Method for detecting nucleic acid mutation with spatial single-cell resolution and application thereof
By using inhibitor substitution amplification technology and fluorescently labeled nucleotide substrates, we have achieved cell type identification and efficient detection of mutant positive cells, solving the sensitivity and cost problems of existing technologies. This technology is suitable for single-cell resolution detection of various tissue sample types.
Patent Information
- Application Number
- CN202610456880.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-08
- Publication Date
- 2026-07-10
AI Technical Summary
Existing spatial genomics analysis methods have trade-offs in sensitivity, throughput, resolution, or compatibility and cost, making it difficult to achieve cell type identification and efficient detection of mutation-positive cells, especially in long-term preserved tissue samples.
In situ PCR amplification was performed using blocking agent substitution amplification (BDA) technology, combined with fluorescently labeled nucleotide substrates and Toehold probes, to achieve selective amplification and efficient enrichment of mutant sequences. The spatial distribution of the amplification products was directly observed using a fluorescence microscope.
It achieves highly sensitive and low-cost mutation detection at the single-cell level, maintains high inhibition efficiency in situ, simplifies the operation process and shortens the detection time, and is suitable for various tissue sample types.
Smart Images

Figure CN122357701A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of gene detection technology, and in particular to a method for detecting nucleic acid mutations with spatial single-cell resolution and its application. Background Technology
[0002] In the spatial molecular detection of tissue sections, immunohistochemistry (IHC) and in situ hybridization (ISH) are two mature techniques that have been widely used for over 50 years. While both ISH and IHC can achieve multiplex detection, the number of samples they can detect is limited by the number of observable dyes. Simply increasing the number of dyes to improve throughput is very limited, and it is difficult to accurately analyze nucleic acid sequence information. Single-cell sequencing (scRNA-seq) can isolate single cells from tissue sections, construct libraries individually, and then sequence them. Although this method can obtain high-throughput sequencing information, it cannot preserve a complete image of the section, losing cell location information.
[0003] In recent years, a series of spatial omics-based biomolecular spatial distribution analysis techniques have been developed. Spatial omics technologies can analyze the spatial distribution information of biomolecules such as DNA, mRNA, and proteins and their modifications in cell and tissue samples, including spatial genomics, spatial transcriptomics, and spatial proteomics. Among them, the research strategies of spatial genomics and transcriptomics are roughly of two types: (i) in situ methods based on fluorescence microscopy, and (ii) ectopic methods based on next-generation sequencing.
[0004] Multiplexed in situ hybridization (smFISH) is based on single-molecule fluorescence in situ hybridization. Typically, this method requires multiple hybridization probes to bind to the same mRNA molecule to amplify the fluorescence signal, which is then detected for identification. This method can detect transcripts with extremely low copy abundance in cells, thus exhibiting excellent sensitivity in spatial analysis. HybISS, the first proposed in situ sequencing technology, uses a barcode-labeled lock probe that specifically binds to RNA. The resulting cDNA, after reverse transcription, undergoes rolling circle amplification (RCA). A bridging probe connects the RCA amplification product to a readout probe, which is covalently modified with one of four fluorescent groups. Subsequent in situ detection is achieved using fluorescence microscopy. While this method has improved the signal-to-noise ratio and detection throughput, it can only image small regions and remains limited by time and data storage constraints. In-situ methods generally require fresh samples and relatively complex, high-precision instruments and equipment.
[0005] Ectopic methods based on next-generation sequencing map back to spatial locations after batch sequencing using spatial barcoding bioinformatics analysis. This is achieved by capturing tissue RNA using spatially barcoded oligonucleotide arrays, linking RNA sequences to spatial locations. Specifically, microarray technology is used to deposit ordered oligonucleotide arrays on glass slides, then thin histological sections are placed on the arrays. Cellular RNA diffuses into the barcoded oligonucleotides through permeation; in situ reverse transcription produces spatially indexed cDNA, which is then amplified to create a library and sequenced. This technology still has some limitations, including low resolution (currently 50–100 μm), high cost per sample, and low RNA capture efficiency. Another ectopic method is laser capture microdissection (LCM), a microdissection technique. LCM uses lasers to physically segment selected regions of interest (ROIs), typically used to separate small areas of tens to hundreds of cells, achieving single-cell resolution after batch sequencing. The advantage of LCM is that it is applicable to both frozen sections and FFPE tissue sections, and can obtain very in-depth analytical data for selected areas. However, each selected area must be collected and processed separately, so the throughput of this method is low, usually limited to studies of less than a hundred sites, and requires specialized instruments and equipment.
[0006] The four main strategies for spatial genomic analysis described above are: (i) multiplex in situ hybridization and (ii) in situ sequencing based on in situ analysis; and (iii) spatial barcoding and (iv) microdissection based on ectopic analysis. These methods involve trade-offs in sensitivity, throughput, resolution, or compatibility and cost, each with its own advantages and disadvantages. However, some problems remain when using these four methods to study lesion tissue sections from patients with a specific disease. (i) Multiplex in situ hybridization and (iii) spatial barcoding can observe the distribution of nucleic acid molecules, mainly RNA, in tissue samples, but their ability to distinguish between single-base mutations and wild-type mutations is weak, especially in analyzing and detecting RNA or non-coding region DNA mutations with low expression levels. (ii) In situ sequencing is based on RCA, thus suffering from slow hybridization reactions, difficulty in design optimization, and poor general applicability of sequences. Furthermore, while (iv) microdissection can cut the ROI in tissue sections, it is difficult to isolate individual cells, thus hindering in-depth studies of specific mutant cell types, the three-dimensional arrangement of cells in the tissue, and their developmental processes. Summary of the Invention
[0007] In view of this, the present invention provides a detection method with spatial single-cell resolution and its application, which can be used alone or in combination with immunofluorescence technology. This invention can simultaneously identify cell types and detect mutant-positive cells. The method is highly sensitive, low-cost, and well-suited for use in cell culture and long-term preservation of clinical tissue samples.
[0008] To achieve the above-mentioned objectives, the present invention provides the following technical solution: In a first aspect, the present invention provides a detection method with spatial single-cell resolution, comprising the following steps: (1) Take tissue samples or cells to be tested for pre-staining, fixation and digestion; (2) Add isBDA reaction solution and perform in situ PCR amplification. After the reaction is complete, discard the reaction solution, fix it again, and perform confocal imaging.
[0009] Furthermore, the isBDA reaction solution includes a forward primer, a reverse primer, and a blocking probe.
[0010] Furthermore, the isBDA reaction solution also includes a nucleotide substrate labeled with a fluorescent dye.
[0011] Furthermore, the forward primer or the reverse primer is modified with a fluorescent group.
[0012] Further, after adding the isBDA reaction solution, seal the edge of the dish lid.
[0013] Furthermore, the reaction program for in situ PCR amplification was 95 °C for 120 seconds. (95 °C, 10 seconds) 60 °C, 30 seconds) x 35 cycles Keep at 4 °C.
[0014] Furthermore, after the in situ PCR amplification was completed, the reaction solution was discarded, Toehold probe solution was added, and in situ PCR amplification was performed again. After the reaction was completed, the reaction solution was discarded, the solution was fixed again, and confocal imaging was performed.
[0015] Secondly, the present invention provides an isBDA reaction reagent, comprising the isBDA reaction solution in any of the above-described detection methods.
[0016] Thirdly, the present invention provides applications of any of the above-described detection methods in any of the following aspects, including: Applications in cell and tissue samples, including frozen tissue, paraffin-embedded tissue, cell culture, and cell smears; Application in the analysis and detection of tissue samples from somatic cell mutation-related genetic diseases; Applications in tumor tissue sample analysis or cancer tissue sample analysis; Application in combination with immunofluorescence protein staining.
[0017] Furthermore, the fluorescent signal labeling method of the detection method is selected from at least one of the following: labeling with a nucleotide substrate incorporating the fluorescent dye, labeling with fluorescent modified primers, and specific labeling with the Toehold probe.
[0018] Blocker displacement amplification (BDA) is a low-abundance mutation enrichment technique based on the principle of competitive hybridization of nucleic acids. During PCR amplification, competitive hybridization occurs between the blocking probe (which is not extended by DNA polymerase) and the primer within each cycle. BDA can selectively amplify mutations. Currently, the experimental system is based on PCR, amplifying extracted and purified DNA. Data is obtained through qPCR or sequencing, but it cannot be applied to cells or tissue sections, nor can it provide spatial distribution information.
[0019] The present invention has the following beneficial effects: This invention presents an innovative in situ cell imaging detection method that enables localization and visualization at the single-cell level. The method selectively inhibits the amplification of wild-type templates, thereby efficiently enriching target mutant sequences. It can identify cell types while detecting mutant-positive cells, offering high sensitivity, low cost, and a simple procedure. Furthermore, by using specific reaction conditions, it maintains high inhibition efficiency even in complex in situ environments, exhibiting good spatial single-cell resolution. Re-fixation after in situ PCR amplification also prevents diffusion and loss of single-cell resolution.
[0020] The detection method of this invention utilizes fluorescently modified dNTPs to convert mutant PCR products into fluorescent signals. During amplification, fluorescent dNTPs are directly incorporated into the nascent DNA strand, allowing the amplified products to be directly observed using a fluorescence microscope. Another fluorescent signal labeling method uses fluorescently modified primers; the primers involved in the reaction to generate PCR products remain at the location of the mutant nucleic acid, allowing for direct observation. Both methods eliminate the need for subsequent hybridization and incubation steps; after the cycle is complete, the spatial distribution information of the target sequence can be directly obtained through imaging, greatly simplifying the operation process and shortening the detection time.
[0021] The detection method of this invention can also utilize the hybridization of fluorescently labeled Toehold probes with target PCR products to generate different colored fluorescent signals for different target sequences. Toehold probes exhibit high sequence specificity; through their strand substitution mechanism, they achieve high specificity at the single-base level while maintaining a fast reaction rate and reducing background signal.
[0022] This invention can be applied to mutation detection in tissue samples of cancer and somatic mutation-related genetic diseases, enabling in situ analysis of mutations at the cellular and tissue section levels, and has promising application prospects. It can be applied to various sample types, including cell culture, cell smears, frozen tissues, and paraffin-embedded tissues, and shows good results in long-term preserved clinical samples. It can be coupled with immunofluorescence methods to accurately distinguish the types of mutated cells in tissues through protein fluorescent labeling, simultaneously achieving in situ detection of target nucleic acid sequences and fluorescence imaging of specific protein markers, thus enabling multimodal joint analysis of nucleic acid mutation information and protein expression information at the single-cell level. By detecting the abundance, location, and mutated cell types of tumor or genetic disease-related mutations in tissues, it can provide important information for clinical diagnosis, prognostic assessment, and mechanistic research. Attached Figure Description
[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.
[0024] Figure 1 This is a cell confocal imaging image from Example 1.
[0025] Figure 2 This is a cell confocal imaging image from Example 2.
[0026] Figure 3 This is a cell confocal imaging image from Example 3.
[0027] Figure 4 This is a confocal imaging image of the FBN3 mutation site in an FCD Ia patient from Example 4.
[0028] Figure 5 The image shows IFiS BDA images of the FBN3 site in FCD Ia and negative patients in Example 5.
[0029] Figure 6 This is an IFiBDA imaging image of the BCL11A site in an FCD Ia patient of Example 5.
[0030] Figure 7 This is an IFiSBDA imaging image of the BRAF site in a ganglion glioma patient from Example 6. Detailed Implementation
[0031] The preferred embodiments of the present invention will be described in detail below with reference to examples. The following examples are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, the experimental methods in the following examples are conventional methods. Where specific techniques or conditions are not specified in the examples, they are performed according to the techniques or conditions described in the literature in the field, or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased from legitimate channels.
[0032] The term "includes" should generally be understood as open-ended and non-restrictive.
[0033] A detection method with spatial single-cell resolution includes the following steps: (1) Take the tissue sample or cells to be tested and culture them in a confocal culture dish, and perform pre-staining, fixation and digestion.
[0034] (2) Add isBDA reaction solution, seal the edge of the dish lid to prevent evaporation. Perform in situ PCR amplification. The reaction program for in situ PCR amplification can be 95 °C for 120 seconds. (95 °C, 10 seconds) 60 °C, 30 seconds) x 35 cycles Maintain at 4 °C. After the reaction is complete, discard the reaction solution, fix the sample again, and perform confocal imaging. Alternatively, after in situ PCR amplification, discard the reaction solution, add Toehold probe solution, perform in situ PCR amplification again, discard the reaction solution after the reaction is complete, fix the sample again, and perform confocal imaging.
[0035] IsBDA reaction solution can include forward primers, reverse primers, and retraction probes. During PCR amplification, competitive hybridization occurs between the retraction probe (which is not extended by DNA polymerase) and the primers in each cycle. For wild-type templates, the retraction probe has a higher hybridization advantage, thus inhibiting primer extension efficiency; however, on mutant templates, the primers have a hybridization advantage and can be efficiently extended and amplified. The difference in extension yield between the two can be exponentially amplified after multiple PCR cycles, ultimately achieving the enrichment of mutant amplification products.
[0036] IsBDA reaction solution may also include nucleotide substrates labeled with fluorescent dyes. Fluorescently labeled dUTPs are added directly to the reaction system. During amplification, the fluorescent dUTPs are directly incorporated into the nascent DNA strand, causing the amplified product to carry a fluorescent signal. Therefore, no subsequent hybridization and incubation steps are required; the spatial distribution information of the target sequence can be directly obtained through imaging after the cycle is complete, greatly simplifying the operation process and shortening the detection time.
[0037] IsBDA reaction reagents include the isBDA reaction solution used in the aforementioned detection methods, specifically including forward primers, reverse primers, and blocking probes. They may also include nucleotide substrates labeled with fluorescent dyes, with the molar percentage of the labeled nucleotide substrates being 5%. Over-labeling can lead to decreased amplification efficiency or fluorescence quenching, while under-labeling may result in an indistinct signal. IsBDA reaction reagents may also include Taq DNA polymerase, preferably at a concentration of 0.2 units / 10 μL.
[0038] The primers in the IsBDA reaction reagent may be fluorescently modified.
[0039] After the IsBDA reaction, the reaction solution can be washed away, and the PCR products can be further hybridized with Toehold probes.
[0040] Source of experimental materials for this invention: Beijing Zhong Sheng Aobang Biotechnology Co., Ltd.: PBS (1x), TBS (1x), cells, Beijing Solarbio Science & Technology Co., Ltd.: 4% paraformaldehyde fixative, Triton X-100, Tris-EDTA antigen retrieval solution, BSA solution. Beijing Lanbolide Trading Co., Ltd.: Proteinase K solution, RNase solution. Shanghai Maclean Biochemical Technology: Acetic acid, ethanol Shanghai Beyotime Biotechnology Co., Ltd.: Anti-fluorescence quenching mounting solution (containing DAPI), Qinghe County Kaimao Rubber Products Factory: 300LSE model double-sided silicone adhesive strips. Shanghai Roche Pharmaceuticals Co., Ltd.: qPCR sealing film. NEB (New England Biolabs) China: Reaction Buffer, Taq Polymerase, Xi'an Baiying Biotechnology Co., Ltd.: iFluor 647-PEG12-dUTP ABcam (Shanghai) Trading Co., Ltd.: Recombinant Anti-Olig2 antibody, Recombinant Anti-NeuN antibody, Goat anti-rabbit IgG H&L (Alexa Fluor® 488), Goat anti-mouse IgG H&L (Alexa Fluor® 568).
[0041] Example 1 The isBDA reaction solution system of Example 1 is shown in Table 1.
[0042] Table 1
[0043] The sequence of the forward primer (TP53) is: ACGGAACAGCTTTGAGGTGC (SEQ ID NO:1), the sequence of the reverse primer (TP53) is: GTGAATCTGAGGCATAACTGCAC (SEQ ID NO:2), the 5' end is labeled with HEX, and the sequence of the blocking probe (TP53) is: GAGGTGCGTGTTTGTGCCTGTCCTAAA (SEQ ID NO:3). The genomic coordinates of the detected mutation site are: Chr17:7673802 G>A, designed based on the GRCh38.p14 human reference genome sequence.
[0044] The experimental procedure for Example 1 is as follows: Cells were seeded at a density of 10^5 cells / dish in confocal culture dishes and cultured for 24 hours. The culture medium was discarded, and fresh medium containing Hoechst (final concentration 1 mM) was added. The cells were incubated at room temperature for 30 minutes, followed by washing three times with PBS for 3 minutes each time. Then, 1 mL of 4% paraformaldehyde fixative was added, and the cells were fixed at room temperature for 30 minutes, followed by washing three times with PBS for 5 minutes each time. Next, 1 mL of 0.25% trypsin was added, and the cells were digested at room temperature for 15 minutes, followed by washing three times with PBS for 5 minutes each time. 200 μL of isBDA reaction solution was added to the confocal dish, and the edges of the dish lids were sealed with sealing film to prevent evaporation. The samples were placed in a plate PCR instrument for thermal cycling using the following program: 37 °C, 120 s → 95 °C, 120 s → (95 °C, 10 s → 60 °C, 30 s) × 35 cycles → storage at 4 °C. After the reaction was complete, the reaction solution was discarded, and 1 mL of 4% paraformaldehyde fixative was added for fixation at room temperature for 10 minutes. The solution was then washed five times with PBS for five minutes each time. Finally, confocal microscopy imaging was performed, and the results are shown below. Figure 1 As shown.
[0045] from Figure 1 As can be seen, the fluorescence intensity signal-to-noise ratio of positive and negative cells is as high as 4.69, indicating that the positive signal has a clean background and high recognition under imaging conditions, which confirms the specificity and reliability of the labeling method.
[0046] The isBDA reaction solution system of Example 2 is shown in Table 2.
[0047] Table 2
[0048] The sequences of the forward primer, reverse primer, and blocking probe are the same as in Example 1.
[0049] The experimental procedure for Example 2 is as follows: Cells were seeded at a density of 10^5 cells / dish in confocal culture dishes and cultured for 24 hours. The culture medium was discarded, and fresh medium containing Hoechst (final concentration 1 mM) was added. The cells were incubated at room temperature for 30 minutes, followed by washing three times with PBS for 3 minutes each time. Then, 1 mL of 4% paraformaldehyde fixative was added, and the cells were fixed at room temperature for 20 minutes, followed by washing three times with PBS for 5 minutes each time. Next, 1 mL of 0.25% trypsin was added, and the cells were digested at room temperature for 15 minutes, followed by washing three times with PBS for 5 minutes each time. 200 μL of isBDA reaction solution was added to the confocal dish, and the edges of the dish lids were sealed with sealing film to prevent evaporation. The samples were placed in a plate PCR instrument for thermal cycling using the following program: 37 °C, 120 s → 95 °C, 120 s → (95 °C, 10 s → 60 °C, 30 s) × 35 cycles → storage at 4 °C. After the reaction was complete, the reaction solution was discarded, and 1 mL of 4% paraformaldehyde fixative was added for fixation at room temperature for 10 minutes. The solution was then washed five times with PBS for five minutes each time. Finally, confocal microscopy imaging was performed, and the results are as follows: Figure 2 As shown.
[0050] from Figure 2 As can be seen, the fluorescence intensity signal-to-noise ratio of positive and negative cells is 1.83, indicating that differentiation can be achieved under these conditions. The detection method of this invention can achieve in-situ imaging detection of mutant cells.
[0051] Example 3 The isBDA reaction solution system of Example 3 is shown in Table 3.
[0052] Table 3
[0053] The sequences of the forward primer, reverse primer, and blocking probe are the same as in Example 1.
[0054] The sequence for incubating the Toehold probe is as follows: 5'-CTTACCTCGCTTAGTGCTCCCTGGGGGCAGCTCGAAAA-3' (SEQ ID NO:4), with ROX marked at the 5' end. 5'-CCAGGGAGCACTAAGCGAGGTAAG-3' (SEQ ID NO:5), with the 3' end marked Quencher.
[0055] The experimental procedure for Example 3 is as follows: Inoculate confocal microspheres at a density of 1 × 10^6 cells per dish and incubate for 24 hours as usual. Discard the culture medium and add fresh medium containing 1 mM Hoechst dye, incubating at room temperature for 10 minutes. After incubation, wash three times with PBS for 3 minutes each time. Then add 1 mL of 4% paraformaldehyde fixative and fix at room temperature for 30 minutes, followed by three washes with PBS for 5 minutes each time. Next, add 1 mL of 0.25% trypsin and digest at room temperature for 15 minutes, washing three times with PBS for 5 minutes each time. After washing, add 200 μL of in-situ blocking replacement amplification reaction solution to the dish and seal the dish tightly with sealing film or special sealing tape to prevent liquid evaporation during the reaction. Place the dishes in a plate PCR instrument and run the following program: 37 °C, 120 s → 95 °C, 120 s → (95 °C, 10 s → 60 °C, 30 s) × 35 cycles → store at 4 °C. After completing the isBDA reaction, discard the reaction solution and add 200 μL of 400 nM Toehold probe solution. Reseal the dish and place it in a plate PCR instrument for the second round of thermal cycling, using the following program: 37 °C, 120 s → 95 °C, 120 s → (95 °C, 10 s → 60 °C, 30 s) × 20 cycles → store at 4 °C. After the reaction, discard the probe solution and add 1 mL of 4% paraformaldehyde for fixation, incubating at room temperature for 10 minutes. Then wash thoroughly with PBS five times, 5 minutes each time. Finally, image acquisition is performed under a confocal microscope, and the results are shown below. Figure 3 As shown.
[0056] from Figure 3 It can be seen that the signal-to-noise ratio of fluorescence intensity between positive and negative cells is 2.26, which can distinguish mutant cells from wild-type cells.
[0057] Example 4 The isBDA reaction solution system of Example 4 is shown in Table 4.
[0058] Table 4
[0059] The sequence of the forward primer (FBN3) is: CACCTCAGTGAGCACACCC (SEQ ID NO:6), the sequence of the reverse primer (FBN3) is: GCAGCCATGAACATCTTAAAGGC (SEQ ID NO:7), and the sequence of the blocking probe (FBN3) is: CACACCCtCATCTGTGAGGGTGAGCTAAA (SEQ ID NO:8). The genomic coordinates of the detected mutation site are: Chr19: 8106119 C>T. The design was based on the GRCh38.p14 human reference genome sequence.
[0060] The experimental procedure for Example 4 is as follows: Surgically removed lesion tissue was flash-frozen in liquid nitrogen and then stored at -80 °C. Before embedding, the tissue was removed and placed on a pre-cooling worktable, and the preservation solution was aspirated. OCT embedding medium was added to the mold, and after positioning the tissue, OCT was added until completely covered. The tissue was then transferred to the cryostat stage for rapid freezing. Once the OCT solidified into white blocks, the tissue could be sectioned. Frozen sections were stored at -20 °C for long-term preservation.
[0061] Brain tissue sections from FCD Ia patients were removed from -20 °C and rinsed with 4 °C PBS to remove OCT embedding agent. The tissue sections were fixed with 4% paraformaldehyde for 30 minutes and washed three times (5 minutes each) with PBS on a shaker. Next, they were subjected to enzyme treatment (2 µg / mL proteinase K, 10 minutes) and acid treatment (10% acetic acid, 1 minute), followed by thorough washing with PBS five times (5 minutes each). After these steps, the tissue area was wiped five times with anhydrous ethanol, dried at room temperature for 15 minutes, and then cooled to a crisp for 3 minutes. Reaction chambers were constructed on glass slides using appropriately sized silicone strips with double-sided adhesive. 20 µL of isBDA reaction solution was added to each reaction chamber, and the slides were sealed with PCR plate sealing film and subjected to thermal cycling amplification using the following program: 37 °C, 120 seconds – 95 °C, 120 seconds. (95 °C, 10 seconds) 60 °C, 30 seconds) x 35 cycles Maintain at 4 °C. After amplification, remove the sealing structure, discard the reaction solution, and fix with 4% paraformaldehyde for 10 minutes. Wash sequentially with TBS (5 minutes) and PBS (twice, 5 minutes each). Finally, add a DAPI-containing anti-quenching mounting medium, cover with a coverslip, and seal the edges with nail polish. After drying, acquire microscopic images. The results are shown below. Figure 4 As shown.
[0062] from Figure 4 As can be seen, the iFluor647 channel has a significant red fluorescence signal, proving that the isBDA technology can achieve in situ detection of FBN3 site mutations in frozen sections of brain tissue from FCD Ia patients.
[0063] Example 5 The isBDA reaction solution system at the FBN3 site in Example 5 is the same as that in Example 3.
[0064] The isBDA reaction solution system for the BCL11A site in Example 5 is shown in Table 5.
[0065] Table 5
[0066] The sequence of the forward primer (BCL11A) is: CTGTTCTCGTGGTGGCGC (SEQ ID NO:9), the sequence of the reverse primer (BCL11A) is: CAGCAGCGCGCTCAAGTC (SEQ ID NO:10), and the sequence of the blocking probe (BCL11A) is: GGCGCGCCGCCTCCAGGC AAAT (SEQ ID NO:11). The genomic coordinates of the detected mutation site are: Chr2: 60461347 G>C, designed based on the GRCh38.p14 human reference genome sequence.
[0067] The experimental procedure for Example 5 is as follows: Day 1 1. Remove OCT embedding agent: Remove the slide with tissue sections from the refrigerator and rinse with PBS at 4 °C to remove the OCT embedding agent.
[0068] 2. Fixation: Fix tissue sections with 4% paraformaldehyde (PFA) for 30 minutes. Then wash with PBS three times on a shaker for 5 minutes each time.
[0069] 3. Circle the tissue regions: Use the hydrophobic screen grouping pen to circle each tissue region.
[0070] 4. Antigen retrieval: Immerse the slide in citrate antigen retrieval buffer (pH 6.0, Servicebio). Microwave for 4 minutes, then allow the slide to cool to room temperature naturally. Wash three times with PBS, 5 minutes each time.
[0071] 5. Permeability and Blocking: Incubate the slides for 1 hour in a 1% BSA (Solarbio) solution containing 0.3% Triton X-100 (prepared with PBS). Wash three times with PBS, 5 minutes each time.
[0072] 6. Primary antibody incubation: Incubate the slides overnight at 4 °C with the primary antibody diluted with blocking buffer. Then wash three times with PBS at 4 °C for 5 minutes each time.
[0073] the next day 7. Secondary antibody incubation: Incubate the slide with the secondary antibody diluted with blocking solution at room temperature for 1 hour.
[0074] 8. Post-fixation: Fix the sections with 4% PFA for 20 minutes. Wash once with TBS for 5 minutes, then wash twice with PBS for 5 minutes each time.
[0075] 9. Digestion: Incubate with 2 µg / mL proteinase K for 10 minutes. Discard the solution and incubate with 10% acetic acid solution for 1 minute. Immediately discard the solution and wash five times with PBS for 5 minutes each time.
[0076] 10. Wiping and Drying: Wipe the tissue area and surrounding tissue five times with anhydrous ethanol. Allow the sections to dry at room temperature for 15 minutes, then dry them with a hairdryer on the cool setting for 3 minutes. During this time, prepare the isBDA reaction mixture.
[0077] 11. Assemble the reaction chamber: Cut the silicone strip with 300LSE double-sided adhesive to the appropriate size and attach it to the glass slide.
[0078] 12. isBDA Amplification: Add 20 µL of isBDA reaction solution to each reaction chamber. Seal the reaction chambers with PCR plate sealing film (NEST) to prevent evaporation and contamination during thermal cycling. Thermal cycling conditions are as follows: 37 °C, 120 s – 95 °C, 120 s (95 °C, 10 seconds) 60 °C, 30 seconds) x 35 cycles Maintain at 4 °C. After the heat cycle is complete, remove the silicone strip and double-sided tape.
[0079] 13. Post-fixation: Discard the reaction solution and fix the sections with 4% PFA for 10 minutes. Wash once with TBS for 5 minutes, then wash twice with PBS for 5 minutes each time.
[0080] 14. Mounting and sealing: Apply a drop of DAPI-containing anti-quenching mounting medium (Beyotime) to the slide and cover with a coverslip. Seal the edges of the coverslip with nail polish and allow it to dry.
[0081] 15. Image acquisition.
[0082] 16. Confocal imaging was performed on two Leica systems on the Capital Medical University shared instrument platform: cell images were acquired using a TCS SP8 STED system mounted on a DMI6000 inverted microscope, and all FCD1a images were acquired using a TCS SP8 system mounted on a DM6000 CS upright microscope. The parameters used were as follows: HC PL APO CS2 63× / 1.40 oil immersion microscope; DAPI / Hoechst (excitation 405 nm, emission 420–470 nm); GFP / Alexa Fluor 488 (excitation 488 nm, emission 497–550 nm); Alexa Fluor 568 (excitation 561 nm, emission 570–619 nm); iFluor647 (excitation 633 nm, emission 650–700 nm).
[0083] The results of the FBN3 site in FCD Ia and negative patients are as follows: Figure 5 As shown. From Figure 5 As can be seen, the imaging results clearly show the neuron (NeuN). + Alexa568 + Oligodendrocytes (Olig2) + Alexa488 + ) and mutation-positive cells detected by isBDA (Alexa647) + Colocalization analysis revealed that the mutant cells were mainly concentrated in oligodendrocytes. This result not only confirms the feasibility of combining isBDA with immunofluorescence technology to successfully label two different cell types simultaneously, but also reveals the spatial distribution characteristics of the mutant cells.
[0084] The results of BCL11A site in FCD Ia patients are as follows: Figure 6 As shown. From Figure 6 As can be seen, cells with the BCL11A mutation are present in the tissue sections. This technique successfully detected the mutation site, precisely revealing that the BCL11A mutation mainly occurs in neuronal cells.
[0085] Example 6 The isBDA reaction solution system of Example 6 is shown in Table 6.
[0086] Table 6
[0087] The sequence of the forward primer (BRAF) is: GGACCCACTCCATCGAGATT (SEQ ID NO:12), the sequence of the reverse primer (BRAF) is: CTTCATGAAGACCTCACAGTAAAAATAG (SEQ ID NO:13), the sequence of blocking probe 1 (BRAF) is: ATCGAGATTTCACTGTAGCTAGACCAAAATCAAATA (SEQ ID NO:14), and the sequence of blocking probe 2 (BRAF) is: TCAAGATTTCACTGTCGCTAGACCAA (SEQ ID NO:15).
[0088] The experimental procedure for Example 6 is the same as that for Example 5.
[0089] Results of BRAF sites in patients with ganglion gliomas, as follows Figure 7 As shown. From Figure 7 As can be seen, the isBDA technology combined with immunofluorescence can be applied to the examination of frozen sections from patients with ganglion gliomas. The results showed that mutation signals were mainly enriched in ganglion cells, consistent with previous studies, thus validating the reliability of this technology.
[0090] The above description is merely a preferred embodiment of the present invention. However, modifications or improvements can be made to the present invention, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.
Claims
1. A detection method with spatial single-cell resolution, characterized in that, Includes the following steps: (1) Take tissue samples or cells to be tested for pre-staining, fixation and digestion; (2) Add isBDA reaction solution and perform in situ PCR amplification. After the reaction is complete, discard the reaction solution, fix it again, and perform confocal imaging.
2. The detection method according to claim 1, characterized in that, The isBDA reaction solution includes a forward primer, a reverse primer, and a blocking probe.
3. The detection method according to claim 2, characterized in that, The isBDA reaction solution also includes a nucleotide substrate labeled with a fluorescent dye.
4. The detection method according to claim 2, characterized in that, The forward primer or the reverse primer is modified with a fluorescent group.
5. The detection method according to claim 1, characterized in that, After adding the isBDA reaction solution, seal the edge of the dish lid.
6. The detection method according to claim 1, characterized in that, The reaction program for in situ PCR amplification was 95 °C for 2 min; 95 °C for 10 s, 60 °C for 30 s, for 35 cycles; and stored at 4 °C.
7. The detection method according to claim 1, characterized in that, After in situ PCR amplification, the reaction solution was discarded, Toehold probe solution was added, and in situ PCR amplification was performed again. After the reaction was completed, the reaction solution was discarded, the solution was fixed again, and confocal imaging was performed.
8. IsBDA reaction reagent, characterized in that, Includes the isBDA reaction solution in the detection method according to any one of claims 1 to 7.
9. The application of any of the following aspects of the detection method according to any one of claims 1 to 7, characterized in that, include: Applications in cell and tissue samples, including frozen tissue, paraffin-embedded tissue, cell culture, and cell smears; Application in the analysis and detection of tissue samples from somatic cell mutation-related genetic diseases; Applications in tumor tissue sample analysis or cancer tissue sample analysis; Application in combination with immunofluorescence protein staining.
10. The application according to claim 9, characterized in that, The fluorescent signal labeling method of the detection method is selected from at least one of the following: labeling with a nucleotide substrate incorporating the fluorescent dye, labeling with fluorescent modified primers, and specific labeling with the Toehold probe.