gnac14 Photoperiod- and temperature-sensitive male-sterile lines are hybridized and backcrossed with target materials to obtain the desired results. gnac14 Traits and gene mutations in photothermosensitive male sterile lines.

[0008] The fourth technical solution of the present invention is obtained by the method described above. gnac14 Application of photoperiod- and temperature-sensitive male sterile lines in hybridization breeding and seed production.

[0009] This invention also provides a method for creating photoperiod-sensitive male-sterile lines of cotton, including inhibiting the growth of photoperiod-sensitive male-sterile lines in plants. GhNAC14 Gene expression and / or transcriptional regulation functions enable male sterility under long-day, high-temperature conditions and restoration of male fertility under short-day, low-temperature conditions, allowing for self-pollination and reproduction.

[0010] In some implementations, the methods for inhibiting gene expression and / or activity include any one of gene editing, RNA interference, and T-DNA insertion.

[0011] In some implementations, the gene editing described above uses the CRISPR / Cas9 method.

[0012] In some implementations, the CRISPR / Cas9 method includes: in GhNAC14_A A CRISPR / Cas9 vector target site (MT1) was designed at the second exon of the gene, and the DNA sequence of the target site is shown in SEQ ID NO. 5; GhNAC14_D A CRISPR / Cas9 vector target (MT2) was designed at the fourth exon of the gene, and the DNA sequence of the target is shown in SEQ ID NO.6.

[0013] In some implementations, the hybridization breeding and seed production refers to... gnac14 Photothermosensitive male-sterile lines are used as parents to hybridize and / or backcross with other target materials, thereby enabling the target materials to obtain... gnac14 Traits and gene mutations in photothermosensitive male sterile lines.

[0014] Based on the above technical solution, the present invention has the following technical effects: GhNAC14 ( GhNAC14_A : Gh_A11G0931.1 ; GhNAC14_D : Gh_D11G1073.1 There are no reported studies on the regulation of male reproductive development in cotton by the gene and its encoded protein. This invention utilizes the CRISPR / Cas9 method to simultaneously mutate... GhNAC14_A and GhNAC14_D This results in cotton exhibiting photoperiod- and temperature-sensitive male sterility. The CRISPR / Cas9 gene editing method and the resulting... gnac14 Male-sterile mutants can be used to create photoperiod- and temperature-sensitive male-sterile lines in cotton, which can then be applied to cotton hybridization breeding and seed production. Attached Figure Description

[0015] Figure 1 Primers were designed for the Cas9 sequence in the gene editing vector, and agarose gel electrophoresis was performed after PCR.

[0016] Figure 2 for gnac14 Identification of T3 generation seedlings and their mutation types, observation of anther dehiscence, and staining of TTC (2,3,5-triphenyltetrazolium chloride) pollen viability in plants. Among these, 'a' represents the WT (wt) level under long-day, high-temperature conditions. gnac14-1 , gnac14-2 Stamens and anthers, b represents WT under long-day, high-temperature conditions. gnac14-1 , gnac14-2 Pollen stained with TTC, c represents the WT under short-day and low-temperature conditions. gnac14-1 , gnac14-2 Stamens and anthers, d represents the total wt under short-day and low-temperature conditions. gnac14-1 , gnac14-2 Pollen stained with TTC.

[0017] Figure 3 Paraffin sections of anthers.

[0018] Figure 4 The results are from a scanning electron microscope (SEM) of the anthers. Detailed Implementation

[0019] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field, and the reagents or raw materials used are all purchased from commercial channels or are publicly available unless otherwise specified.

[0020] In recent years, the only reported photoperiod-sensitive male sterile cotton lines are the 9106 line bred from aerospace materials and the photoperiod-sensitive male sterile cotton mutant line obtained through tissue culture. psm4 The lack of cloning and functional analysis of key genes has hindered precise molecular breeding. This invention discovers that GhNAC14 is significantly upregulated in the anthers of the photoperiod-thermosensitive male sterile line psm4, and that a CRISPR knockout mutant... gnac14 It exhibits photoperiod- and temperature-sensitive male sterility. The discovery of this gene lays the theoretical foundation for elucidating the molecular mechanism by which photoperiod regulates male fertility in cotton, and provides crucial genetic resources and patent support for creating novel photoperiod- and temperature-sensitive male sterile lines through molecular means and establishing an efficient cotton two-line hybrid seed production technology system.

[0021] This invention provides GhNAC14 The application of genes in controlling male reproductive development in cotton. GhNAC14 The homologous gene sequences in subgenomes A and D show high sequence similarity, and it is generally predictable that these homologous genes from different plants or different cotton materials will have the same or similar functions. Therefore, these genes can also be used to improve the agronomic traits of plants. Furthermore, even if the function of these genes cannot be predicted, those skilled in the art can determine whether they have the function of controlling male fertility in plants using the methods provided by this invention and existing technology.

[0022] Embodiments of the present invention provide silencing or knockout. GhNAC14 The application of genes in regulating male fertility conversion in plants, the aforementioned GhNAC14 The nucleotide sequence of the gene is shown in SEQ ID NO.1 or SEQ ID NO.2, and the amino acid sequence it encodes is shown in SEQ ID NO.3 or SEQ ID NO.4.

[0023] In some specific implementations, the regulation of plant male fertility is photothermosensitive male sterility.

[0024] In some specific implementations, the plant is cotton.

[0025] This invention also provides a method for creating photoperiod- and thermosensitive male-sterile lines in plants, including inhibiting the growth of photoperiod- and thermosensitive male-sterile lines in plants. GhNAC14 Gene expression was used to obtain male-sterile plants under long-day, high-temperature conditions and male-fertile plants under short-day, low-temperature conditions.

[0026] In some specific implementations, the suppression GhNAC14The methods for gene expression are: simultaneous knockout or silencing. GhNAC14 Two homologous copies of a gene.

[0027] In some specific implementations, the suppression GhNAC14 The methods of gene expression include: gene editing, RNA interference, or T-DNA insertion.

[0028] In some specific implementations, the plant is cotton.

[0029] This invention also provides a method for obtaining... gnac14 A method for obtaining photothermosensitive male sterile lines, using the method described. gnac14 Photoperiod- and temperature-sensitive male-sterile lines are hybridized and backcrossed with target materials to obtain the desired results. gnac14 Traits and gene mutations in photothermosensitive male sterile lines.

[0030] Embodiments of the present invention also provide the method for obtaining gnac14 Application of photoperiod- and temperature-sensitive male sterile lines in hybridization breeding and seed production.

[0031] In some specific implementation schemes, the hybridization breeding and seed production refer to... gnac14 Photothermosensitive male sterile lines were used as parents to cross with other target materials.

[0032] Example 1 CRISPR Cas9 gene editing and cotton shoot tip transformation (1) CRISPR Cas9 editing target design and vector construction We designed and edited the target sgRNA of the GhNAC14 gene using CRISPR-P 2.0 (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR), and sent it to GenScript Biotech for whole genome sequence synthesis and construction into a CRISPR / Cas9 knockout vector.

[0033] The sequences of the GhNAC14 gene, sgRNA, and amino acid sequences are shown in SEQ ID NO. 1-6.

[0034] GhNAC14 (Gh_A11G0931.1;Gh_D11G1073.1): >Gh_A11G0931.1 full sequence 1739 bp

[0035] >Gh_D11G1073.1 full sequence 1730 bp

[0036] >Gh_A11G0931.1 Protein 394 aa SEQ ID NO.3: MNYVKGFRFHPTDAEAIELLWEKVQLDRDSFVQLGDSLAPVITQLNDICKFEPAELPGRSELVSGDNVWYFFCSPRYKYRNSKRKNRVTKKGYWNPTGKFRTIVTTCDGKKITGTRRALVFYKGRVCVKNKKANNTLWIMHEFEFLTLNPNQKSLILCKLKKYYGKVNVSIGEEEQSNQYLPSSNLENHCTNNGIPKEQLNSTEQVAFNENSGIQSELVNNEQTIDEFVDSLLIKNDEFYSNQPYFVHDKQDPKVYSDFQIYNANTDIPKNQEGFSDLTYQKLRTPNDRVWTMNEVGSSSALVANDPSYSEGDNNQHDTYFAEQGSILAFENHVLVDSISMGGSGFDEFLHDGLFMAELSPLPKPPKNPDEVQNHQFSTNEQDEFWNSIFITTD*.

[0037] >Gh_D11G1073.1 Protein 394 aa SEQ ID NO.4: MNYVKGFRFHPTDAEAIELLWEKLQLDRDSFIQLGDSLVPVITQLNDICKFEPAELPGRSELVSGDNVWYFFCSPRYKYRNSKRKNRVTKQGYWNPTGKSRTIVTTCDGKKITGTRQALVFYKGRVCVKNKKANKTLWVMHEFEFLTLNPNQKSLILCKLKKKYGKINVSIGEEEQSNQYLPSSNLENHCTNNGVPKEQLNSTEPVAFSEYSGIQSELVNNEQTVDEFVDSLLIKNDEFYSNQPYFVHDKQEPKVYSDFQIYNANTDIPKNQEGFSDLTYQKLRTPNDRVWTMNEVGSSSGLVANDPSYSNGDNNQHDTSFAEEGSSLAFENHVLVDSISMGGSGFDEFLHNGLFMAELSPLPEPPKNPDEVQNHQFSTNEQDEFCNSIFITTD*.

[0038] sgRNA sequence: SEQ ID NO. 5: ATTGTACGAAATTTGCCGGT TGG.

[0039] SEQ ID NO.6: GTTAAACTCTACAGAGCCGG TGG.

[0040] (2) Identification of cotton shoot tip transformation and positive plants 1) The constructed positive plasmid was transformed with Agrobacterium according to the instructions of Weidi Biotechnology GV3101. The transformed competent cells were plated on RK medium containing kanamycin and rifampin, and incubated in the dark at 28°C for 2-3 days. After single colonies grew, a single colony was picked and placed in 300-500 μL of RK liquid medium. After shaking at 28°C for 12-14 hours, PCR and electrophoresis were performed. The correctly transformed Agrobacterium strain, verified by sequencing, was amplified and resuspended until OD600 = 0.3-0.6.

[0041] 2) Add the peeled CCRI24 cotton stem tips to the above resuspension solution, sonicate for 1 min, and incubate on a shaker at 80 rpm for 10 min.

[0042] 3) Discard the bacterial solution, disperse the cotton stem tips onto the culture medium and incubate at 23℃ for 16 h / 8 h (light / dark) for 2-3 days.

[0043] 4) Transfer the explants to shoot tip selection medium and culture them for 3 days at 35°C for 16 h / 8 h (light / dark) conditions, and then place them in a 28°C culture room.

[0044] 5) Positive plants were obtained one month later. Plant leaves were taken and plant DNA was extracted using the CTAB method for identification. CTAB working solution was prepared according to the formula in Table 1.

[0045] Table 1 CTAB Working Fluid

[0046] CTAB DNA extraction procedure steps: ① Take tender cotton leaves and put them into a 2.0 mL centrifuge tube with sterilized steel beads.

[0047] ②After freezing with liquid nitrogen, the sample is crushed using a sample breaking machine.

[0048] ③ Add β-mercaptoethanol to the CTAB working solution, mix well, and preheat. Add the preheated CTAB lysis buffer to the centrifuge tube containing the sample, place it in a 65 ℃ oven, and invert and shake it once every 10 min. Repeat the operation 3 times.

[0049] ④ Add 800 μL of chloroform-isoamyl alcohol mixture (chloroform:isoamyl alcohol = 24:1) and gently shake to mix.

[0050] ⑤ Centrifuge at 4 ℃ and 12000 rpm for 10 min.

[0051] ⑥ Transfer the supernatant to a 1.5 mL centrifuge tube, and add 0.8 times the volume of pre-cooled isopropanol to the tube. Invert the tube to mix.

[0052] ⑦ When white flocculent DNA is observed to precipitate, centrifuge at 12000 rpm for 1 min and discard the supernatant.

[0053] ⑧ Wash with 75% alcohol and anhydrous ethanol in sequence, and discard the anhydrous ethanol after centrifugation.

[0054] ⑨ Open the lid and place it in a fume hood to evaporate the residual anhydrous ethanol. The next day, add 50 μL of ddH2O to dissolve it, and then use an ultra-micro spectrophotometer to dilute and determine the concentration.

[0055] 6) Identification of positive plants using HI-TOM: ① Primer design Gene-specific primers (18–22 nt) were designed according to standard PCR primer design principles, with the target site located 10–100 bp downstream / upstream of the forward or reverse primers. The recommended length of the target amplified fragment is 150–300 bp (maximum not exceeding 500 bp). For polyploid materials, primers were designed in conserved regions, and homologous sequence alignment was used. After sequencing, the different genome origins were distinguished based on sequence differences between genomes. Bridging sequences were added to the 5' ends of the forward and reverse specific primers: 5'-ggagtgagtacggtgtgc-3' and 5'-gagttggatgctggatgg-3', respectively.

[0056] Table 2 GhNAC14 Primers used for identification

[0057] ② First round of PCR amplification (target fragment amplification) PCR amplification was performed using a 10 μL reaction system, with wild-type DNA (WT) and a template-free control (ddH2O) included. The reaction system (10 μL) consisted of: 1 μL template DNA, 0.5 μL primer F, 0.5 μL primer R, 5 μL 2×Mix, and 3 μL ddH2O. After amplification, 3–5 μL of the product was collected for agarose gel electrophoresis (2% gel recommended) to confirm the acquisition of the expected bands.

[0058] ③ Second round of PCR amplification (barcode / adapter introduction) Barcode-based library construction was performed using 96-well plates: different reverse primer mixtures (RA, RB, etc.) were added in the row direction, and different forward primers (F1–F12) were added in the column direction to form a unique combination corresponding to each well. Second-round PCR was performed using the first-round PCR product as a template, with a reaction volume of 10 μL and an annealing temperature (Tm) set at 56–58 ℃. The reaction volume (10 μL) consisted of: 0.5 μL of first-round PCR product, 0.5 μL of 2PF (10 μM), 0.5 μL of 2PR (10 μM), 0.5 μL of Fx (0.1 μM), 0.5 μL of Rx (0.1 μM), 5 μL of 2×Mix, and 2.5 μL of ddH2O.

[0059] ④ Library mixing, gel recovery, and next-generation sequencing After electrophoresis, the second-round PCR products were mixed in equal volumes from each well and recovered using a 2.5% agarose gel. Theoretically, the second-round PCR bands increased by approximately 50 bp compared to the first-round products. The larger molecular weight target bands were recovered for subsequent sequencing. The gel-recovered products were submitted for next-generation sequencing according to the sample delivery requirements (sample volume 20 μL, concentration >50 μg / μL).

[0060] ⑤ Hi-TOM 2.0 Data Analysis The paired-end data obtained from sequencing were uploaded to the "Mutation detection" module of the Hi-TOM 2.0 website for analysis; the sequencing files were uploaded directly as compressed packages. The reference sequence was the target fragment sequence obtained by cloning with specific primers (the whole genome sequence was not uploaded); the default filtering threshold of 5% was used and the task was submitted to obtain statistical results such as mutation type and frequency.

[0061] Table 3 Primer Sequences

[0062] Example 2 Phenotypic observation of cotton ghnac14 (1) Plant phenotypic observation Cotton CCRI24 and gene-edited plants gnac14 The anthers on the day of flowering were observed under a stereomicroscope to observe the dehiscence of the anthers.

[0063] (2) 2,3,5-Triphenyltetrazolium chloride (TTC) pollen viability staining method On the day the cotton flowers open, the pollen is shaken into TTC staining solution and incubated overnight in a 37 ℃ constant temperature incubator. The pollen is then collected on a glass slide, the moisture is blotted dry with absorbent paper, and the pollen staining is observed under a microscope to determine pollen viability.

[0064] (3) Paraffin sections of anthers 1) Sample fixation: On the day of flowering, the anthers were placed in centrifuge tubes containing FAA fixative for fixation for about 8 hours.

[0065] 2) Dehydration treatment: Anhydrous ethanol was diluted at concentrations of 70%, 80%, 85%, 90%, and 95%, and then dehydrated for 30 min in the order of 70%, 80%, 85%, 90%, 95%, 100%, and 100% ethanol concentration gradient. Then, xylene and anhydrous ethanol (1:1) were added for treatment for 1 h, xylene was added for treatment for 1 h, and a mixture of xylene and pure wax (1:1) was added and dried overnight in an oven at 60 ℃.

[0066] 3) Sample wax infiltration: Add pure wax to the sample tube and treat at 60 ℃ for 24 h. Repeat twice.

[0067] 4) Embedding and sectioning: The sample is embedded and sectioned using an embedding machine and a slicer.

[0068] 5) Sample dewaxing: Dewaxing is performed in the following order: xylene I (20 min), xylene II (20 min), anhydrous ethanol I (5 min), anhydrous ethanol II (5 min), and 75% ethanol (5 min).

[0069] 6) Safranin staining: After staining with safranin for 1 hour, wash off the safranin color with ddH2O.

[0070] 7) Decolorization: Decolorize in sequence using alcohols of 50%, 70%, and 80%.

[0071] 8) Fast Green staining: Immerse in staining solution for 1 min, then dehydrate with anhydrous ethanol.

[0072] 9) Clearing the slides: Clear the slides with clean xylene.

[0073] 10) Observe the images under a microscope and perform image acquisition and analysis.

[0074] (4) Scanning electron microscopy observation Collect CCRI24 and mutant lines gnac14 On the day of flowering, the anther samples were placed on a copper platform, observed and photographed using a scanning electron microscope, and the undehiscent anthers were gently cut open with a single-edged knife.

[0075] Experimental results are as follows Figure 1-2 As shown, gnac14-1 Five bases are missing at the target site of GhNAC14_A, and four bases are missing at the target site of GhNAC14_D. gnac14-2One base was added at the target site in GhNAC14_A, and five bases were deleted at the target site in GhNAC14_D. Both genes underwent frameshift mutations. Under long-day, high-temperature conditions, the wild-type anthers dehisced normally, and pollen viability was normal. gnac14 Anthers do not dehisce, pollen is inactive; under short-day and low-temperature conditions gnac14 The anthers dehisce normally, and the anthers regain their vitality.

[0076] Paraffin sections show that from S9 to S13, under long-day, high-temperature conditions, gnac14 Pollen grains were vacuolated and wrinkled, and the anthers failed to dehisce normally during the S13 stage. Scanning electron microscopy results showed that under long-day, high-temperature conditions, gnac14 The anthers do not split open, and the pollen grains collapse and shrivel.

[0077] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively describe all embodiments here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. Silence or knockout GhNAC14 The application of genes in regulating male fertility conversion in plants is characterized by, The GhNAC14 The nucleotide sequence of the gene is shown in SEQ ID NO.1 or SEQ ID NO.2, and the amino acid sequence it encodes is shown in SEQ ID NO.3 or SEQ ID NO.

4.

2. The application according to claim 1, characterized in that, The regulation of plant male fertility is photothermosensitive male sterility.

3. The application according to claim 1 or 2, characterized in that, The plant in question is cotton.

4. A method for creating photoperiod- and thermosensitive male-sterile lines in plants, characterized in that, Including inhibiting plants GhNAC14 Gene expression was used to obtain male-sterile plants under long-day, high-temperature conditions and male-fertile plants under short-day, low-temperature conditions.

5. The method according to claim 4, characterized in that, inhibition GhNAC14 The methods for gene expression are: simultaneous knockout or silencing. GhNAC14 Two homologous copies of a gene.

6. The method according to claim 5, characterized in that, inhibition GhNAC14 The methods of gene expression include: gene editing, RNA interference, or T-DNA insertion.

7. The method according to any one of claims 4-6, characterized in that, The plant in question is cotton.

8. A way to obtain ghnac14 The method for developing photothermosensitive male sterile lines is characterized by, Obtained by the method described in any one of claims 4-6 ghnac14 Photoperiod- and temperature-sensitive male-sterile lines are hybridized and backcrossed with target materials to obtain the desired results. ghnac14 Traits and gene mutations in photothermosensitive male sterile lines.

9. Obtained by the method according to any one of claims 4-6 ghnac14 Application of photoperiod- and temperature-sensitive male sterile lines in hybridization breeding and seed production.

10. The application according to claim 8, characterized in that, The hybridization breeding and seed production mentioned above refer to the process of... ghnac14 Photothermosensitive male sterile lines were used as parents to cross with other target materials.