A biosensor for detecting active acetylcholinesterase and use thereof

Abstract

The application belongs to the technical field of biosensing and specifically relates to a biosensor for detecting active acetylcholinesterase and application thereof. The biosensor comprises nanotubes with nanometer apertures at tips for generating current blocking signals; and a ring bundle DNA tetrahedron carrier for loading a solution containing active acetylcholinesterase to be detected, wherein the ring bundle DNA tetrahedron carrier is TDN1 or TDN4, the sequences of the four DNA single strands in TDN1 are shown as SEQ ID NO. 1 to SEQ ID NO. 4, and the sequences of the four DNA single strands in TDN4 are shown as SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5 and SEQ ID NO. 6. The application utilizes a closed-loop DNA tetrahedron nanostructure anchored at two ends of an aptamer to generate a difference in current signals in a nanometer hole before and after the active AChE is combined, so that high-sensitivity and high-selectivity detection of the active AChE at a single-molecule level is achieved.

Description

Technical Field

[0001] This invention belongs to the field of biosensing technology, specifically relating to a biosensor for detecting active acetylcholinesterase and its application. Background Technology

[0002] Precise monitoring of protease activity is crucial for disease diagnosis and drug development. For example, the abnormal activity of neural target proteases, such as acetylcholinesterase (AChE), is closely associated with neurodegenerative diseases like Alzheimer's. Therefore, developing highly sensitive and selective methods for detecting protease activity not only aids in early disease diagnosis but also provides new perspectives for optimizing treatment strategies. However, existing traditional detection methods (such as the Ellman assay, fluorescent probes, and colorimetric methods) have significant limitations: firstly, they rely on population-averaged signals, making it difficult to distinguish the dynamic behavior of single enzyme molecules; secondly, they lack sensitivity to enzyme conformational changes, failing to identify the functional state of partially inactivated proteins. Furthermore, these methods are often limited by low sensitivity, complex operation, or the need for labeling.

[0003] Currently, research on modulating nanopore signals by utilizing interactions between biomolecules (such as antigen-antibody and enzyme-inhibitor interactions) is gaining momentum, providing new ideas for immobilization-free detection strategies. For example, DNA nanotechnology, especially the self-assembly of structural DNA, offers new solutions to the aforementioned challenges.

[0004] The research group of Su Xin at the School of Life Science and Technology, Beijing University of Chemical Technology (Chem. Sci., 2019, 10, 5959) reported a novel method for detecting and modulating cellular APE1 activity using DNA tetrahedra. Tetrahedra with antennas containing AP sites exhibit high sensitivity and specificity for APE1. It is suitable for in vitro detection of APE1 (detection limit 5 pM) and cellular fluorescence imaging without any auxiliary transfection reagents, distinguishing APE1 expression levels between cancer cells and normal cells. Conversely, tetrahedra with AP sites on a scaffold exhibit high binding affinity for APE1 but limit enzymatic catalysis, thus making this nanostructure a potential candidate for IC50-modifying (IC50) ... 50 A 14.8 nM APE1 inhibitor was obtained. It was demonstrated that the APE1 probe and inhibitor can undergo allosteric transformation via DNA tetrahedral framework shift, and this scaffold has the potential to reversibly inhibit APE1. This method provides a new approach for the fabrication of enzyme probes and regulators.

[0005] The research group of Professor Jingjuan Xu at the College of Chemistry and Chemical Engineering, Nanjing University (ACS Sens, 2024, 9, 988−994) has designed a bifunctional bioconjugate, namely a photosensitive inserted DNA structure, as an intelligent gating module confined within a nanotip. This module is designed to perform ion-electro-photochemical (PEC) biorecognition probes that respond to incident light and biological targets of interest. Photostimulation of the bioconjugate enhances the negative charge at the nanopore to maintain an enhanced ion current. The presence of proteins (such as acetylcholinesterase AChE) or nucleic acids (such as microRNA (miR)-10b) leads to the release of the bioconjugate.

[0006] The research group of Professor Zhenzhen Huang at the College of Chemistry, Jilin University (Biosensors and Bioelectronics, 2025, 271) constructed a three-mode sensing platform for fluorescence / colorimetric / smartphone detection to monitor AChE activity and screen AChE inhibitors. MnO2 nanosheets (NS) can quench the fluorescence emission of Cu3I(SR)2 through internal filtration, while thiocholine (TCh) produced by the hydrolysis of acetylcholine (ATCh) under AChE catalysis can restore the fluorescence emission of Cu3I(SR)2. Based on this, a fluorescence "on" detection method for acetylcholinesterase activity was established with a detection limit of 0.03 U / L and a detection range of 0.25 U / L to 50 U / L. Furthermore, with increasing AChE activity, the Cu3I(SR)2 / MnO2NS sensing system also exhibits a color change from brown to colorless, making colorimetric and smartphone detection of AChE activity possible. However, the measurements only capture the macroscopic average signal of a large number of enzyme molecules, failing to obtain information on heterogeneity and real-time kinetics at the single-molecule level.

[0007] However, the aforementioned recognition probes or biosensors constructed based on the self-assembly of structural DNA are difficult to use for label-free, real-time, single-molecule level enzyme kinetic analysis. How to achieve highly specific and sensitive detection, especially how to convert the functional activity of the enzyme (rather than its mere presence) into a resolvable electrical signal, remains a major challenge in this field. Summary of the Invention

[0008] To address the aforementioned issues, this invention provides a biosensor for detecting active acetylcholinesterase and its application. It utilizes a highly stable, spatially closed loop-bound DNA tetrahedron (a loop-constrained aptamer-functionalized DNA tetrahedron) as a functionalized carrier for AChE. By leveraging the difference in current signals generated in the nanopore before and after binding with active AChE, highly sensitive and selective detection of active AChE is achieved.

[0009] The present invention solves the above-mentioned technical problems through the following technical solutions.

[0010] The first object of the present invention is to provide a biosensor for detecting active acetylcholinesterase, comprising: Nanotubes with nanopores at their tips are used to generate current blocking signals. A circular DNA tetrahedral carrier is used to load a test solution containing active acetylcholinesterase. The circular DNA tetrahedral carrier is either TDN1 or TDN4. Both TDN1 and TDN4 are formed by the annealing and self-assembly of four single-stranded DNA molecules. The sequences of the four single-stranded DNA molecules of TDN1 are shown in SEQ ID NO.1 to SEQ ID NO.4. The sequences of the four single-stranded DNA molecules of TDN4 are shown in SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5 and SEQ ID NO.6.

[0011] The circular DNA tetrahedral carrier binds to active acetylcholinesterase in the test solution, generating a current blocking signal through the nanopore size of the nanotube, enabling single-molecule detection of active acetylcholinesterase.

[0012] Furthermore, the preparation method of the circular DNA tetrahedral vector includes the following steps: Four single-stranded DNA strands were placed in Tris-HCl / MgCl2 buffer and annealed at 95°C. After annealing, the mixture was cooled to 4°C within 10 min to obtain a circularly bundled DNA tetrahedral vector.

[0013] Furthermore, the molar ratio of the four DNA single strands is 1:1:1:1, and the concentration of the looped DNA tetrahedral carrier is 2 μM.

[0014] Furthermore, the concentration of Tris-HCl in the Tris-HCl / MgCl2 buffer was 20 mM, the concentration of MgCl2 was 50 mM, and the annealing time was 5 min to 15 min.

[0015] Furthermore, the nanotubes are glass capillaries with a nanopore size of 55nm to 65nm.

[0016] A second objective of this invention is the application of the aforementioned biosensor for detecting active acetylcholinesterase in the detection of active acetylcholinesterase.

[0017] Furthermore, this includes the following steps: S1. Mix the test solution containing active acetylcholinesterase and the circular DNA tetrahedral carrier in a buffer solution and incubate to form a mixed solution.

[0018] S2. Place the mixed solution inside the nanotube, then immerse it in the working electrode, and immerse the working electrode and reference electrode in the electrolyte solution to form an electrode system; or immerse the reference electrode inside the nanotube containing the electrolyte solution, and immerse the working electrode and reference electrode in the mixed solution to form an electrode system.

[0019] S3. Apply voltage to the electrode system and detect the current blocking signal at the tip of the nanotube. Based on the characteristic changes of the current blocking signal, the detection of active acetylcholinesterase in the test solution is achieved.

[0020] Furthermore, in the mixed solution, the concentration of the circular DNA tetrahedral carrier is 25 nM to 35 nM, and the buffer solution consists of 20 mM Tris-HCl, 1 mM MgCl2, and 600 mM NaCl.

[0021] Furthermore, the voltage is -1.0V to +1.0V.

[0022] Furthermore, the detection range for acetylcholinesterase is 3 fM to 1 nM.

[0023] Compared with the prior art, the present invention has the following advantages: The biosensor provided by this invention utilizes a highly stable, spatially closed loop DNA tetrahedron as a functionalized carrier for AChE. It achieves highly sensitive and selective detection of active AChE by leveraging the difference in current signals generated at the nanopore size of the nanotube before and after binding with active AChE. This tetrahedron is designed to have a specific affinity for AChE. Its stable loop DNA tetrahedron structure ensures that the spatial orientation of the binding site is fixed and not easily disrupted, thus providing a high-affinity and high-specificity binding interface for AChE. When the tetrahedron passes through the nanopore alone, its moderate size generates a stable and repeatable small current blocking signal. Furthermore, based on the nanotube with nanopores at its tip, free AChE, due to its much smaller volume than the nanopore size, cannot generate a distinguishable current signal on its own. When active AChE binds to the aforementioned DNA tetrahedron carrier, a "tetrahedron-AChE" complex is formed. The complex exhibits a significantly increased effective blocking volume through nanopores due to the attachment of AChE, resulting in a significantly amplified and easily distinguishable current blocking signal. This directly and specifically indicates the presence of active AChE molecules and their successful binding to the carrier. AChE activity can be quantitatively analyzed by statistically analyzing the frequency of the characteristic signal per unit time. It features high sensitivity, high selectivity, and is label-free; the entire detection process requires no chemical labeling of the enzyme or substrate and can monitor binding events in real time, reflecting the dynamics of enzyme activity. Attached Figure Description

[0024] Figure 1 This is a schematic diagram illustrating the structure of the circular DNA tetrahedral carrier and biosensor constructed in this invention.

[0025] Figure 2 The diagram shows the integration of the TDN tetrahedral structure with AChE in Examples 1-2 and Comparative Examples 1-3 of the present invention. Figure 2 In the figure, (a) shows the AChE and original current traces for different TDNs combined with AChE, (b) shows the histogram of the statistical distribution of the average event blocking amplitude for different TDNs combined with AChE, and (c) shows the corresponding statistical data for the combination ratio.

[0026] Figure 3 This is a nanopore analysis diagram for the activity detection of TDN1 in Example 1 of the present invention. Figure 3 In the diagram, (a) represents TDN1, (a1) represents TDN-AChE, (b) is a two-dimensional contour plot of current amplitude and residence time for (a), (b1) is a two-dimensional contour plot of current amplitude and residence time for (a1), (c) is a histogram of the statistical distribution of the average event blocking amplitude for (a), and (c1) is a histogram of the statistical distribution of the average event blocking amplitude for (c1).

[0027] Figure 4 The diagram shows the activity evaluation of AChE by TDN1 in Example 1 and TDN2 in Comparative Example 1 of this invention. Figure 4 (a) is a diagram distinguishing the activity of AChE that is inactivated at high temperature and that is active at 37°C, and (b) is a statistical chart of the corresponding binding ratio data.

[0028] Figure 5 The image shows the UV-Vis absorption spectrum of the TDN tetrahedral structure for AChE in Example 1 of this invention.

[0029] Figure 6 The image shows the fluorescence emission spectrum of the TDN tetrahedral structure in Example 1 against AChE.

[0030] Figure 7 This is a high-sensitivity detection-concentration dependence plot of TDN1 pair in Example 1 of the present invention. Figure 7 In the figure, (a) is a histogram of the statistical distribution of the average event blocking amplitude of TDN1 and different concentrations of AChE, (b) is a two-dimensional contour plot of the current amplitude versus the residence time of the TDN1-AChE complex, (c) is the corresponding linear relationship, and (d) is the linear correlation from 30 fM to 600 pM in (c).

[0031] Figure 8 This is a high-specificity detection diagram of TDN1 for AChE in Example 1 of the present invention. Figure 8(a) shows the current-time trajectory of the interaction between TDN1 and AChE and other interfering proteins, and their mixing at 1000 mV; (b) shows the statistical data on the binding ratio; and (c) shows the current-blocking two-dimensional contour plot of the residence time of the interaction.

[0032] Figure 9 This is a graph showing the real-time kinetic monitoring of AChE activity by TDN1 in Example 1 of the present invention. Figure 9 In the figure, (a) shows the kinetics of the inhibitory effect over time, and (b) shows the relationship between the binding rate of TDN1 and AChE and the inhibition time.

[0033] Figure 10 The graphs show the thermal inactivation repair performance of TDN1 in Example 1 and TDN2 in Comparative Example 1 of this invention on AChE activity. Figure 10 In the figure, (a) the influence of the presence of Mg and the structure of TDN on the original current trace of AChE regeneration after thermal deactivation at 50 °C, (b) and (c) are the corresponding regeneration kinetic binding rate statistics, and (d) is the UV-Vis absorption spectroscopy used to confirm the presence of Mg in the regeneration experiment of AChE after thermal deactivation at 50 °C. 2+ The presence and renaturation function of closed TDNs, (e) is an experimental diagram of the renaturation kinetics of circular DNA tetrahedral TDN1 on AChE that is thermally inactivated at 50℃ in the presence of Mg by UV-Vis absorption spectroscopy, and (f) is an experimental diagram of the renaturation kinetics of open TDN2 on AChE that is thermally inactivated at 50℃ in the presence of Mg by UV-Vis absorption spectroscopy.

[0034] Figure 11 This is a scanning electron microscope image of the nanopore size of the glass capillary of the present invention. Detailed Implementation

[0035] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0036] It should be noted that the technical terms used in this invention are only for the purpose of describing specific embodiments and are not intended to limit the scope of protection of this invention. Unless otherwise specified, all raw materials, reagents, instruments and equipment used in the following embodiments of this invention can be purchased from the market or prepared by existing methods.

[0037] Currently, research on regulating nanopore signals by utilizing interactions between biomacromolecules (such as antigen-antibody and enzyme-inhibitor interactions) is gaining momentum, providing new ideas for immobilization-free detection strategies. For example, DNA nanotechnology, especially the self-assembly of structural DNA, offers new solutions to the aforementioned challenges. DNA tetrahedra, as a classic three-dimensional framework nucleic acid structure, has become a 'molecular Lego' for constructing ideal biosensor interfaces due to its unique properties: 1) Rigid and precise structure: Formed by the self-assembly of four DNA strands with specific sequences, it has uniform size (~several nanometers), structural stability, precise positioning, chemical stability, and ease of programming design. When it passes through a nanopore, it can generate a uniform and characteristic current blocking signal; 2) Site-specific functionalization: Its four vertices can be precisely modified with different functional molecules (such as thio groups, amino groups, biotin, or specific DNA sequences), achieving controllable and directional arrangement of recognition elements in three-dimensional space. Functional DNA nanostructures, due to their structural simplicity and high stability, have been used for the detection of single-protein molecules.

[0038] To enhance signal strength and specificity, researchers have proposed improved schemes involving the introduction of functionalized carriers. For example, one existing approach involves modifying the inner wall or rim of a nanopore with recognition molecules (such as aptamers or antibodies) to specifically capture the target analyte and generate a stronger blocking signal. Another representative approach utilizes nanostructures such as DNA origami as carriers to load multiple signal molecules, amplifying the signal through the interaction between the carrier and the pore. However, these existing carrier schemes still face the following key unresolved issues:

[0039] (1) Disordered immobilization interface: The immobilization of recognition molecules on the surface of the pores is random, resulting in inconsistent orientation and density, and poor performance reproducibility.

[0040] (2) The design of the vector is simple and the function is fixed: the existing vector (such as linear DNA, simple nanoparticles) has a non-programmable structure, making it difficult to systematically optimize its size, charge and spatial configuration to match specific enzyme reactions.

[0041] (3) Low signal transduction efficiency: The coupling between the carrier and the enzyme reaction is indirect or inefficient, failing to achieve efficient transduction of 'one enzyme reaction event' corresponding to 'one significant carrier signal change'.

[0042] (4) The relationship between carrier structure and performance is not considered: In particular, there is a lack of research schemes to actively regulate and maximize the sensing performance by changing the three-dimensional structural parameters of the carrier (such as vertex modification mode, rigidity, and spatial steric hindrance).

[0043] Therefore, label-free, real-time, single-molecule-level enzyme kinetic analysis is difficult to achieve. How to achieve highly specific and sensitive detection, especially how to convert enzyme functional activity (rather than simply its presence) into a resolvable electrical signal, remains a major challenge in this field.

[0044] Based on this, the present invention provides a label-free, substrate-free, and low-cost method for monitoring protease activity and applies it to actual sample detection. Specifically:

[0045] On one hand, the present invention provides a biosensor for detecting active acetylcholinesterase, comprising: Nanotubes with nanopores at their tips are used to generate current blocking signals.

[0046] A circular DNA tetrahedral carrier is used to load a test solution containing active acetylcholinesterase. The circular DNA tetrahedral carrier is either TDN1 or TDN4. Both TDN1 and TDN4 are formed by the annealing and self-assembly of four single-stranded DNA. The sequences of the four single-stranded DNA of TDN1 are shown in SEQ ID NO.1 to SEQ ID NO.4; the sequences of the four single-stranded DNA of TDN4 are shown in SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5 and SEQ ID NO.6.

[0047] The circular DNA tetrahedral carrier binds to active acetylcholinesterase in the test solution, generating a current blocking signal through the nanopore size of the nanotube, enabling single-molecule detection of active acetylcholinesterase.

[0048] In this invention, a highly stable, spatially closed DNA tetrahedron (a loop-constrained aptamer-functionalized DNA tetrahedron) is used as a functionalized carrier for active AChE. The difference in current signals generated in the nanopore before and after binding with active AChE enables highly sensitive and selective detection of AChE activity. Figure 1As shown, four single-stranded DNA molecules were first placed in a hybridization buffer using a self-assembly technique and annealed at 95°C. After annealing, the molecules were cooled to 4°C within 10 minutes to obtain a circular DNA tetrahedron carrier, constructing a structurally stable, spatially closed, and precisely tunable circular DNA tetrahedron. This tetrahedron was designed to have a specific affinity for active AChE. Its stable circular DNA tetrahedron structure ensures that the spatial orientation of the binding site is fixed and not easily destroyed, thus providing a high-affinity and high-specificity binding interface for active AChE. When this tetrahedron passes through a nanopore alone, it generates a stable and reproducible small current blocking signal due to its moderate size. Secondly, based on nanotubes with nanopores at their tips, free active AChE, due to its volume being much smaller than the nanopore pore size, cannot generate a distinguishable current signal on its own. However, when active AChE binds to the aforementioned circular DNA tetrahedron carrier, a "tetrahedron-AChE" complex is formed. The composite exhibits a significantly increased effective blocking volume through the nanopores due to the attachment of AChE, resulting in a significantly amplified and easily distinguishable current blocking signal, which is defined as the "characteristic signal." The appearance of the characteristic signal directly and specifically indicates the presence of active AChE molecules and their successful binding to the support. Ultimately, the activity of AChE can be quantitatively analyzed by statistically analyzing the frequency of the characteristic signal per unit time. The signal frequency is directly proportional to the concentration of active AChE.

[0049] The core advantages of this method are: High sensitivity: A single AChE molecule binding event is converted into a significantly amplified electrical signal, achieving detection at the single-molecule level. High selectivity: The stable tetrahedral structure of the looped DNA provides a precise binding interface. Combined with dual discrimination of "characteristic signal" and inhibitor verification, interference from non-specific binding in complex samples is effectively eliminated. Label-free and real-time: The entire detection process requires no chemical labeling of the enzyme or substrate and can monitor binding events in real time, reflecting the dynamics of enzyme activity.

[0050] In some embodiments, the molar ratio of the four DNA single strands is 1:1:1:1, the concentration of the circular DNA tetrahedral carrier is 2 μM, the concentration of Tris-HCl in the Tris-HCl / MgCl2 buffer is 20 mM, the concentration of MgCl2 is 50 mM, and the annealing time is 5 min to 15 min. In this invention, the circular DNA tetrahedral carrier needs to be diluted to the corresponding concentration when used for detecting active acetylcholinesterase.

[0051] In some embodiments, the nanotubes are glass capillaries with nanopore sizes of 35 nm to 45 nm. In this invention, the nanotubes are obtained by laser drawing of quartz capillaries to achieve nanopore sizes at the tips. The quartz capillaries are of model QF100-70-10, with an outer diameter of 1.0 mm and an inner diameter of 0.7 mm, and are drawn using a P-2000 laser drawing tool. Before drawing, the quartz capillaries are soaked in a piranha solution (30% concentrated sulfuric acid, 70% hydrogen peroxide). After thorough cleaning and drying with distilled water and ethanol, they are drawn using the following parameters: Heat=675, Fil=3, Vel=35, Del=180, Pull=190. A scanning electron microscope image of the nanopore size of the glass capillary is shown below. Figure 11 As shown.

[0052] On the other hand, the present invention provides the application of the above-mentioned biosensor for detecting acetylcholinesterase activity in the detection of acetylcholinesterase activity.

[0053] Furthermore, this includes the following steps: S1. Mix the test solution containing active acetylcholinesterase and the circular DNA tetrahedral carrier in a buffer solution and incubate to form a mixed solution.

[0054] In the mixed solution, the concentration of the circular DNA tetrahedral carrier was 25 nM–35 nM, and the buffer solution consisted of 20 mM Tris-HCl, 1 mM MgCl2, and 600 mM NaCl. The incubation temperature was 37°C.

[0055] S2. Place the mixed solution inside the nanotube, then immerse it in the working electrode, and immerse the working electrode and reference electrode in the electrolyte solution to form an electrode system; or immerse the reference electrode inside the nanotube containing the electrolyte solution, and immerse the working electrode and reference electrode in the mixed solution to form an electrode system.

[0056] It should be noted that, in a preferred embodiment, the mixed solution is placed inside the nanotube and then immersed in the working electrode. The working electrode and the reference electrode are then immersed in the electrolyte solution to form an electrode system.

[0057] S3. Apply voltage to the electrode system and detect the current blocking signal at the tip of the nanotube. Based on the characteristic changes of the current blocking signal, the activity of acetylcholinesterase can be detected.

[0058] In this invention, a Multiclamp 700B amplifier (Axon Instruments, USA) in voltage clamp mode and equipped with Clampex 11.2 software were used to record ion current traces. Current-voltage (IV) and current-time (It) records were plotted using Clampfit 11.2 software and Origin 2024b. IV curves were recorded by scanning from -1.0V to +1.0V in +100mV increments, while detection was performed at different voltages in gapless mode with a sampling frequency of 100kHz and a low-pass filter of 2kHz.

[0059] In some embodiments, the electrolyte is the buffer solution described above, which is composed of 20 mM Tris-HCl, 1 mM MgCl2 and 600 mM NaCl.

[0060] This invention achieves the monitoring of protease activity through the organic combination of "structurally programmable loop DNA tetrahedrons" and "nanotubes with nanopores at the tip," with the following advantages: (1) Structure-driven high-efficiency signal transduction and amplification: The loop DNA tetrahedron acts as a pre-assembled "signal amplifier" with a size matched to the nanopore. Enzyme activity does not directly generate an electrical signal, but rather changes the net charge or local hydrophobicity of the entire tetrahedron (approximately 5nm to 10nm in size) instantaneously by specifically binding to the DNA carrier. This "overall change in carrier properties" strategy transforms a small change in enzyme activity into a significant and easily detectable current blocking signal generated when a sufficiently large object passes through the nanopore. This fundamentally solves the bottleneck problem of low signal transduction efficiency in single-molecule enzyme detection. (2) "Programmable" structure enables active optimization of performance: The structure of the loop DNA tetrahedron has atomically precise designability. By changing its structure, the size of the carrier itself can be controlled, thereby changing its translocation speed and degree of blockage through the nanopore; by changing the specific structure (open or closed) binding AChE, the kinetics and probability of enzyme binding to the carrier can be controlled. This makes the performance of the present invention no longer a result of "luck", but can be actively optimized through calculation and design. For example, for low-activity samples, tetrahedrons with higher sensitivity can be designed to increase the capture probability and improve detection sensitivity; for high-throughput inhibitor screening, tetrahedrons with optimal binding kinetics can be designed to obtain the optimal signal-to-noise ratio and detection throughput. This is something that no existing immobilized enzyme sensor can achieve. (3) Real-time, label-free single-molecule kinetic analysis: When a single AChE molecule randomly collides in solution and binds to a DNA tetrahedron, the reaction of active AChE binding to the looped DNA tetrahedron occurs immediately, and the carrier properties change. Once this "modified" carrier enters the nanopore under electrophoretic drive, it generates an easily distinguishable signal, and its translocation event is recorded in real time. By analyzing the dwell time and amplitude distribution of consecutive events, the microscopic dynamics of enzyme activity changes can be inverted. This allows for real-time observation of enzyme behaviors that are invisible to traditional methods, without any labeling, such as changes in enzyme activity, different active conformational states of enzyme molecules, and the dynamic transformation of the reversible binding of inhibitors to enzymes (manifested as random switching of current signals). This opens up entirely new avenues for fundamental research in enzymology and the study of drug mechanisms of action.

[0061] The following specific examples will provide further explanation.

[0062] The sequences of the four DNA single strands involved in the following examples and comparative examples are shown in Table 1.

[0063] Table 1. Sequences of the four DNA single strands involved in the examples and comparative examples. SEQ ID NO.1: CATAACCTGGGAGCGTAGATAATGTCGAACGATGTGACAGTTGACGGACCACTAT。

[0064] SEQ ID NO.2: GGTCGCATCCTAAGGGTGCATCACAGCAAAATAGTGGTCCGTCAACTAACTTCTCGGC。

[0065] SEQ ID NO.3: TACGCTCCCAGGTTATGTTTGCTGTGATGCACCCTTCGTGTAAGGATTCAGACTT。

[0066] SEQ ID NO.4: AAGTCTGAATCCTTACATTGATGCGACCGGTTGACTGTAGCTCTGGCAGACGTAGTGTGAAGGTACCGCCGAGAAGAGCACATCGTTCGACATTA。

[0067] SEQ ID NO.5: ATAGTGGTCCGTCAACTAACTTCTCGGCGGTCGCACCTAAGGGTGCATCACAGCA。

[0068] SEQ ID NO.6: GTCTGAATCCTTACATTGGTTGACTGTAGCTCTGGCAGACGTAGTGTGAAGGTACCTTGTGCGACCGCCGAGAAGAGCACATCGTTCGACATTA。

[0069] SEQ ID NO.7: GCCGAGAAGAGCACATCGTTCGACATTATTAAGTCTGAATCCTTACATTGTGCGACCGGTTGACTGTAGCTCTGGCAGACGTAGTGTGAAGGTACC。

[0070] SEQ ID NO.8: GGTTGACTGTAGCTCTGGCAGACGTAGTGTGAAGGTACC GCCGAGAAGAGCACATCGTTCGACATTATTAAGTCTGAATCCTTACATTGTGCGACC。

[0071] SEQ ID NO.9: GTGCGACCGAGAAGAGCACATCGTTCGACATTATTGTCTGAATCCTTACATT GGTTGACTGTAGCTCT GGCAGACGTAGTGTGAAGGTACC .

[0072] The underlined part represents the aptamer section.

[0073] Example 1 A biosensor for detecting active acetylcholinesterase, comprising: Nanotubes with nanopores at their tips are used to generate current blocking signals.

[0074] Circular DNA tetrahedral carriers are used to load detection solutions containing active acetylcholinesterase, such as... Figure 1 As shown, the looped DNA tetrahedral carrier is TDN1, which is formed by the self-assembly of four DNA single strands through annealing. The sequences of the four DNA single strands of TDN1 are shown in SEQ ID NO.1 to SEQ ID NO.4.

[0075] The method for preparing a circular DNA tetrahedral vector includes the following steps: Four DNA single strands were placed in equal molar amounts in a Tris-HCl / MgCl2 buffer solution with a Tris-HCl concentration of 20 mM and a MgCl2 concentration of 50 mM. The solution was annealed at 95 °C for 5 min and then rapidly cooled to 4 °C within 10 min to obtain a circular DNA tetrahedral vector with a concentration of 2 μM, which is TDN1.

[0076] The method for preparing nanotubes includes the following steps: Quartz capillaries with an outer diameter of 1.0 mm and an inner diameter of 0.7 mm were immersed in a piranha solution (30% concentrated sulfuric acid, 70% hydrogen peroxide), thoroughly cleaned and dried with distilled water and ethanol, and then drawn using a P-2000 laser drawing machine with the following parameters: Heat=675, Fil=3, Vel=35, Del=180, Pull=190, resulting in glass nanotubes with nanopores at the tips.

[0077] Example 2 A biosensor for detecting active acetylcholinesterase differs from Example 1 in that the sequences of the four single strands of DNA of TDN4 are shown in SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5 and SEQ ID NO.6.

[0078] The method for preparing a circular DNA tetrahedral vector includes the following steps: Four DNA single strands were placed in equal molar amounts in a Tris-HCl / MgCl2 buffer solution with a Tris-HCl concentration of 20 mM and a MgCl2 concentration of 50 mM. The solution was annealed at 95 °C for 5 min and then rapidly cooled to 4 °C within 10 min to obtain a circular DNA tetrahedral vector with a concentration of 2 μM, which is TDN4.

[0079] The method for preparing nanotubes includes the following steps: Quartz capillaries with an outer diameter of 1.0 mm and an inner diameter of 0.7 mm were immersed in a piranha solution (30% concentrated sulfuric acid, 70% hydrogen peroxide), thoroughly cleaned and dried with distilled water and ethanol, and then drawn using a P-2000 laser drawing machine with the following parameters: Heat=675, Fil=3, Vel=35, Del=180, Pull=190, resulting in glass nanotubes with nanopores at the tips.

[0080] Comparative Example 1 A biosensor for detecting active acetylcholinesterase differs from Example 1 in that it employs an open DNA tetrahedral carrier, such as... Figure 1 As shown, the open DNA tetrahedral vector is TDN2, and the sequences of the four DNA single strands of TDN2 are shown in SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5 and SEQ ID NO.7.

[0081] The preparation method of an open DNA tetrahedral vector includes the following steps: Four DNA single strands were placed in equal molar amounts in a Tris-HCl / MgCl2 buffer solution with a Tris-HCl concentration of 20 mM and a MgCl2 concentration of 50 mM. The mixture was annealed at 95 °C for 5 min and then rapidly cooled to 4 °C within 10 min to obtain an open DNA tetrahedral vector with a concentration of 2 μM, which is TDN2.

[0082] The method for preparing nanotubes includes the following steps: Quartz capillaries with an outer diameter of 1.0 mm and an inner diameter of 0.7 mm were immersed in a piranha solution (30% concentrated sulfuric acid, 70% hydrogen peroxide), thoroughly cleaned and dried with distilled water and ethanol, and then drawn using a P-2000 laser drawing machine with the following parameters: Heat=675, Fil=3, Vel=35, Del=180, Pull=190, resulting in glass nanotubes with nanopores at the tips.

[0083] Comparative Example 2 A biosensor for detecting active acetylcholinesterase differs from Example 1 in that it employs an open DNA tetrahedral carrier, such as... Figure 1 As shown, the open DNA tetrahedral vector is TDN3, and the sequences of the four DNA single strands of TDN3 are shown in SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5 and SEQ ID NO.8.

[0084] The preparation method of an open DNA tetrahedral vector includes the following steps: Four DNA single strands were placed in equal molar amounts in a Tris-HCl / MgCl2 buffer solution with a Tris-HCl concentration of 20 mM and a MgCl2 concentration of 50 mM. The mixture was annealed at 95 °C for 5 min and then rapidly cooled to 4 °C within 10 min to obtain a DNA tetrahedral vector. The concentration of the open DNA tetrahedral vector was 2 μM, which is TDN3.

[0085] The method for preparing nanotubes includes the following steps: Quartz capillaries with an outer diameter of 1.0 mm and an inner diameter of 0.7 mm were immersed in a piranha solution (30% concentrated sulfuric acid, 70% hydrogen peroxide), thoroughly cleaned and dried with distilled water and ethanol, and then drawn using a P-2000 laser drawing machine with the following parameters: Heat=675, Fil=3, Vel=35, Del=180, Pull=190, resulting in glass nanotubes with nanopores at the tips.

[0086] Comparative Example 3 A biosensor for detecting active acetylcholinesterase differs from Example 1 in that it employs an open DNA tetrahedral carrier, such as... Figure 1 As shown, the open DNA tetrahedral vector is TDN5, and the sequences of the four DNA single strands of TDN5 are shown in SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5 and SEQ ID NO.9.

[0087] The preparation method of an open DNA tetrahedral vector includes the following steps: Four DNA single strands were placed in equal molar amounts in a Tris-HCl / MgCl2 buffer solution with a Tris-HCl concentration of 20 mM and a MgCl2 concentration of 50 mM. The mixture was annealed at 95 °C for 5 min and then rapidly cooled to 4 °C within 10 min to obtain an open DNA tetrahedral vector with a concentration of 2 μM, which is TDN5.

[0088] The method for preparing nanotubes includes the following steps: Quartz capillaries with an outer diameter of 1.0 mm and an inner diameter of 0.7 mm were immersed in a piranha solution (30% concentrated sulfuric acid, 70% hydrogen peroxide), thoroughly cleaned and dried with distilled water and ethanol, and then drawn using a P-2000 laser drawing machine with the following parameters: Heat=675, Fil=3, Vel=35, Del=180, Pull=190, resulting in glass nanotubes with nanopores at the tips.

[0089] The biosensors of Examples 1-2 and Comparative Examples 1-3 were used for the detection of acetylcholinesterase activity, including the following steps: S1. Using the TDN tetrahedral structure from Examples 1 to 2 and Comparative Examples 1 to 3 as a carrier, it was mixed with active AChE in a buffer solution at a certain ratio and incubated in a water bath at 37°C to form a mixed solution. The concentration of the TDN tetrahedral structure in the mixed solution was 30 nM and the concentration of active AChE was 6 nM. This solution was named TDN-AChE.

[0090] S3. Place the mixed solution inside the nanotube and then immerse it in the working electrode. Immerse the working electrode and the reference electrode in the electrolyte solution to construct a dual-electrode system.

[0091] S4. Ion current traces were recorded using a Multiclamp 700B amplifier in voltage clamp mode and the accompanying Clampex 11.2 software. Current-voltage (IV) and current-time (It) records were plotted using Clampfit 11.2 software and Origin 2024b. IV curves were recorded by scanning from -1.0V to +1.0V in increments of +100mV, while detection was performed at different voltages in gapless mode with a sampling frequency of 100kHz and a low-pass filter of 2kHz.

[0092] Figure 2 The diagram shows the integration of the TDN tetrahedral structure with AChE in Examples 1-2 and Comparative Examples 1-3 of the present invention. Figure 2 In the diagram, (a) shows the AChE and original current traces for different TDN combinations, (b) shows the histogram of the statistical distribution of the average event blocking amplitude for different TDN combinations with AChE, and (c) shows the corresponding statistical data for the combination ratio. Figure 2As shown, the TDN1 and TDN4 tetrahedrals of the circular DNA bundle exhibit stronger binding affinity to AChE, with a higher relative event frequency of the complex. In contrast, the open-type TDN2, TDN3, and TDN5 show predominantly TDN RPS signals. The rigid scaffold of the circular bundle's tetrahedron exposes more binding sites, which is beneficial for AChE binding. The reduced rigidity of the open-type tetrahedron increases its flexibility, thus weakening the binding affinity. Notably, the activity of TDN1 and TDN4 tetrahedrons for AChE can be monitored more sensitively. The addition of neostigmine significantly reduces the characteristic signal of the complex, with most of the signal being TDN RPS signals, while the binding rate of the open-type inhibitor shows almost no change before and after addition. This demonstrates the feasibility of monitoring AChE activity using the circular bundle's TDN1.

[0093] Figure 3 This is a nanopore analysis diagram for the activity detection of TDN1 in Example 1 of the present invention. Figure 3 In the diagram, (a) represents TDN1, (a1) represents TDN-AChE, (b) is a two-dimensional contour plot of current amplitude and residence time for (a), (b1) is a two-dimensional contour plot of current amplitude and residence time for (a1), (c) is a histogram of the statistical distribution of the average event blocking amplitude for (a), and (c1) is a histogram of the statistical distribution of the average event blocking amplitude for (c1). Figure 3 As shown, taking a 60nm glass nanopore as an example for single-molecule detection, TDN produces a smaller RPS signal with a current amplitude of 30±11.63pA, while TDN-AChE produces a larger RPS signal with a current amplitude of 69.83±9.76pA, which can be clearly distinguished from the TDN signal. Within the nanopore, the translocation of target molecules is influenced by multiple factors such as diffusion, electrophoresis, and electroosmosis. This phenomenon is mainly attributed to the combined effect of appropriate volume and charge effects of TDN and TDN-AChE. This size of nanopore can simultaneously accommodate target molecules and amplify the current response to size differences, enabling precise monitoring of target molecules.

[0094] Changes in AChE activity are closely related to the pathological progression of Alzheimer's disease (AD), playing a crucial role, particularly in cholinergic system dysfunction. To monitor changes in AChE activity, two methods were employed: high-temperature inactivation and inhibition by an inhibitor (neostigmine). The inhibitor inactivates AChE, causing a conformational change that results in the loss of its binding ability to looped DNA tetrahedra. At this point, only unbound DNA tetrahedra remain in solution, generating only a small current signal upon passing through the nanopore, and the characteristic signal subsequently disappears. This reversible "characteristic signal appearance / disappearance" process strongly demonstrates that the detection results directly depend on the active conformation of AChE, rather than non-specific adsorption.

[0095] To monitor changes in AChE activity, before mixing with the TDN tetrahedral structure, active AChE and the inhibitor neostigmine were mixed in a 10:1 ratio and then placed at room temperature in the dark for 120 min to inactivate AChE; or inactivated by heating in a 90°C water bath for 30 min. A control group was used that inactivated AChE by heating in a 50°C water bath for 30 min.

[0096] like Figure 10 At a mid-d UV absorption of 50 °C, neostigmine's mechanism of action with AChE involves binding to serine residues at the active site of AChE, temporarily blocking the catalytic function of AChE, thereby slowing down the hydrolysis rate of the neurotransmitter ACh. With increasing neostigmine concentration from 0.12 nM to 60 nM, the characteristic signal of the complex gradually decreased, while the RPS signal of TDN gradually increased, reaching a half-inhibitory concentration of 0.8 nM. This indicates that the addition of the inhibitor occupies the active site of AChE, causing AChE to lose its ability to bind to TDN, resulting in a gradual decrease in the number of complexes formed, with more TDN monomers passing through the nanopores.

[0097] Figure 4 The diagram shows the activity evaluation of AChE by TDN1 in Example 1 and TDN2 in Comparative Example 1 of this invention. Figure 4 (a) shows the difference in activity between AChE inactivated at high temperature and AChE that maintains activity at 37℃, and (b) shows the corresponding binding ratio data. Figure 4 As shown, the circular DNA tetrahedral vector TDN1 is effective in distinguishing between AChE activity inactivated at high temperatures and AChE activity maintained at 37°C, while it is almost indistinguishable from the open-type TDN2. This further demonstrates that the circular DNA tetrahedral vector TDN1 can monitor AChE activity.

[0098] To further demonstrate that the use of neostigmine inhibition and high-temperature inactivation indeed weakens AChE activity, common fluorescence and UV-Vis experiments were employed for verification. For UV and fluorescence verification of AChE activity, the AChE catalyzes the hydrolysis of the substrate ATCh to generate thiocholine TCh, which triggers the colorimetric indicator DTNB to form the yellow product 5-thio-2-nitrobenzoic acid (TNB). UV verification of AChE activity was performed by adding 10 μM DTNB as a colorimetric reagent to a mixed solution containing ATCh and AChE, and then measuring the absorbance change of the resulting yellow product TNB at a wavelength of 412 nm using a UV-Vis spectrophotometer.

[0099] Figure 5 This is the UV-Vis absorption spectrum of the TDN tetrahedral structure of Embodiment 1 of the present invention for AChE. Figure 5As shown, under optimal conditions, AChE can catalyze the hydrolysis of the substrate ATCh to produce TCh, which triggers the colorimetric indicator DTNB to form the yellow product TNB. TNB is detected at a wavelength of 412 nm. The addition of neostigmine inhibitors and the reduction of AChE activity due to high temperature inactivation cannot cause the formation of TNB, and the peak at 412 nm disappears.

[0100] After reacting ThT and AChE in 20 mM Tris-HCl (pH=8.0) for 30 min, we used a fluorescence spectrometer to record the emission peak at 504 nm under excitation at 448 nm to verify the fluorescence activity of AChE. Figure 6 The fluorescence emission spectrum of the TDN tetrahedral structure in Example 1 against AChE is shown below. Figure 6 As shown, ThT binds to AChE and fluoresces at an excitation wavelength of 448 nm, while the fluorescence disappears when AChE is inactivated. This further demonstrates the feasibility of using inhibitors and high-temperature inactivation to reduce AChE activity.

[0101] To obtain optimal analytical performance, this invention investigated the relationship between AChE concentration and binding rate of TDN functionalized carrier. Different concentrations of AChE were used to bind to the tetrahedral TDN1 carrier. The concentrations of AChE in the test solution were 30 fM, 60 fM, 300 fM, 600 fM, 3 pM, 6 pM, 15 pM, 60 pM, 600 pM, 3 nM, 6 nM and 10 nM, respectively. Figure 7 This is a high-sensitivity detection-concentration dependence plot of TDN1 pair in Example 1 of the present invention. Figure 7 In the diagram, (a) is a histogram of the statistical distribution of the average event blocking amplitude of TDN1 versus different concentrations of AChE; (b) is a two-dimensional contour plot of the current amplitude versus the residence time of the TDN1-AChE complex; (c) shows the corresponding linear relationship; and (d) shows the linear correlation from 30 fm to 600 pm in (c). Figure 7 As shown, the binding rate of TDN-AChE depends on the AChE concentration. From 30 fM to 10 nM, the binding rate gradually increases with increasing AChE concentration, reaching equilibrium at approximately 6 nM, and exhibiting a good linear correlation between 30 fM and 600 pM. Subsequent experiments selected 6 nM AChE as the optimal concentration. The two-dimensional contour plot also demonstrates that the number of complexes increases with increasing AChE concentration, with the lowest detection line reaching 30 fM.

[0102] To test selectivity for AChE, 30 nM TDN1 and 6 nM AChE, 6 nM other interfering proteins (BSA, GSH, AA, TBA), and mixtures were measured separately. Figure 8This is a high-specificity detection diagram of TDN1 for AChE in Example 1 of the present invention. Figure 8 In the image, (a) shows the current-time trajectory of the interaction between TDN1 and AChE and other interfering proteins, and their mixing at 1000 mV; (b) is a statistical plot of the binding ratio; and (c) is a two-dimensional contour plot of current-blocking residence time for the interaction. Figure 8 As shown, due to the high specificity of the aptamer for AChE, only the binding of AChE to TDN1 produced a significant characteristic signal, while other interfering substances did not generate any. Furthermore, all coexisting proteins did not significantly interfere with the determination of AChE. Therefore, the circular DNA tetrahedron can achieve highly specific detection of AChE.

[0103] To monitor the change in AChE activity over time after the addition of neostigmine, the peak change within 160 min after the addition of neostigmine was tested. Neostigmine and AChE were placed in a buffer solution at a ratio of 10:1 and inhibited at room temperature for different times from 0 min to 160 min. Samples were taken every 10 min, and TDN1 was added. The mixture was incubated at 37°C for 120 min to monitor the binding of TDN to the nanopores, thereby reflecting the inhibition. Figure 9 This is a graph showing the real-time kinetic monitoring of AChE activity by TDN1 in Example 1 of the present invention. Figure 9 In the figure, (a) shows the kinetics of inhibition over time, and (b) shows the relationship between the binding rate of TDN1 to AChE and the inhibition time. Figure 9 As shown in the ridgeline diagram, it can be seen more intuitively that the peak amplitude of the lower TDN centered at about 25 pA becomes the main group at about 80 min, while the peak amplitude of the higher complex centered at about 70 pA gradually decreases and reaches equilibrium at about 120 min.

[0104] Figure 10 The graphs show the thermal inactivation repair performance of TDN1 in Example 1 and TDN2 in Comparative Example 1 of this invention on AChE activity. Figure 10 In the figure, (a) the influence of the presence of Mg and the structure of TDN on the original current trace of AChE regeneration after thermal deactivation at 50 °C, (b) and (c) are the corresponding regeneration kinetic binding rate statistics, and (d) is the UV-Vis absorption spectroscopy used to confirm the presence of Mg in the regeneration experiment of AChE after thermal deactivation at 50 °C. 2+ The presence and renaturation function of closed TDNs are shown in (e), which is an experimental diagram of the renaturation kinetics of circular DNA tetrahedral TDN1 on AChE inactivated by heat at 50℃ in the presence of Mg, verified by UV-Vis absorption spectroscopy; and (f) which is an experimental diagram of the renaturation kinetics of open TDN2 on AChE inactivated by heat at 50℃ in the presence of Mg, verified by UV-Vis absorption spectroscopy. Figure 10As shown in (a), for AChE that is thermally deactivated at 50 °C, in Mg 2+ The protein exhibits low binding affinity to TDN, showing only the RPS signal of TDN. However, the addition of Mg results in a significant complex signal, indicating that the presence of Mg can assist in the refolding of heat-inactivated proteases. Figure 10 As shown in (b), the refolding kinetics experiment was conducted. The binding rate gradually increased with increasing refolding time, reaching 50% at approximately 60 minutes (e.g., ...). Figure 10 As shown in (c). Figure 10 As shown in (d), UV-Vis absorption spectroscopy was used to verify the effect using DTNB as a substrate. It is clearly observed that the absorption peak at 412 nm only appears when Mg and TDN are present simultaneously. Furthermore, comparing the effects of ring-beam TDN1 and open-type TDN2 on refolding, ring-beam TDN1 showed a more significant effect on the refolding of AChE deactivated at 50 °C. The refolding kinetics of the two tetrahedral structures were also studied separately (e.g., ...). Figure 10 As shown in (e) and (f), this further illustrates that the TDN of the ring bundle is more conducive to the restoration of AChE activity. Therefore, the TDN1 of the ring bundle can not only monitor AChE activity in real time, but also restore the function of thermally deactivated AChE, realizing a new strategy of "detection-repair" integration.

[0105] The biosensor from Example 1 was used for real-world sample detection. Commercially available sterile artificial cerebrospinal fluid (ACSF) was diluted 1000-fold, and the supernatant was obtained by centrifugation at 12000 rpm. Spike recovery experiments on the ACSF samples were performed under the same conditions as the AChE activity determination. As shown in Table 2, different amounts of AChE were spiked into the 1000-fold diluted ACSF. The characteristic signals detected in the sterile ACSF environment were consistent with those in the electrolyte solution, and the measured AChE concentrations showed good correspondence with the spiked concentrations, with spike recoveries ranging from 98.16% to 102.56%. These recoveries fall within the acceptable range for real-world sample analysis, confirming the feasibility of this strategy for detecting AChE in complex samples.

[0106] Table 2. Spiked recovery experiment of AChE in artificial cerebrospinal fluid In summary, the biosensor provided by this invention establishes a quantitative database relating different DNA tetrahedral structures (variables: size, opening modification mode) to their final detection performance (output: sensitivity, linear range, signal-to-noise ratio, inhibitor detection sensitivity), which has profound beneficial effects and economic benefits.

[0107] 1. Extremely high success rate and reproducibility. Leveraging structure-activity relationship mapping, it can quickly recommend and supply optimized carrier structures for specific applications (such as detecting extremely low abundance of AChE in cerebrospinal fluid), ensuring experimental success on the first attempt and greatly improving user R&D efficiency and experience. 2. Product consistency and long-term reliability. Stable synthesis and packaging processes guarantee highly consistent performance of each batch of carrier reagents, and they are ready to use immediately after opening, lowering the user's barrier to entry and technical risks—something that cannot be matched by manual laboratory preparation.

[0108] 2. Expected Economic Benefit Model: High-end Scientific Reagent Market: As the world's only supplier providing "AChE Single-Molecular Kinetics Research Kits," we sell to neuroscience and chemical biology laboratories worldwide. Each kit (containing a DNA tetrahedral vector with a specific structure, dedicated buffer, standards, and operating procedures) can be priced from several thousand to tens of thousands of RMB, with extremely high gross profit margins. Drug Development CRO Services: We provide pharmaceutical companies with ultra-sensitive, high-information AChE inhibitor screening and characterization services based on this platform. Compared to traditional high-throughput screening, this method can provide richer kinetic parameters (such as dissociation constant and mechanism of action) in the early stages of lead compound optimization, with a service unit price and added value far exceeding conventional detection. Instrument Platform Licensing and Cooperation: We collaborate with manufacturers of nanopore sequencers or single-molecule detection equipment, promoting the "programmable vector" and "detection algorithm" of this invention as featured application modules of their instruments, and collecting technology licensing fees or sales revenue sharing. Long-term value of platform expansion: The proven "programmable DNA vector-nanopore" platform paradigm can be rapidly expanded to other important enzyme targets (such as kinases and proteases) or biomarkers (such as microRNAs and proteins), forming a large "single-molecule detection family" product line and bringing continuous growth momentum.

[0109] It should be noted that when numerical ranges are involved in this invention, it should be understood that both endpoints of each numerical range and any value between the two endpoints can be selected. Since the steps and methods used are the same as in the embodiments, preferred embodiments are described here to avoid redundancy. Although preferred embodiments of the invention have been described, those skilled in the art, once they understand the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments as well as all changes and modifications falling within the scope of this invention.

[0110] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. A biosensor for detecting active acetylcholinesterase, characterized in that, include: Nanotubes with nanopores at their tips are used to generate current blocking signals; The circular DNA tetrahedral carrier is used to load the test solution containing active acetylcholinesterase. The circular DNA tetrahedral carrier is TDN1 or TDN4. Both TDN1 and TDN4 are formed by the self-assembly of four single-stranded DNA strands through annealing. The sequences of the four DNA single strands of TDN1 are shown in SEQ ID NO.1 to SEQ ID NO.4; the sequences of the four DNA single strands of TDN4 are shown in SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5 and SEQ ID NO.

6. The circular DNA tetrahedral carrier binds to active acetylcholinesterase in the test solution, and detects the active acetylcholinesterase by generating a current blocking signal through the nanopore size of the nanotube.

2. The biosensor for detecting acetylcholinesterase activity according to claim 1, characterized in that, The method for preparing a circular DNA tetrahedral vector includes the following steps: Four single-stranded DNA molecules were placed in Tris-HCl / MgCl2 buffer and annealed at 95°C. The molecule was then cooled to 4°C within 10 min to obtain a circularly bundled DNA tetrahedral vector.

3. The biosensor for detecting active acetylcholinesterase according to claim 2, characterized in that, The molar ratio of the four DNA single strands is 1:1:1:1, and the concentration of the circular DNA tetrahedral carrier is 2 μM.

4. The biosensor for detecting active acetylcholinesterase according to claim 2, characterized in that, The Tris-HCl / MgCl2 buffer solution contains 20 mM Tris-HCl and 50 mM MgCl2, with an annealing time of 5 min to 15 min.

5. The biosensor for detecting active acetylcholinesterase according to claim 1, characterized in that, The nanotubes are glass capillaries with a nanopore size of 35nm to 45nm.

6. The use of the biosensor for detecting active acetylcholinesterase according to any one of claims 1 to 5 in the detection of active acetylcholinesterase.

7. The application according to claim 6, characterized in that, Includes the following steps: The test solution containing active acetylcholinesterase and the circular DNA tetrahedral carrier were mixed in a buffer solution and incubated to form a mixed solution. The mixed solution is placed inside a nanotube and then immersed in the working electrode. The working electrode and the reference electrode are then immersed in an electrolyte solution to form an electrode system; or the reference electrode is immersed inside a nanotube containing an electrolyte solution, and the working electrode and the reference electrode are then immersed in a mixed solution to form an electrode system. A voltage is applied to the electrode system, and the current blocking signal at the tip of the nanotube is detected. Based on the characteristic changes in the current blocking signal, the active acetylcholinesterase in the test solution is detected.

8. The application according to claim 7, characterized in that, In the mixed solution, the concentration of the circular DNA tetrahedral carrier was 25 nM to 35 nM, and the buffer solution consisted of 20 mM Tris-HCl, 1 mM MgCl2, and 600 mM NaCl.

9. The application according to claim 7, characterized in that, The voltage is -1.0V to +1.0V.

10. The application according to claim 7, characterized in that, The detection range for active acetylcholinesterase is 3 fM to 1 nM.

Images